-- dump date   	20140620_081636
-- class       	Genbank::misc_feature
-- table       	misc_feature_note
-- id	note
759913000001	chromosomal replication initiation protein; Reviewed; Region: dnaA; PRK00149
759913000002	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
759913000003	Walker A motif; other site
759913000004	ATP binding site [chemical binding]; other site
759913000005	Walker B motif; other site
759913000006	arginine finger; other site
759913000007	C-terminal domain of bacterial DnaA proteins. The DNA-binding C-terminal domain of DnaA contains a helix-turn-helix motif that specifically interacts with the DnaA box, a 9-mer motif that occurs repetitively in the replication origin oriC. Multiple...; Region: Bac_DnaA_C; cd06571
759913000008	DnaA box-binding interface [nucleotide binding]; other site
759913000009	DNA polymerase III subunit beta; Validated; Region: PRK05643
759913000010	Beta clamp domain.  The beta subunit (processivity factor) of DNA polymerase III holoenzyme, refered to as the beta clamp, forms a ring shaped dimer that encircles dsDNA (sliding clamp) in bacteria.  The beta-clamp is structurally similar to the trimeric...; Region: beta_clamp; cd00140
759913000011	putative DNA binding surface [nucleotide binding]; other site
759913000012	dimer interface [polypeptide binding]; other site
759913000013	beta-clamp/clamp loader binding surface; other site
759913000014	beta-clamp/translesion DNA polymerase binding surface; other site
759913000015	Bacterial protein of unknown function (DUF951); Region: DUF951; pfam06107
759913000016	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
759913000017	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
759913000018	non-specific DNA binding site [nucleotide binding]; other site
759913000019	salt bridge; other site
759913000020	sequence-specific DNA binding site [nucleotide binding]; other site
759913000021	GTP-binding protein YchF; Reviewed; Region: PRK09601
759913000022	YchF GTPase; Region: YchF; cd01900
759913000023	G1 box; other site
759913000024	GTP/Mg2+ binding site [chemical binding]; other site
759913000025	Switch I region; other site
759913000026	G2 box; other site
759913000027	Switch II region; other site
759913000028	G3 box; other site
759913000029	G4 box; other site
759913000030	G5 box; other site
759913000031	TGS_YchF_C: This subfamily represents TGS domain-containing YchF GTP-binding protein, a universally conserved GTPase whose function is unknown. The N-terminal domain of the YchF protein belongs to the Obg-like family of GTPases, and some members of the...; Region: TGS_YchF_C; cd04867
759913000032	Peptidyl-tRNA hydrolase (PTH) is a monomeric protein that cleaves the ester bond linking the nascent peptide and tRNA when peptidyl-tRNA is released prematurely from the ribosome. This ensures the recycling of peptidyl-tRNAs into tRNAs produced through...; Region: PTH; cd00462
759913000033	putative active site [active]
759913000034	catalytic residue [active]
759913000035	Transcription-repair coupling factor (superfamily II helicase) [DNA replication, recombination, and repair / Transcription]; Region: Mfd; COG1197
759913000036	CarD-like/TRCF domain; Region: CarD_TRCF; smart01058
759913000037	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
759913000038	ATP binding site [chemical binding]; other site
759913000039	putative Mg++ binding site [ion binding]; other site
759913000040	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
759913000041	nucleotide binding region [chemical binding]; other site
759913000042	ATP-binding site [chemical binding]; other site
759913000043	This domain is found in proteins necessary for strand-specific repair in DNA such as TRCF in Escherichia coli; Region: TRCF; smart00982
759913000044	Membrane protein involved in the export of O-antigen and teichoic acid [General function prediction only]; Region: RfbX; COG2244
759913000045	Multidrug and toxic compound extrusion family and similar proteins; Region: MATE_like; cl09326
759913000046	S4/Hsp/ tRNA synthetase RNA-binding domain; The domain surface is populated by conserved, charged residues that define a likely RNA-binding site;  Found in stress proteins, ribosomal proteins and tRNA synthetases; This may imply a hitherto unrecognized...; Region: S4; cd00165
759913000047	RNA binding surface [nucleotide binding]; other site
759913000048	Septum formation initiator [Cell division and chromosome partitioning]; Region: COG2919
759913000049	Septum formation initiator; Region: DivIC; pfam04977
759913000050	Beta-lactamase class A [Defense mechanisms]; Region: PenP; COG2367
759913000051	Beta-lactamase enzyme family; Region: Beta-lactamase2; pfam13354
759913000052	tRNA(Ile)-lysidine synthase MesJ [Cell cycle control, cell division, chromosome partitioning]; Region: MesJ; COG0037
759913000053	N-terminal domain of predicted ATPase of the PP-loop faimly implicated in cell cycle control [Cell division and chromosome partitioning]. This is a subfamily of Adenine nucleotide alpha hydrolases superfamily.Adeninosine nucleotide alpha hydrolases...; Region: PP-ATPase; cd01992
759913000054	Ligand Binding Site [chemical binding]; other site
759913000055	TilS substrate C-terminal domain; Region: TilS_C; smart00977
759913000056	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
759913000057	active site
759913000058	ATP-dependent Zn proteases [Posttranslational modification, protein turnover, chaperones]; Region: HflB; COG0465
759913000059	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
759913000060	Walker A motif; other site
759913000061	ATP binding site [chemical binding]; other site
759913000062	Walker B motif; other site
759913000063	arginine finger; other site
759913000064	Peptidase family M41; Region: Peptidase_M41; pfam01434
759913000065	amino acid transporter; Region: 2A0306; TIGR00909
759913000066	C-terminus of AA_permease; Region: AA_permease_C; pfam13906
759913000067	Transposase and inactivated derivatives, IS30 family [DNA replication, recombination, and repair]; Region: Tra8; COG2826
759913000068	Helix-turn-helix domain; Region: HTH_38; pfam13936
759913000069	Integrase core domain; Region: rve; pfam00665
759913000070	Transposase and inactivated derivatives, IS30 family [DNA replication, recombination, and repair]; Region: Tra8; COG2826
759913000071	Transposase and inactivated derivatives, IS30 family [DNA replication, recombination, and repair]; Region: Tra8; COG2826
759913000072	Helix-turn-helix domain; Region: HTH_38; pfam13936
759913000073	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3883
759913000074	Surface antigen [General function prediction only]; Region: COG3942
759913000075	CHAP domain; Region: CHAP; pfam05257
759913000076	ribose-phosphate pyrophosphokinase; Provisional; Region: PRK02269
759913000077	N-terminal domain of ribose phosphate pyrophosphokinase; Region: Pribosyltran_N; pfam13793
759913000078	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
759913000079	active site
759913000080	Recombination protein O N terminal; Region: RecO_N; pfam11967
759913000081	DNA repair protein RecO; Region: reco; TIGR00613
759913000082	Recombination protein O C terminal; Region: RecO_C; pfam02565
759913000083	putative phosphate acyltransferase; Provisional; Region: PRK05331
759913000084	acyl carrier protein; Provisional; Region: PRK12449
759913000085	phosphoribosylaminoimidazole-succinocarboxamide synthase; Reviewed; Region: PRK09362
759913000086	bacterial and archaeal 5-aminoimidazole-4-(N-succinylcarboxamide) ribonucleotide (SAICAR) synthase; Region: SAICAR_synt_PurC; cd01415
759913000087	ATP binding site [chemical binding]; other site
759913000088	active site
759913000089	substrate binding site [chemical binding]; other site
759913000090	phosphoribosylformylglycinamidine synthase, clade II; Region: FGAM-synthase; TIGR01857
759913000091	AIR (aminoimidazole ribonucleotide) synthase related protein. This family includes Hydrogen expression/formation protein HypE, AIR synthases, FGAM (formylglycinamidine ribonucleotide) synthase and Selenophosphate synthetase (SelD). The N-terminal domain...; Region: PurM-like; cl10019
759913000092	PurL subunit of the formylglycinamide ribonucleotide amidotransferase (FGAR-AT), first repeat. FGAR-AT catalyzes the ATP-dependent conversion of formylglycinamide ribonucleotide (FGAR) and glutamine to formylglycinamidine ribonucleotide (FGAM), ADP; Region: PurL_repeat1; cd02203
759913000093	dimerization interface [polypeptide binding]; other site
759913000094	ATP binding site [chemical binding]; other site
759913000095	PurL subunit of the formylglycinamide ribonucleotide amidotransferase (FGAR-AT), second repeat. FGAR-AT catalyzes the ATP-dependent conversion of formylglycinamide ribonucleotide (FGAR) and glutamine to formylglycinamidine ribonucleotide (FGAM), ADP; Region: PurL_repeat2; cd02204
759913000096	dimerization interface [polypeptide binding]; other site
759913000097	ATP binding site [chemical binding]; other site
759913000098	Type 1 glutamine amidotransferase (GATase1)-like domain found in Formylglycinamide ribonucleotide amidotransferase; Region: GATase1_FGAR_AT; cd01740
759913000099	putative active site [active]
759913000100	catalytic triad [active]
759913000101	amidophosphoribosyltransferase; Provisional; Region: PRK07272
759913000102	Glutamine amidotransferases class-II (GN-AT)_GPAT- type. This domain is found at the N-terminus of  glutamine phosphoribosylpyrophosphate (Prpp) amidotransferase (GPATase) . The glutaminase domain catalyzes amide nitrogen transfer from glutamine to the...; Region: GPATase_N; cd00715
759913000103	active site
759913000104	tetramer interface [polypeptide binding]; other site
759913000105	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
759913000106	active site
759913000107	phosphoribosylaminoimidazole synthetase; Provisional; Region: PRK05385
759913000108	PurM (Aminoimidazole Ribonucleotide [AIR] synthetase), one of eleven enzymes required for purine biosynthesis, catalyzes the conversion of formylglycinamide ribonucleotide (FGAM) and ATP to AIR, ADP, and Pi, the fifth step in de novo purine biosynthesis; Region: PurM; cd02196
759913000109	dimerization interface [polypeptide binding]; other site
759913000110	putative ATP binding site [chemical binding]; other site
759913000111	phosphoribosylglycinamide formyltransferase; Reviewed; Region: purN; PRK05647
759913000112	Phosphoribosylglycinamide formyltransferase (GAR transformylase, GART); Region: FMT_core_GART; cd08645
759913000113	active site
759913000114	substrate binding site [chemical binding]; other site
759913000115	cosubstrate binding site; other site
759913000116	catalytic site [active]
759913000117	VanZ like family; Region: VanZ; pfam04892
759913000118	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase; Provisional; Region: purH; PRK00881
759913000119	Inosine monophosphate cyclohydrolase domain. This is the N-terminal domain in the purine biosynthesis pathway protein ATIC (purH). The bifunctional ATIC protein contains a C-terminal  ATIC formylase domain that formylates...; Region: IMPCH; cd01421
759913000120	purine monophosphate binding site [chemical binding]; other site
759913000121	dimer interface [polypeptide binding]; other site
759913000122	putative catalytic residues [active]
759913000123	AICARFT/IMPCHase bienzyme; Region: AICARFT_IMPCHas; smart00798
759913000124	AICARFT/IMPCHase bienzyme; Region: AICARFT_IMPCHas; cl03362
759913000125	Surface antigen [General function prediction only]; Region: COG3942
759913000126	CHAP domain; Region: CHAP; pfam05257
759913000127	Bacterial SH3 domain; Region: SH3_5; pfam08460
759913000128	phosphoribosylamine--glycine ligase; Provisional; Region: PRK00885
759913000129	Phosphoribosylglycinamide synthetase, N domain; Region: GARS_N; pfam02844
759913000130	Phosphoribosylglycinamide synthetase, ATP-grasp (A) domain; Region: GARS_A; pfam01071
759913000131	Phosphoribosylglycinamide synthetase, C domain; Region: GARS_C; pfam02843
759913000132	Phosphoribosylcarboxyaminoimidazole (NCAIR) mutase [Nucleotide transport and metabolism]; Region: PurE; COG0041
759913000133	phosphoribosylaminoimidazole carboxylase ATPase subunit; Reviewed; Region: PRK06019
759913000134	ATP-grasp domain; Region: ATP-grasp_4; cl17255
759913000135	Domain of unknown function (DUF4041); Region: DUF4041; pfam13250
759913000136	This entry represents the putative helicase A859L; Region: T5orf172; smart00974
759913000137	adenylosuccinate lyase; Provisional; Region: PRK07492
759913000138	Adenylsuccinate lyase (ASL)_subgroup 1; Region: Adenylsuccinate_lyase_1; cd01360
759913000139	tetramer interface [polypeptide binding]; other site
759913000140	active site
759913000141	Adenylosuccinate lyase C-terminus; Region: ADSL_C; smart00998
759913000142	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
759913000143	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
759913000144	non-specific DNA binding site [nucleotide binding]; other site
759913000145	salt bridge; other site
759913000146	sequence-specific DNA binding site [nucleotide binding]; other site
759913000147	Holliday junction DNA helicase RuvB; Reviewed; Region: ruvB; PRK00080
759913000148	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
759913000149	Walker A motif; other site
759913000150	ATP binding site [chemical binding]; other site
759913000151	Walker B motif; other site
759913000152	arginine finger; other site
759913000153	Holliday junction DNA helicase ruvB C-terminus; Region: RuvB_C; pfam05491
759913000154	Protein-tyrosine-phosphatase [Signal transduction mechanisms]; Region: Wzb; COG0394
759913000155	Low molecular weight phosphatase family; Region: LMWPc; cd00115
759913000156	active site
759913000157	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4642
759913000158	MORN repeat; Region: MORN; cl14787
759913000159	Predicted acyltransferases [Lipid metabolism]; Region: COG1835
759913000160	glucans biosynthesis protein; Provisional; Region: opgC; PRK03854
759913000161	yrhL-like subfamily of SGNH-hydrolases, a diverse family of lipases and esterases. The tertiary fold of the enzyme is substantially different from that of the alpha/beta hydrolase family and unique among all known hydrolases; its active site closely...; Region: SGNH_hydrolase_yrhL_like; cd01840
759913000162	catalytic triad [active]
759913000163	catalytic triad [active]
759913000164	oxyanion hole [active]
759913000165	bifunctional acetaldehyde-CoA/alcohol dehydrogenase; Provisional; Region: PRK13805
759913000166	Coenzyme A acylating aldehyde dehydrogenase (ACDH), ALDH family 20-like; Region: ALDH_F20_ACDH; cd07122
759913000167	putative catalytic cysteine [active]
759913000168	C-terminal alcohol dehydrogenase domain of the acetaldehyde dehydrogenase-alcohol dehydrogenase bifunctional two-domain protein (AAD); Region: AAD_C; cd08178
759913000169	putative active site [active]
759913000170	metal binding site [ion binding]; metal-binding site
759913000171	ethanol-active dehydrogenase/acetaldehyde-active reductase; Provisional; Region: PRK09422
759913000172	Cinnamyl alcohol dehydrogenases (CAD); Region: CAD3; cd08297
759913000173	NAD binding site [chemical binding]; other site
759913000174	substrate binding site [chemical binding]; other site
759913000175	catalytic Zn binding site [ion binding]; other site
759913000176	tetramer interface [polypeptide binding]; other site
759913000177	structural Zn binding site [ion binding]; other site
759913000178	Threonine synthase [Amino acid transport and metabolism]; Region: ThrC; COG0498
759913000179	Threonine synthase catalyzes the final step of threonine biosynthesis. The conversion of O-phosphohomoserine into threonine and inorganic phosphate is pyridoxal 5'-phosphate dependent. The Thr-synth_1 CD includes members from higher plants; Region: Thr-synth_2; cd01560
759913000180	pyridoxal 5'-phosphate binding site [chemical binding]; other site
759913000181	catalytic residue [active]
759913000182	Na+-driven multidrug efflux pump [Defense mechanisms]; Region: NorM; COG0534
759913000183	Subfamily of the multidrug and toxic compound extrusion (MATE)-like proteins similar to Thermotoga marina NorM; Region: MATE_NorM_like; cd13137
759913000184	Transposase and inactivated derivatives, IS30 family [DNA replication, recombination, and repair]; Region: Tra8; COG2826
759913000185	Integrase core domain; Region: rve; pfam00665
759913000186	Helix-turn-helix domain; Region: HTH_38; pfam13936
759913000187	30S ribosomal protein S10; Reviewed; Region: rpsJ; PRK00596
759913000188	50S ribosomal protein L3; Validated; Region: rplC; PRK00001
759913000189	50S ribosomal protein L4; Provisional; Region: rplD; PRK05319
759913000190	50S ribosomal protein L23; Reviewed; Region: rplW; PRK05738
759913000191	50S ribosomal protein L2; Validated; Region: rplB; PRK09374
759913000192	Ribosomal Proteins L2, RNA binding domain; Region: Ribosomal_L2; pfam00181
759913000193	Ribosomal Proteins L2, C-terminal domain; Region: Ribosomal_L2_C; pfam03947
759913000194	30S ribosomal protein S19; Reviewed; Region: rpsS; PRK00357
759913000195	Ribosomal protein L22/L17e.  L22 (L17 in eukaryotes) is a core protein of the large ribosomal subunit.  It is the only ribosomal protein that interacts with all six domains of 23S rRNA, and is one of the proteins important for directing the proper...; Region: Ribosomal_L22; cd00336
759913000196	putative translocon binding site; other site
759913000197	protein-rRNA interface [nucleotide binding]; other site
759913000198	30S ribosomal protein S3; Reviewed; Region: rpsC; PRK00310
759913000199	K homology RNA-binding (KH) domain of the prokaryotic 30S small ribosomal subunit protein S3. S3  is part of the head region of the 30S ribosomal subunit and is believed to interact with mRNA as it threads its way from the latch into the channel.  The KH...; Region: 30S_S3_KH; cd02412
759913000200	G-X-X-G motif; other site
759913000201	Ribosomal protein S3, C-terminal domain; Region: Ribosomal_S3_C; pfam00189
759913000202	Ribosomal_L16_L10e: L16 is an essential protein in the large ribosomal subunit of bacteria, mitochondria, and chloroplasts. Large subunits that lack L16 are defective in peptidyl transferase activity, peptidyl-tRNA hydrolysis activity, association with...; Region: Ribosomal_L16_L10e; cd01433
759913000203	23S rRNA interface [nucleotide binding]; other site
759913000204	5S rRNA interface [nucleotide binding]; other site
759913000205	putative antibiotic binding site [chemical binding]; other site
759913000206	L25 interface [polypeptide binding]; other site
759913000207	L27 interface [polypeptide binding]; other site
759913000208	Ribosomal L29 protein/HIP.  L29 is a protein of the large ribosomal Subunit. A homolog, called heparin/heparan sulfate interacting protein (HIP), has also been identified in mammals.  L29 is located on the surface of the large ribosomal subunit, where it...; Region: Ribosomal_L29_HIP; cd00427
759913000209	23S rRNA interface [nucleotide binding]; other site
759913000210	putative translocon interaction site; other site
759913000211	signal recognition particle (SRP54) interaction site; other site
759913000212	L23 interface [polypeptide binding]; other site
759913000213	trigger factor interaction site; other site
759913000214	30S ribosomal protein S17; Reviewed; Region: rpsQ; PRK05610
759913000215	50S ribosomal protein L14; Validated; Region: rplN; PRK05483
759913000216	50S ribosomal protein L24; Reviewed; Region: rplX; PRK00004
759913000217	KOW motif of Ribosomal Protein L26; Region: KOW_RPL26; cd06089
759913000218	RNA binding site [nucleotide binding]; other site
759913000219	50S ribosomal protein L5; Validated; Region: rplE; PRK00010
759913000220	Ribosomal protein L5; Region: Ribosomal_L5; pfam00281
759913000221	ribosomal L5P family C-terminus; Region: Ribosomal_L5_C; pfam00673
759913000222	30S ribosomal protein S14; Reviewed; Region: rpsN; PRK08061
759913000223	30S ribosomal protein S8; Validated; Region: rpsH; PRK00136
759913000224	50S ribosomal protein L6; Validated; Region: rplF; PRK05498
759913000225	Ribosomal protein L6; Region: Ribosomal_L6; pfam00347
759913000226	Ribosomal protein L6; Region: Ribosomal_L6; pfam00347
759913000227	Ribosomal L18/L5e:  L18 (L5e) is a ribosomal protein found in the central protuberance (CP) of the large subunit. L18 binds 5S rRNA and induces a conformational change that stimulates the binding of L5 to 5S rRNA. Association of 5S rRNA with 23S rRNA...; Region: Ribosomal_L18_L5e; cd00432
759913000228	5S rRNA interface [nucleotide binding]; other site
759913000229	L27 interface [polypeptide binding]; other site
759913000230	23S rRNA interface [nucleotide binding]; other site
759913000231	L5 interface [polypeptide binding]; other site
759913000232	30S ribosomal protein S5; Validated; Region: rpsE; PRK00550
759913000233	Ribosomal protein S5, N-terminal domain; Region: Ribosomal_S5; pfam00333
759913000234	Ribosomal protein S5, C-terminal domain; Region: Ribosomal_S5_C; pfam03719
759913000235	Ribosomal protein L30, which is found in eukaryotes and prokaryotes but not in archaea, is one of the smallest ribosomal proteins with a molecular mass of about 7kDa. L30 binds the 23SrRNA as well as the 5S rRNA and is one of five ribosomal proteins that...; Region: Ribosomal_L30; cd01658
759913000236	23S rRNA binding site [nucleotide binding]; other site
759913000237	50S ribosomal protein L15; Reviewed; Region: rplO; PRK05592
759913000238	preprotein translocase subunit SecY; Reviewed; Region: secY; PRK09204
759913000239	SecY translocase; Region: SecY; pfam00344
759913000240	adenylate kinase; Reviewed; Region: adk; PRK00279
759913000241	Adenylate kinase (ADK) catalyzes the reversible phosphoryl transfer from adenosine triphosphates (ATP) to adenosine monophosphates (AMP) and to yield adenosine diphosphates (ADP). This enzyme is required for the biosynthesis of ADP and is essential for...; Region: ADK; cd01428
759913000242	AMP-binding site [chemical binding]; other site
759913000243	ATP-AMP (Ap5A)-binding site [chemical binding]; other site
759913000244	S1_IF1: Translation Initiation Factor IF1, S1-like RNA-binding domain. IF1 contains an S1-like RNA-binding domain, which is found in a wide variety of RNA-associated proteins. Translation initiation includes a number of interrelated steps preceding the...; Region: S1_IF1; cd04451
759913000245	rRNA binding site [nucleotide binding]; other site
759913000246	predicted 30S ribosome binding site; other site
759913000247	Ribosomal protein L36; Region: Ribosomal_L36; pfam00444
759913000248	Ribosomal protein S13 [Translation, ribosomal structure and biogenesis]; Region: RpsM; COG0099
759913000249	30S ribosomal protein S13; Region: bact_S13; TIGR03631
759913000250	30S ribosomal protein S11; Validated; Region: PRK05309
759913000251	DNA-directed RNA polymerase subunit alpha; Provisional; Region: PRK05182
759913000252	N-terminal domain of the Alpha subunit of Bacterial RNA polymerase; Region: RNAP_alpha_NTD; cd06928
759913000253	alphaNTD homodimer interface [polypeptide binding]; other site
759913000254	alphaNTD - beta interaction site [polypeptide binding]; other site
759913000255	alphaNTD - beta' interaction site [polypeptide binding]; other site
759913000256	Bacterial RNA polymerase, alpha chain C terminal domain; Region: RNA_pol_A_CTD; pfam03118
759913000257	50S ribosomal protein L17; Validated; Region: rplQ; PRK05591
759913000258	Transposase and inactivated derivatives, IS30 family [DNA replication, recombination, and repair]; Region: Tra8; COG2826
759913000259	Helix-turn-helix domain; Region: HTH_38; pfam13936
759913000260	Integrase core domain; Region: rve; pfam00665
759913000261	Nudix hydrolase is a superfamily of enzymes found in all three kingdoms of life, and it catalyzes the hydrolysis of NUcleoside DIphosphates linked to other moieties, X. Enzymes belonging to this superfamily require a divalent cation, such as Mg2+ or Mn2+...; Region: Nudix_Hydrolase; cl00447
759913000262	nudix motif; other site
759913000263	1,4-dihydroxy-2-naphthoate octaprenyltransferase; Validated; Region: PRK06080
759913000264	UbiA prenyltransferase family; Region: UbiA; pfam01040
759913000265	NADH dehydrogenase, FAD-containing subunit [Energy production and conversion]; Region: Ndh; COG1252
759913000266	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
759913000267	Bacterial Cytochrome Ubiquinol Oxidase; Region: Bac_Ubq_Cox; pfam01654
759913000268	cytochrome d ubiquinol oxidase subunit 2; Provisional; Region: PRK15003; cl12219
759913000269	Cytochrome oxidase subunit II; Region: Cyto_ox_2; pfam02322
759913000270	ABC-type transport system involved in cytochrome bd biosynthesis, ATPase and permease components [Energy production and conversion / Posttranslational modification, protein turnover, chaperones]; Region: CydD; COG4988
759913000271	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
759913000272	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
759913000273	Walker A/P-loop; other site
759913000274	ATP binding site [chemical binding]; other site
759913000275	Q-loop/lid; other site
759913000276	ABC transporter signature motif; other site
759913000277	Walker B; other site
759913000278	D-loop; other site
759913000279	H-loop/switch region; other site
759913000280	ABC-type transport system involved in cytochrome bd biosynthesis, fused ATPase and permease components [Energy production and conversion / Posttranslational modification, protein turnover, chaperones]; Region: CydC; COG4987
759913000281	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
759913000282	ATP-binding cassette domain of CydCD, subfamily C; Region: ABCC_cytochrome_bd; cd03247
759913000283	Walker A/P-loop; other site
759913000284	ATP binding site [chemical binding]; other site
759913000285	Q-loop/lid; other site
759913000286	ABC transporter signature motif; other site
759913000287	Walker B; other site
759913000288	D-loop; other site
759913000289	H-loop/switch region; other site
759913000290	Geranylgeranyl pyrophosphate synthase [Coenzyme metabolism]; Region: IspA; COG0142
759913000291	Trans-Isoprenyl Diphosphate Synthases, head-to-tail; Region: Trans_IPPS_HT; cd00685
759913000292	substrate binding pocket [chemical binding]; other site
759913000293	chain length determination region; other site
759913000294	substrate-Mg2+ binding site; other site
759913000295	catalytic residues [active]
759913000296	aspartate-rich region 1; other site
759913000297	active site lid residues [active]
759913000298	aspartate-rich region 2; other site
759913000299	4-diphosphocytidyl-2-C-methyl-D-erythritol kinase; Provisional; Region: ipk; PRK00128
759913000300	GHMP kinases N terminal domain; Region: GHMP_kinases_N; pfam00288
759913000301	GHMP kinases C terminal; Region: GHMP_kinases_C; pfam08544
759913000302	helix_turn_helix multiple antibiotic resistance protein; Region: HTH_MARR; smart00347
759913000303	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
759913000304	putative Zn2+ binding site [ion binding]; other site
759913000305	putative DNA binding site [nucleotide binding]; other site
759913000306	ABC-type cobalt transport system, ATPase component [Inorganic ion transport and metabolism]; Region: CbiO; COG1122
759913000307	ATP-binding cassette domain of the metal-type transporters; Region: ABC_Metallic_Cations; cd03235
759913000308	ABC-type Mn2+/Zn2+ transport systems, permease components [Inorganic ion transport and metabolism]; Region: ZnuB; COG1108
759913000309	Transmembrane subunit (TM), of Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters involved in the uptake of siderophores, heme, vitamin B12, or the divalent cations Mg2+ and Zn2+. PBP-dependent ABC transporters consist of...; Region: TM_ABC_iron-siderophores_like; cd06550
759913000310	ABC-ATPase subunit  interface; other site
759913000311	dimer interface [polypeptide binding]; other site
759913000312	putative PBP binding regions; other site
759913000313	tyrosyl-tRNA synthetase; Validated; Region: PRK05912
759913000314	catalytic core domain of tyrosinyl-tRNA synthetase; Region: TyrRS_core; cd00805
759913000315	active site
759913000316	HIGH motif; other site
759913000317	dimer interface [polypeptide binding]; other site
759913000318	KMSKS motif; other site
759913000319	S4/Hsp/ tRNA synthetase RNA-binding domain; The domain surface is populated by conserved, charged residues that define a likely RNA-binding site;  Found in stress proteins, ribosomal proteins and tRNA synthetases; This may imply a hitherto unrecognized...; Region: S4; cd00165
759913000320	RNA binding surface [nucleotide binding]; other site
759913000321	Membrane carboxypeptidase (penicillin-binding protein) [Cell envelope biogenesis, outer membrane]; Region: MrcB; COG0744
759913000322	Transglycosylase; Region: Transgly; pfam00912
759913000323	Penicillin binding protein transpeptidase domain; Region: Transpeptidase; cl17760
759913000324	DNA-directed RNA polymerase subunit beta; Reviewed; Region: rpoB; PRK00405
759913000325	RNA polymerase beta subunit. RNA polymerases catalyse the DNA dependent polymerization of RNA. Prokaryotes contain a single RNA polymerase compared to three in eukaryotes (not including mitochondrial. and chloroplast polymerases). Each RNA polymerase...; Region: RNA_pol_B_RPB2; cl17585
759913000326	RNA polymerase Rpb2, domain 2; Region: RNA_pol_Rpb2_2; pfam04561
759913000327	P-loop ATPase protein family; Region: ATP_bind_2; cl15794
759913000328	RNA polymerase beta subunit. RNA polymerases catalyse the DNA dependent polymerization of RNA. Prokaryotes contain a single RNA polymerase compared to three in eukaryotes (not including mitochondrial. and chloroplast polymerases). Each RNA polymerase...; Region: RNA_pol_B_RPB2; cd00653
759913000329	RPB1 interaction site [polypeptide binding]; other site
759913000330	RPB10 interaction site [polypeptide binding]; other site
759913000331	RPB11 interaction site [polypeptide binding]; other site
759913000332	RPB3 interaction site [polypeptide binding]; other site
759913000333	RPB12 interaction site [polypeptide binding]; other site
759913000334	DNA-directed RNA polymerase subunit beta'; Provisional; Region: PRK00566
759913000335	RNA polymerase Rpb1, domain 1; Region: RNA_pol_Rpb1_1; pfam04997
759913000336	RNA polymerase I subunit A N-terminus; Region: RPOLA_N; smart00663
759913000337	RNA polymerase Rpb1, domain 3; Region: RNA_pol_Rpb1_3; pfam04983
759913000338	RNA polymerase Rpb1, domain 4; Region: RNA_pol_Rpb1_4; pfam05000
759913000339	Largest subunit (beta') of Bacterial DNA-dependent RNA polymerase (RNAP), C-terminal domain; Region: RNAP_beta'_C; cd02655
759913000340	Rpb1 (beta') - Rpb6 (omega) interaction site [polypeptide binding]; other site
759913000341	G-loop; other site
759913000342	Largest subunit (beta') of Bacterial DNA-dependent RNA polymerase (RNAP), C-terminal domain; Region: RNAP_beta'_C; cd02655
759913000343	DNA binding site [nucleotide binding]
759913000344	Rpb1 (beta') - Rpb2 (beta) interaction site [polypeptide binding]; other site
759913000345	Protein of unknown function (DUF1033); Region: DUF1033; pfam06279
759913000346	RecA-like NTPases. This family includes the NTP binding domain of F1 and V1 H+ATPases, DnaB and related helicases as well as bacterial RecA and related eukaryotic and archaeal recombinases. This group also includes bacterial conjugation proteins and...; Region: RecA-like_NTPases; cl17233
759913000347	Walker A motif; other site
759913000348	ATP binding site [chemical binding]; other site
759913000349	Walker B motif; other site
759913000350	Type II secretory pathway, component PulF [Cell motility and secretion / Intracellular trafficking and secretion]; Region: PulF; COG1459
759913000351	Type II secretion system (T2SS), protein F; Region: T2SF; pfam00482
759913000352	Competence protein ComGC [Intracellular trafficking and secretion]; Region: ComGC; COG4537
759913000353	Type II secretory pathway, pseudopilin PulG [Cell motility and secretion / Intracellular trafficking and secretion]; Region: PulG; COG2165
759913000354	Type II secretory pathway pseudopilin; Region: PulG; pfam11773
759913000355	Competence protein ComGF [Intracellular trafficking and secretion]; Region: ComGF; COG4940
759913000356	Methyltransferase domain; Region: Methyltransf_31; pfam13847
759913000357	Methyltransferase domain; Region: Methyltransf_26; pfam13659
759913000358	acetate kinase A/propionate kinase 2; Reviewed; Region: PRK00180
759913000359	propionate/acetate kinase; Provisional; Region: PRK12379
759913000360	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
759913000361	non-specific DNA binding site [nucleotide binding]; other site
759913000362	salt bridge; other site
759913000363	sequence-specific DNA binding site [nucleotide binding]; other site
759913000364	CAAX protease self-immunity; Region: Abi; pfam02517
759913000365	pyrroline-5-carboxylate reductase; Region: proC; TIGR00112
759913000366	NADP oxidoreductase coenzyme F420-dependent; Region: F420_oxidored; cl17232
759913000367	Cellulase M and related proteins [Carbohydrate transport and metabolism]; Region: FrvX; COG1363
759913000368	glutamyl aminopeptidase; Region: glu_aminopep; TIGR03107
759913000369	TRX family; composed of two groups: Group I, which includes proteins that exclusively encode a TRX domain; and Group II, which are composed of fusion proteins of TRX and additional domains. Group I TRX is a small ancient protein that alter the redox...; Region: TRX_family; cd02947
759913000370	Thioredoxin-like; Region: Thioredoxin_8; pfam13905
759913000371	catalytic residues [active]
759913000372	tRNA-binding-domain-containing prokaryotic phenylalanly tRNA synthetase (PheRS) beta chain.  PheRS aminoacylate phenylalanine transfer RNAs (tRNAphe). PheRSs belong structurally to class II aminoacyl tRNA synthetases (aaRSs) but, as they aminoacylate...; Region: tRNA_bind_bactPheRS; cd02796
759913000373	putative tRNA-binding site [nucleotide binding]; other site
759913000374	Single-stranded DNA-binding protein [DNA replication, recombination, and repair]; Region: Ssb; COG0629
759913000375	SSB_OBF: A subfamily of OB folds similar to the OB fold of ssDNA-binding protein (SSB). SSBs bind with high affinity to ssDNA. They bind to and protect ssDNA intermediates during DNA metabolic pathways. All bacterial and eukaryotic SSBs studied to date...; Region: SSB_OBF; cd04496
759913000376	dimer interface [polypeptide binding]; other site
759913000377	ssDNA binding site [nucleotide binding]; other site
759913000378	tetramer (dimer of dimers) interface [polypeptide binding]; other site
759913000379	Deoxynucleoside kinases [Nucleotide transport and metabolism]; Region: COG1428
759913000380	Deoxyribonucleoside kinase (dNK) catalyzes the phosphorylation of deoxyribonucleosides to yield corresponding monophosphates (dNMPs). This family consists of various deoxynucleoside kinases including deoxyribo- cytidine (EC 2.7.1.74), guanosine (EC 2.7.1; Region: dNK; cd01673
759913000381	Substrate-binding site [chemical binding]; other site
759913000382	Substrate specificity [chemical binding]; other site
759913000383	putative TIM-barrel protein, nifR3 family; Region: nifR3_yhdG; TIGR00737
759913000384	Dihydrouridine synthase-like (DUS-like) FMN-binding domain. Members of this family catalyze the reduction of the 5,6-double bond of a uridine residue on tRNA. Dihydrouridine modification of tRNA is widely observed in prokaryotes and eukaryotes, and also...; Region: DUS_like_FMN; cd02801
759913000385	FMN binding site [chemical binding]; other site
759913000386	active site
759913000387	catalytic residues [active]
759913000388	substrate binding site [chemical binding]; other site
759913000389	Hsp33-like chaperonin; Reviewed; Region: hslO; PRK00114
759913000390	Heat shock protein 33 (Hsp33):  Cytosolic protein that acts as a molecular chaperone under oxidative conditions.  In normal (reducing) cytosolic conditions, four conserved Cys residues are coordinated by a Zn ion. Under oxidative stress (such as heat...; Region: Hsp33; cd00498
759913000391	dimerization interface [polypeptide binding]; other site
759913000392	domain crossover interface; other site
759913000393	redox-dependent activation switch; other site
759913000394	Mga helix-turn-helix domain; Region: Mga; pfam05043
759913000395	M protein trans-acting positive regulator (MGA) PRD domain; Region: PRD_Mga; pfam08270
759913000396	fimbrial isopeptide formation D2 domain; Region: RrgB_K2N_iso_D2; TIGR04226
759913000397	Cna protein B-type domain; Region: Cna_B; pfam05738
759913000398	Sortase C (SrtC) or subfamily-3 sortases are membrane cysteine transpeptidases found in Gram-positive bacteria that anchor surface proteins to peptidoglycans of the bacterial cell wall envelope. This involves a transpeptidation reaction in which the...; Region: Sortase_C_3; cd05827
759913000399	active site
759913000400	catalytic site [active]
759913000401	Sortase C (SrtC) or subfamily-3 sortases are membrane cysteine transpeptidases found in Gram-positive bacteria that anchor surface proteins to peptidoglycans of the bacterial cell wall envelope. This involves a transpeptidation reaction in which the...; Region: Sortase_C_3; cd05827
759913000402	active site
759913000403	catalytic site [active]
759913000404	Cna protein B-type domain; Region: Cna_B; pfam05738
759913000405	Von Willebrand factor type A (vWA) domain was originally found in the blood coagulation protein von Willebrand factor (vWF). Typically, the vWA domain is made up of approximately 200 amino acid residues folded into a classic a/b para-rossmann type of...; Region: vWFA; cd00198
759913000406	metal ion-dependent adhesion site (MIDAS); other site
759913000407	Cna protein B-type domain; Region: Cna_B; pfam05738
759913000408	Sortase C (SrtC) or subfamily-3 sortases are membrane cysteine transpeptidases found in Gram-positive bacteria that anchor surface proteins to peptidoglycans of the bacterial cell wall envelope. This involves a transpeptidation reaction in which the...; Region: Sortase_C_3; cd05827
759913000409	active site
759913000410	catalytic site [active]
759913000411	Cna protein B-type domain; Region: Cna_B; pfam05738
759913000412	Cna protein B-type domain; Region: Cna_B; pfam05738
759913000413	Cna protein B-type domain; Region: Cna_B; pfam05738
759913000414	Cna protein B-type domain; Region: Cna_B; pfam05738
759913000415	C-terminus of bacterial fibrinogen-binding adhesin; Region: SdrG_C_C; pfam10425
759913000416	Cna protein B-type domain; Region: Cna_B; pfam05738
759913000417	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2964
759913000418	YheO-like PAS domain; Region: PAS_6; pfam08348
759913000419	HTH domain; Region: HTH_22; pfam13309
759913000420	YjgF, YER057c, and UK114 belong to a large family of proteins present in bacteria, archaea, and eukaryotes with no definitive function. The conserved domain is similar in structure to chorismate mutase but there is no sequence similarity and no...; Region: YjgF_YER057c_UK114_family; cd00448
759913000421	homotrimer interaction site [polypeptide binding]; other site
759913000422	putative active site [active]
759913000423	Phosphotransferase system, EIIC; Region: PTS_EIIC_2; pfam13303
759913000424	Phosphotransferase system, fructose-specific IIC component [Carbohydrate transport and metabolism]; Region: FruA; COG1299
759913000425	Uncharacterized protein involved in tellurite resistance [Inorganic ion transport and metabolism]; Region: TelA; COG3853
759913000426	Adenylosuccinate synthetase; Region: Adenylsucc_synt; smart00788
759913000427	Adenylosuccinate synthetase (AdSS) catalyzes the first step in the de novo biosynthesis of AMP. IMP and L-aspartate are conjugated in a two-step reaction accompanied by the hydrolysis of GTP to GDP in the presence of Mg2+. In the first step, the...; Region: AdSS; cd03108
759913000428	GDP-binding site [chemical binding]; other site
759913000429	ACT binding site; other site
759913000430	IMP binding site; other site
759913000431	Uncharacterized ABC-type transport system, periplasmic component/surface lipoprotein [General function prediction only]; Region: Med; COG1744
759913000432	Periplasmic binding domain of basic membrane lipoprotein, PnrA, in Treponema pallidum and its homologs from other bacteria and Archaea; Region: PBP1_BmpA_PnrA_like; cd06354
759913000433	ligand binding site [chemical binding]; other site
759913000434	glycyl-radical enzyme activating protein family; Region: PFLE_PFLC; TIGR02494
759913000435	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
759913000436	FeS/SAM binding site; other site
759913000437	Transcriptional regulators of sugar metabolism [Transcription / Carbohydrate transport and metabolism]; Region: GlpR; COG1349
759913000438	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
759913000439	DNA-binding site [nucleotide binding]; DNA binding site
759913000440	DeoR C terminal sensor domain; Region: DeoRC; pfam00455
759913000441	Transcriptional regulator, contains sigma factor-related N-terminal domain [Transcription]; Region: DeoR; COG2390
759913000442	Homeodomain-like domain; Region: HTH_23; cl17451
759913000443	Putative sugar-binding domain; Region: Sugar-bind; pfam04198
759913000444	PTS_IIA, PTS system, lactose/cellobiose specific IIA subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This...; Region: PTS_IIA_lac; cd00215
759913000445	active site
759913000446	methionine cluster; other site
759913000447	phosphorylation site [posttranslational modification]
759913000448	metal binding site [ion binding]; metal-binding site
759913000449	PTS_IIB_chitobiose_lichenan: subunit IIB of enzyme II (EII) of the N,N-diacetylchitobiose-specific and lichenan-specific phosphoenolpyruvate:carbohydrate phosphotransferase system (PTS). In these systems, EII is either a lichenan- or an N; Region: PTS_IIB_chitobiose_lichenan; cd05564
759913000450	active site
759913000451	P-loop; other site
759913000452	phosphorylation site [posttranslational modification]
759913000453	Phosphotransferase system cellobiose-specific component IIC [Carbohydrate transport and metabolism]; Region: CelB; COG1455
759913000454	cellobiose phosphotransferase system IIC component; Reviewed; Region: celD; PRK09592
759913000455	Pyruvate-formate lyase [Energy production and conversion]; Region: PflD; COG1882
759913000456	Pyruvate formate lyase 2 and related enzymes; Region: PFL2_DhaB_BssA; cd01677
759913000457	dimer interface [polypeptide binding]; other site
759913000458	active site
759913000459	glycine loop; other site
759913000460	Transaldolase-like fructose-6-phosphate aldolases (FSA) found in bacteria and archaea; Region: Transaldolase_FSA; cd00956
759913000461	active site
759913000462	intersubunit interactions; other site
759913000463	catalytic residue [active]
759913000464	Glycerol dehydrogenase and related enzymes [Energy production and conversion]; Region: GldA; COG0371
759913000465	Glycerol dehydrogenases (GlyDH) catalyzes oxidation of glycerol to dihydroxyacetone in glycerol dissmilation; Region: GlyDH; cd08170
759913000466	dimer interface [polypeptide binding]; other site
759913000467	active site
759913000468	metal binding site [ion binding]; metal-binding site
759913000469	Phosphatidylglycerophosphatase A; a bacterial membrane-associated enzyme involved in lipid metabolism; Region: PgpA; cd06971
759913000470	tetramer interfaces [polypeptide binding]; other site
759913000471	binuclear metal-binding site [ion binding]; other site
759913000472	Microcin C7 self-immunity protein determines resistance to exogenous microcin C7; Region: Peptidase_S66_mccF_like; cd07062
759913000473	putative dimer interface [polypeptide binding]; other site
759913000474	catalytic triad [active]
759913000475	This CD includes bacterial (Agrobacterium tumefaciens and Caulobacter crescentus ProX, and Clostridium sticklandii PrdX) and eukaryotic (Plasmodium falciparum N-terminal ProRS editing domain) sequences. The C. sticklandii PrdX protein, a homolog of the...; Region: PrdX_deacylase; cd04335
759913000476	putative deacylase active site [active]
759913000477	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
759913000478	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
759913000479	non-specific DNA binding site [nucleotide binding]; other site
759913000480	salt bridge; other site
759913000481	sequence-specific DNA binding site [nucleotide binding]; other site
759913000482	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4529
759913000483	FAD-NAD(P)-binding; Region: NAD_binding_9; pfam13454
759913000484	ATPase components of ABC transporters with duplicated ATPase domains [General function prediction only]; Region: Uup; COG0488
759913000485	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
759913000486	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
759913000487	cAMP-binding proteins - catabolite gene activator and regulatory subunit of cAMP-dependent protein kinases [Signal transduction mechanisms]; Region: Crp; COG0664
759913000488	effector domain of the CAP family of transcription factors; members include CAP (or cAMP receptor protein (CRP)), which binds cAMP, FNR (fumarate and nitrate reduction), which uses an iron-sulfur cluster to sense oxygen) and CooA, a heme containing CO...; Region: CAP_ED; cd00038
759913000489	ligand binding site [chemical binding]; other site
759913000490	Predicted membrane protein [Function unknown]; Region: COG2364
759913000491	Maf-like protein; Region: Maf; pfam02545
759913000492	Maf_Ham1. Maf, a nucleotide binding protein, has been implicated in inhibition of septum formation in eukaryotes, bacteria and archaea. A Ham1-related protein from Methanococcus jannaschii is a novel NTPase that has been shown to hydrolyze nonstandard...; Region: Maf_Ham1; cl00276
759913000493	putative active site [active]
759913000494	Histidine phosphatase superfamily (branch 1); Region: His_Phos_1; pfam00300
759913000495	topology modulation protein; Provisional; Region: PRK07261
759913000496	AAA domain; Region: AAA_17; pfam13207
759913000497	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
759913000498	Coenzyme A binding pocket [chemical binding]; other site
759913000499	Radical SAM superfamily; Region: Radical_SAM; pfam04055
759913000500	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
759913000501	FeS/SAM binding site; other site
759913000502	radical SAM additional 4Fe4S-binding SPASM domain; Region: rSAM_more_4Fe4S; TIGR04085
759913000503	ABC-type multidrug transport system, ATPase and permease components [Defense mechanisms]; Region: MdlB; COG1132
759913000504	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
759913000505	ATP-binding cassette domain of multidrug resistance protein-like transporters; Region: ABCC_MRP_Like; cd03228
759913000506	Walker A/P-loop; other site
759913000507	ATP binding site [chemical binding]; other site
759913000508	Q-loop/lid; other site
759913000509	ABC transporter signature motif; other site
759913000510	Walker B; other site
759913000511	D-loop; other site
759913000512	H-loop/switch region; other site
759913000513	Streptomycin adenylyltransferase; Region: Adenyl_transf; pfam04439
759913000514	Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067
759913000515	catalytic core [active]
759913000516	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
759913000517	Coenzyme A binding pocket [chemical binding]; other site
759913000518	Transposase DDE domain; Region: DDE_Tnp_1; pfam01609
759913000519	Transposase DDE domain; Region: DDE_Tnp_1_3; pfam13612
759913000520	Integrase core domain; Region: rve_3; pfam13683
759913000521	Transposase; Region: HTH_Tnp_1; pfam01527
759913000522	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG2963
759913000523	HTH-like domain; Region: HTH_21; pfam13276
759913000524	Integrase core domain; Region: rve; pfam00665
759913000525	Protein Kinases, catalytic domain; Region: PKc_like; cl09925
759913000526	ATP binding site [chemical binding]; other site
759913000527	Aminoglycoside 3'-phosphotransferase (APH) and Choline Kinase (ChoK) family. The APH/ChoK family is part of a larger superfamily that includes the catalytic domains of other kinases, such as the typical serine/threonine/tyrosine protein kinases (PKs)...; Region: APH_ChoK_like; cl17270
759913000528	active site
759913000529	ATP binding site [chemical binding]; other site
759913000530	Subunit A of Class III extradiol dioxygenases; Region: Extradiol_Dioxygenase_3A_like; cl06673
759913000531	dimer interface [polypeptide binding]; other site
759913000532	tetramer interface [polypeptide binding]; other site
759913000533	ABC-type multidrug transport system, ATPase component [Defense mechanisms]; Region: CcmA; COG1131
759913000534	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
759913000535	Walker A/P-loop; other site
759913000536	ATP binding site [chemical binding]; other site
759913000537	Q-loop/lid; other site
759913000538	ABC transporter signature motif; other site
759913000539	Walker B; other site
759913000540	D-loop; other site
759913000541	H-loop/switch region; other site
759913000542	ABC-2 type transporter; Region: ABC2_membrane; cl17235
759913000543	ABC-type multidrug transport system, permease component [Defense mechanisms]; Region: COG0842
759913000544	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3464
759913000545	Transposase; Region: DDE_Tnp_ISL3; pfam01610
759913000546	recombination factor protein RarA; Reviewed; Region: PRK13342
759913000547	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
759913000548	Walker A motif; other site
759913000549	ATP binding site [chemical binding]; other site
759913000550	Walker B motif; other site
759913000551	arginine finger; other site
759913000552	MgsA AAA+ ATPase C terminal; Region: MgsA_C; pfam12002
759913000553	Type 1 glutamine amidotransferase (GATase1) domain found in Anthranilate synthase; Region: GATase1_Anthranilate_Synthase; cd01743
759913000554	Glutamine amidotransferase class-I; Region: GATase; pfam00117
759913000555	glutamine binding [chemical binding]; other site
759913000556	catalytic triad [active]
759913000557	aminodeoxychorismate synthase; Provisional; Region: PRK07508
759913000558	chorismate binding enzyme; Region: Chorismate_bind; cl10555
759913000559	Branched-chain amino acid aminotransferase/4-amino-4-deoxychorismate lyase [Amino acid transport and metabolism / Coenzyme metabolism]; Region: IlvE; COG0115
759913000560	PyridoxaL 5'-Phosphate Dependent Enzymes class IV (PLPDE_IV). This D-amino acid superfamily, one of five classes of PLPDE, consists of branched-chain amino acid aminotransferases (BCAT), D-amino acid transferases (DAAT), and...; Region: PLPDE_IV; cl00224
759913000561	substrate-cofactor binding pocket; other site
759913000562	pyridoxal 5'-phosphate binding site [chemical binding]; other site
759913000563	catalytic residue [active]
759913000564	amidase; Provisional; Region: PRK06529
759913000565	Amidase; Region: Amidase; cl11426
759913000566	Protein of unknown function (DUF3013); Region: DUF3013; pfam11217
759913000567	NUDIX Indel
759913000568	ASC-1 homology domain, subfamily similar to Pyrococcus furiosus Pf0470. The ASCH domain, a small beta-barrel domain found in all three kingdoms of life, resembles the RNA-binding PUA domain and may also interact with RNA. ASCH has been proposed to...; Region: ASCH_PF0470_like; cd06555
759913000569	Members of the Nudix hydrolase superfamily catalyze the hydrolysis of NUcleoside DIphosphates linked to other moieties, X. Enzymes belonging to this superfamily require a divalent cation, such as Mg2+ or Mn2+, for their activity and contain a highly...; Region: Nudix_Hydrolase_23; cd04682
759913000570	nudix motif; other site
759913000571	Ribosomal protein L11 methyltransferase (PrmA); Region: PrmA; pfam06325
759913000572	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
759913000573	S-adenosylmethionine binding site [chemical binding]; other site
759913000574	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG1385
759913000575	RNA methyltransferase, RsmE family; Region: TIGR00046
759913000576	Transcriptional regulators [Transcription]; Region: PurR; COG1609
759913000577	Helix-turn-helix (HTH) DNA binding domain of the LacI family of transcriptional regulators; Region: HTH_LacI; cd01392
759913000578	DNA binding site [nucleotide binding]
759913000579	domain linker motif; other site
759913000580	Type 1 periplasmic binding fold superfamily; Region: Periplasmic_Binding_Protein_Type_1; cl10011
759913000581	Phosphotransferase system IIC components, glucose/maltose/N-acetylglucosamine-specific [Carbohydrate transport and metabolism]; Region: PtsG; COG1263
759913000582	PTS system, IIBC component; Region: PTS-II-BC-unk1; TIGR02003
759913000583	PTS_IIB, PTS system, glucose/sucrose specific IIB subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This family...; Region: PTS_IIB_glc; cd00212
759913000584	active site turn [active]
759913000585	phosphorylation site [posttranslational modification]
759913000586	Phosphotransferase system IIA components [Carbohydrate transport and metabolism]; Region: NagE; COG2190
759913000587	HPr interaction site; other site
759913000588	glycerol kinase (GK) interaction site [polypeptide binding]; other site
759913000589	active site
759913000590	phosphorylation site [posttranslational modification]
759913000591	Streptococcus agalactiae RgfB, part of a putative two component signal transduction system, and related proteins; Region: RgfB-like; cd09079
759913000592	putative catalytic site [active]
759913000593	putative metal binding site [ion binding]; other site
759913000594	putative phosphate binding site [ion binding]; other site
759913000595	hypothetical protein; Provisional; Region: PRK06762
759913000596	Cellulase M and related proteins [Carbohydrate transport and metabolism]; Region: FrvX; COG1363
759913000597	M42 Peptidase, Endoglucanase-like subfamily; Region: M42_glucanase_like; cd05657
759913000598	putative oligomer interface [polypeptide binding]; other site
759913000599	putative active site [active]
759913000600	metal binding site [ion binding]; metal-binding site
759913000601	Protein of unknown function (DUF3816); Region: DUF3816; pfam12822
759913000602	NH_3: A subgroup of nucleoside hydrolases. This group contains eukaryotic and bacterial proteins similar to nucleoside hydrolases. Nucleoside hydrolases cleave the N-glycosidic bond in nucleosides generating ribose and the respective base. These enzymes...; Region: nuc_hydro_3; cd02653
759913000603	active site
759913000604	flavoprotein NrdI; Provisional; Region: PRK02551
759913000605	M protein trans-acting positive regulator (MGA) HTH domain; Region: HTH_Mga; pfam08280
759913000606	Mga helix-turn-helix domain; Region: Mga; pfam05043
759913000607	M protein trans-acting positive regulator (MGA) PRD domain; Region: PRD_Mga; pfam08270
759913000608	Chromosome segregation ATPases [Cell division and chromosome partitioning]; Region: Smc; COG1196
759913000609	Guanosine polyphosphate pyrophosphohydrolases/synthetases [Signal transduction mechanisms / Transcription]; Region: SpoT; COG0317
759913000610	Metal dependent phosphohydrolases with conserved 'HD' motif; Region: HDc; cd00077
759913000611	Zn2+ binding site [ion binding]; other site
759913000612	Mg2+ binding site [ion binding]; other site
759913000613	Nucleotidyltransferase (NT) domain of RelA- and SpoT-like ppGpp synthetases and hydrolases; Region: NT_Rel-Spo_like; cd05399
759913000614	synthetase active site [active]
759913000615	NTP binding site [chemical binding]; other site
759913000616	metal binding site [ion binding]; metal-binding site
759913000617	TGS_RelA_SpoT: The RelA (SpoT) protein, also referred to as ppGpp hydrolase/synthetase, is a ribosome-associated protein that is activated during amino acid starvation and thought to mediate the stringent response. RelA contains a TGS domain, named after...; Region: TGS_RelA_SpoT; cd01668
759913000618	ACT  domain found C-terminal of the RelA/SpoT domains; Region: ACT_RelA-SpoT; cd04876
759913000619	D-Tyrosyl-tRNAtyr deacylases; a class of tRNA-dependent hydrolases which are capable of hydrolyzing the ester bond of D-Tyrosyl-tRNA reducing the level of cellular D-Tyrosine while recycling the peptidyl-tRNA; found in bacteria and in eukaryotes but not...; Region: Dtyr_deacylase; cd00563
759913000620	putative active site [active]
759913000621	dimerization interface [polypeptide binding]; other site
759913000622	putative tRNAtyr binding site [nucleotide binding]; other site
759913000623	Staphylokinase/Streptokinase family; Region: Staphylokinase; pfam02821
759913000624	Staphylokinase/Streptokinase family; Region: Staphylokinase; pfam02821
759913000625	Staphylokinase/Streptokinase family; Region: Staphylokinase; pfam02821
759913000626	Regulator of polyketide synthase expression [Signal transduction mechanisms / Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG2508
759913000627	PucR C-terminal helix-turn-helix domain; Region: HTH_30; pfam13556
759913000628	glycerol-3-phosphate transporter ATP-binding subunit; Provisional; Region: ugpC; PRK11650
759913000629	The N-terminal ATPase domain of the maltose transporter, MalK; Region: ABC_MalK_N; cd03301
759913000630	Walker A/P-loop; other site
759913000631	ATP binding site [chemical binding]; other site
759913000632	Q-loop/lid; other site
759913000633	ABC transporter signature motif; other site
759913000634	Walker B; other site
759913000635	D-loop; other site
759913000636	H-loop/switch region; other site
759913000637	TOBE domain; Region: TOBE; pfam03459
759913000638	alpha,alpha-phosphotrehalase; Region: trehalose_treC; TIGR02403
759913000639	Alpha amylase catalytic domain found in Sucrose isomerases, oligo-1,6-glucosidase (also called isomaltase; sucrase-isomaltase; alpha-limit dextrinase), dextran glucosidase (also called glucan 1,6-alpha-glucosidase), and related proteins; Region: AmyAc_SI_OligoGlu_DGase; cd11333
759913000640	Ca binding site [ion binding]; other site
759913000641	active site
759913000642	catalytic site [active]
759913000643	YSIRK type signal peptide; Region: YSIRK_signal; cl04650
759913000644	pullulanase, extracellular, Gram-positive; Region: pullulan_Gpos; TIGR02102
759913000645	Family 41 Carbohydrate-Binding Module from pullulanase-like enzymes; Region: CBM41_pullulanase; cd10315
759913000646	carbohydrate binding site [chemical binding]; other site
759913000647	Family 41 Carbohydrate-Binding Module from pullulanase-like enzymes; Region: CBM41_pullulanase; cd10315
759913000648	carbohydrate binding site [chemical binding]; other site
759913000649	Early set domain associated with the catalytic domain of pullulanase (also called dextrinase and alpha-dextrin endo-1,6-alpha glucosidase); Region: E_set_Pullulanase; cd02860
759913000650	Alpha amylase catalytic domain found in Pullulanase (also called dextrinase; alpha-dextrin endo-1,6-alpha glucosidase), limit dextrinase, and related proteins; Region: AmyAc_Pullulanase_LD-like; cd11341
759913000651	Ca binding site [ion binding]; other site
759913000652	active site
759913000653	catalytic site [active]
759913000654	Gram positive anchor; Region: Gram_pos_anchor; pfam00746
759913000655	TRX family; composed of two groups: Group I, which includes proteins that exclusively encode a TRX domain; and Group II, which are composed of fusion proteins of TRX and additional domains. Group I TRX is a small ancient protein that alter the redox...; Region: TRX_family; cd02947
759913000656	Thioredoxin-like; Region: Thioredoxin_8; pfam13905
759913000657	catalytic residues [active]
759913000658	preprotein translocase subunit YajC; Validated; Region: yajC; PRK06531
759913000659	Undecaprenyl pyrophosphate synthase [Lipid metabolism]; Region: UppS; COG0020
759913000660	Cis (Z)-Isoprenyl Diphosphate Synthases (cis-IPPS); homodimers which catalyze the successive 1'-4 condensation of the isopentenyl diphosphate (IPP) molecule to trans,trans-farnesyl diphosphate (FPP) or to cis,trans-FPP to form long-chain polyprenyl...; Region: CIS_IPPS; cd00475
759913000661	catalytic residue [active]
759913000662	putative FPP diphosphate  binding site; other site
759913000663	putative FPP binding hydrophobic cleft; other site
759913000664	dimer interface [polypeptide binding]; other site
759913000665	putative IPP diphosphate binding site; other site
759913000666	CDP-diglyceride synthetase [Lipid metabolism]; Region: CdsA; COG0575
759913000667	Cytidylyltransferase family; Region: CTP_transf_1; pfam01148
759913000668	RIP metalloprotease RseP; Region: TIGR00054
759913000669	RseP-like Site-2 proteases (S2P), zinc metalloproteases (MEROPS family M50A), cleave transmembrane domains of substrate proteins, regulating intramembrane proteolysis (RIP) of diverse signal transduction mechanisms. In Escherichia coli, the S2P homolog...; Region: S2P-M50_PDZ_RseP-like; cd06163
759913000670	active site
759913000671	PDZ domain of bacterial and plant zinc metalloprotases, presumably membrane-associated or integral membrane proteases, which may be involved in signalling and regulatory mechanisms. May be responsible for substrate recognition and/or binding, as most PDZ...; Region: PDZ_metalloprotease; cd00989
759913000672	RseP-like Site-2 proteases (S2P), zinc metalloproteases (MEROPS family M50A), cleave transmembrane domains of substrate proteins, regulating intramembrane proteolysis (RIP) of diverse signal transduction mechanisms. In Escherichia coli, the S2P homolog...; Region: S2P-M50_PDZ_RseP-like; cd06163
759913000673	putative substrate binding region [chemical binding]; other site
759913000674	prolyl-tRNA synthetase; Provisional; Region: PRK09194
759913000675	Class II tRNA amino-acyl synthetase-like catalytic core domain. Class II amino acyl-tRNA synthetases (aaRS) share a common fold and generally attach an amino acid to the 3' OH of ribose of the appropriate tRNA.   PheRS is an exception in that it...; Region: class_II_aaRS-like_core; cl00268
759913000676	motif 1; other site
759913000677	dimer interface [polypeptide binding]; other site
759913000678	active site
759913000679	motif 2; other site
759913000680	INS is an amino acid-editing domain inserted (INS) into the bacterial class II prolyl-tRNA synthetase (ProRS) however, this CD is not exclusively bacterial. It is also found at the N-terminus of the eukaryotic/archaea-like ProRS's of yeasts and...; Region: ProRS-INS; cd04334
759913000681	putative deacylase active site [active]
759913000682	Class II tRNA amino-acyl synthetase-like catalytic core domain. Class II amino acyl-tRNA synthetases (aaRS) share a common fold and generally attach an amino acid to the 3' OH of ribose of the appropriate tRNA.   PheRS is an exception in that it...; Region: class_II_aaRS-like_core; cl00268
759913000683	active site
759913000684	motif 3; other site
759913000685	ProRS Prolyl-anticodon binding domain, short version found predominantly in bacteria. ProRS belongs to class II aminoacyl-tRNA synthetases (aaRS). This alignment contains the anticodon binding domain, which is responsible for specificity in tRNA-binding; Region: ProRS_anticodon_short; cd00861
759913000686	anticodon binding site; other site
759913000687	Bacterial protein of unknown function (DUF925); Region: DUF925; pfam06042
759913000688	DNA polymerase III PolC; Validated; Region: polC; PRK00448
759913000689	DNA polymerase III polC-type N-terminus; Region: DNA_pol3_alph_N; pfam11490
759913000690	polC_OBF: A subfamily of OB folds corresponding to the N-terminal OB-fold nucleic acid binding domain of Bacillus subtilis type C replicative DNA polymerase III alpha subunit (polC). Replication in B. subtilis and Staphylococcus aureus requires two...; Region: polC_OBF; cd04484
759913000691	generic binding surface II; other site
759913000692	generic binding surface I; other site
759913000693	Polymerase and Histidinol Phosphatase domain; Region: PHP; cl17102
759913000694	active site
759913000695	DEDDh 3'-5' exonuclease domain family; Region: DEDDh; cd06127
759913000696	active site
759913000697	catalytic site [active]
759913000698	substrate binding site [chemical binding]; other site
759913000699	Polymerase and Histidinol Phosphatase domain of alpha-subunit of bacterial polymerase III at PolC gene; Region: PHP_PolIIIA_POLC; cd07435
759913000700	putative PHP Thumb interface [polypeptide binding]; other site
759913000701	active site
759913000702	MarR family; Region: MarR_2; cl17246
759913000703	helix_turn_helix multiple antibiotic resistance protein; Region: HTH_MARR; smart00347
759913000704	Predicted flavoprotein [General function prediction only]; Region: COG0431
759913000705	NADPH-dependent FMN reductase; Region: FMN_red; pfam03358
759913000706	Polypeptide or peptide deformylase; a family of metalloenzymes that catalyzes the removal of the N-terminal formyl group in a growing polypeptide chain following translation initiation during protein synthesis in prokaryotes. These enzymes utilize Fe(II)...; Region: Pep_deformylase; cd00487
759913000707	active site
759913000708	catalytic residues [active]
759913000709	metal binding site [ion binding]; metal-binding site
759913000710	DNA-binding transcriptional activator YeiL; Provisional; Region: PRK10402
759913000711	effector domain of the CAP family of transcription factors; members include CAP (or cAMP receptor protein (CRP)), which binds cAMP, FNR (fumarate and nitrate reduction), which uses an iron-sulfur cluster to sense oxygen) and CooA, a heme containing CO...; Region: CAP_ED; cd00038
759913000712	ligand binding site [chemical binding]; other site
759913000713	helix_turn_helix, cAMP Regulatory protein C-terminus; DNA binding domain of prokaryotic regulatory proteins belonging to the catabolite activator protein family; Region: HTH_CRP; cl17320
759913000714	Ribosomal protein S15 (prokaryotic)_S13 (eukaryotic) binds the central domain of 16S rRNA and is required for assembly of the small ribosomal subunit and for intersubunit association, thus representing a key element in the assembly of the whole ribosome; Region: Ribosomal_S15p_S13e; cd00353
759913000715	16S/18S rRNA binding site [nucleotide binding]; other site
759913000716	S13e-L30e interaction site [polypeptide binding]; other site
759913000717	25S rRNA binding site [nucleotide binding]; other site
759913000718	Transcriptional antiterminator [Transcription]; Region: BglG; COG3711
759913000719	PRD domain; Region: PRD; pfam00874
759913000720	PTS_IIB_bgl_like: the PTS (phosphotransferase system) IIB domain of a family of sensory systems composed of a membrane-bound sugar-sensor (similar to BglF) and a transcription antiterminator (similar to BglG) which regulate expression of genes involved...; Region: PTS_IIB_bgl_like; cd05568
759913000721	active site
759913000722	P-loop; other site
759913000723	phosphorylation site [posttranslational modification]
759913000724	PTS_IIA, PTS system, fructose/mannitol specific IIA subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This...; Region: PTS_IIA_fru; cd00211
759913000725	active site
759913000726	phosphorylation site [posttranslational modification]
759913000727	PTS_IIB_ascorbate: subunit IIB of enzyme II (EII) of the L-ascorbate-specific phosphoenolpyruvate:carbohydrate phosphotransferase system (PTS). In this system, EII is an L-ascorbate-specific permease with two cytoplasmic subunits (IIA and IIB) and a...; Region: PTS_IIB_ascorbate; cd05563
759913000728	active site
759913000729	P-loop; other site
759913000730	phosphorylation site [posttranslational modification]
759913000731	PTS system ascorbate-specific transporter subunit IIC; Reviewed; Region: ulaA; PRK09410
759913000732	Transaldolase-like fructose-6-phosphate aldolases (FSA) found in bacteria and archaea; Region: Transaldolase_FSA; cd00956
759913000733	active site
759913000734	intersubunit interactions; other site
759913000735	catalytic residue [active]
759913000736	polynucleotide phosphorylase/polyadenylase; Provisional; Region: PRK11824
759913000737	Polyribonucleotide nucleotidyltransferase, repeat 1; Region: RNase_PH_PNPase_1; cd11363
759913000738	RNase E interface [polypeptide binding]; other site
759913000739	trimer interface [polypeptide binding]; other site
759913000740	Polyribonucleotide nucleotidyltransferase, repeat 2; Region: RNase_PH_PNPase_2; cd11364
759913000741	RNase E interface [polypeptide binding]; other site
759913000742	trimer interface [polypeptide binding]; other site
759913000743	active site
759913000744	Polynucleotide phosphorylase (PNPase) K homology RNA-binding domain (KH). PNPase is a polyribonucleotide nucleotidyl transferase that degrades mRNA in prokaryotes and plant chloroplasts. The C-terminal region of PNPase contains domains homologous to...; Region: PNPase_KH; cd02393
759913000745	S1_PNPase: Polynucleotide phosphorylase (PNPase), ), S1-like RNA-binding domain. PNPase  is a polyribonucleotide nucleotidyl transferase that degrades mRNA. It is a trimeric multidomain protein. The C-terminus contains the S1 domain which binds ssRNA; Region: S1_PNPase; cd04472
759913000746	RNA binding site [nucleotide binding]; other site
759913000747	domain interface; other site
759913000748	Serine acetyltransferase [Amino acid transport and metabolism]; Region: CysE; COG1045
759913000749	Serine acetyltransferase (SAT): SAT catalyzes the CoA-dependent acetylation of the side chain hydroxyl group of L-serine to form O-acetylserine, as the first step of a two-step biosynthetic pathway in bacteria and plants leading to the formation of...; Region: LbH_SAT; cd03354
759913000750	trimer interface [polypeptide binding]; other site
759913000751	active site
759913000752	substrate binding site [chemical binding]; other site
759913000753	CoA binding site [chemical binding]; other site
759913000754	cysteinyl-tRNA synthetase; Validated; Region: cysS; PRK00260
759913000755	catalytic core domain of cysteinyl tRNA synthetase; Region: CysRS_core; cd00672
759913000756	active site
759913000757	HIGH motif; other site
759913000758	catalytic core domain of cysteinyl tRNA synthetase; Region: CysRS_core; cd00672
759913000759	KMSKS motif; other site
759913000760	Anticodon-binding domain of class Ia aminoacyl tRNA synthetases and similar domains; Region: Anticodon_Ia_like; cl12020
759913000761	tRNA binding surface [nucleotide binding]; other site
759913000762	anticodon binding site; other site
759913000763	Ribonuclease III family protein [Replication, recombination, and    repair]; Region: COG1939
759913000764	active site
759913000765	metal binding site [ion binding]; metal-binding site
759913000766	dimerization interface [polypeptide binding]; other site
759913000767	Fusaric acid resistance protein-like; Region: FUSC_2; pfam13515
759913000768	rRNA methylases [Translation, ribosomal structure and biogenesis]; Region: SpoU; COG0566
759913000769	RNA 2'-O ribose methyltransferase substrate binding; Region: SpoU_sub_bind; pfam08032
759913000770	SpoU rRNA Methylase family; Region: SpoU_methylase; pfam00588
759913000771	Predicted RNA-binding protein containing a PIN domain [General function prediction only]; Region: COG3688
759913000772	EDD domain protein, DegV family; Region: DegV; TIGR00762
759913000773	Uncharacterized protein, DegV family COG1307; Region: DegV; pfam02645
759913000774	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
759913000775	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
759913000776	non-specific DNA binding site [nucleotide binding]; other site
759913000777	salt bridge; other site
759913000778	sequence-specific DNA binding site [nucleotide binding]; other site
759913000779	Transposase and inactivated derivatives, IS30 family [DNA replication, recombination, and repair]; Region: Tra8; COG2826
759913000780	Helix-turn-helix domain; Region: HTH_38; pfam13936
759913000781	Integrase core domain; Region: rve; pfam00665
759913000782	Transposase and inactivated derivatives, IS30 family [DNA replication, recombination, and repair]; Region: Tra8; COG2826
759913000783	Helix-turn-helix domain; Region: HTH_38; pfam13936
759913000784	Integrase core domain; Region: rve; pfam00665
759913000785	Ribosomal protein L13.  Protein L13, a large ribosomal subunit protein, is one of five proteins required for an early folding intermediate of 23S rRNA in the assembly of the large subunit. L13 is situated on the bottom of the large subunit, near the...; Region: Ribosomal_L13; cd00392
759913000786	23S rRNA interface [nucleotide binding]; other site
759913000787	L3 interface [polypeptide binding]; other site
759913000788	30S ribosomal protein S9; Reviewed; Region: rpsI; PRK00132
759913000789	Salivaricin Indel
759913000790	DNA breaking-rejoining enzymes, C-terminal catalytic domain. The DNA breaking-rejoining enzyme superfamily includes type IB topoisomerases and tyrosine recombinases that share the same fold in their catalytic domain containing six conserved active site...; Region: DNA_BRE_C; cl00213
759913000791	active site
759913000792	DNA binding site [nucleotide binding]
759913000793	Int/Topo IB signature motif; other site
759913000794	Helix-turn-helix domain; Region: HTH_17; cl17695
759913000795	Replication initiation factor; Region: Rep_trans; pfam02486
759913000796	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
759913000797	non-specific DNA binding site [nucleotide binding]; other site
759913000798	salt bridge; other site
759913000799	sequence-specific DNA binding site [nucleotide binding]; other site
759913000800	Type-A lantibiotic; Region: L_biotic_typeA; pfam04604
759913000801	Lantibiotic modifying enzyme [Defense mechanisms]; Region: LcnDR2; COG4403
759913000802	LanM-like proteins. LanM is a bifunctional enzyme, involved in the synthesis of class II lantibiotics. It is responsible for both the dehydration and the cyclization of the precursor-peptide during lantibiotic synthesis. The C-terminal domain shows...; Region: LanM-like; cd04792
759913000803	active site
759913000804	zinc binding site [ion binding]; other site
759913000805	A sub-family of peptidase family C39. Peptidase family C39 mostly contains bacteriocin-processing endopeptidases from bacteria. The cysteine peptidases in family C39 cleave the "double-glycine" leader peptides from the precursors of various...; Region: Peptidase_C39F; cd02425
759913000806	ABC-type bacteriocin/lantibiotic exporters, contain an N-terminal double-glycine peptidase domain [Defense mechanisms]; Region: SunT; COG2274
759913000807	putative active site [active]
759913000808	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
759913000809	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
759913000810	Walker A/P-loop; other site
759913000811	ATP binding site [chemical binding]; other site
759913000812	Q-loop/lid; other site
759913000813	ABC transporter signature motif; other site
759913000814	Walker B; other site
759913000815	D-loop; other site
759913000816	H-loop/switch region; other site
759913000817	ABC-type antimicrobial peptide transport system, ATPase component [Defense mechanisms]; Region: SalX; COG1136
759913000818	ATP-binding cassette domain of the transporters involved in export of lipoprotein and macrolide, and cell division protein; Region: ABC_MJ0796_LolCDE_FtsE; cd03255
759913000819	Walker A/P-loop; other site
759913000820	ATP binding site [chemical binding]; other site
759913000821	Q-loop/lid; other site
759913000822	ABC transporter signature motif; other site
759913000823	Walker B; other site
759913000824	D-loop; other site
759913000825	H-loop/switch region; other site
759913000826	FtsX-like permease family; Region: FtsX; pfam02687
759913000827	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: COG4585
759913000828	Response regulator containing a CheY-like receiver domain and an HTH DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: CitB; COG2197
759913000829	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
759913000830	active site
759913000831	phosphorylation site [posttranslational modification]
759913000832	intermolecular recognition site; other site
759913000833	dimerization interface [polypeptide binding]; other site
759913000834	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
759913000835	DNA binding residues [nucleotide binding]
759913000836	dimerization interface [polypeptide binding]; other site
759913000837	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3464
759913000838	Transposase; Region: DDE_Tnp_ISL3; pfam01610
759913000839	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
759913000840	salt bridge; other site
759913000841	non-specific DNA binding site [nucleotide binding]; other site
759913000842	sequence-specific DNA binding site [nucleotide binding]; other site
759913000843	Phage derived protein Gp49-like (DUF891); Region: Gp49; pfam05973
759913000844	DNA breaking-rejoining enzymes, intergrase/recombinases, C-terminal catalytic domain. The tyrosine recombinase/integrase family share the same catalytic domain containing six conserved active site residues. The best-studied members of this diverse family...; Region: INT_REC_C; cd01182
759913000845	DNA binding site [nucleotide binding]
759913000846	active site
759913000847	Int/Topo IB signature motif; other site
759913000848	catalytic residues [active]
759913000849	Transcriptional antiterminator [Transcription]; Region: BglG; COG3711
759913000850	PRD domain; Region: PRD; pfam00874
759913000851	PTS_IIB_bgl_like: the PTS (phosphotransferase system) IIB domain of a family of sensory systems composed of a membrane-bound sugar-sensor (similar to BglF) and a transcription antiterminator (similar to BglG) which regulate expression of genes involved...; Region: PTS_IIB_bgl_like; cd05568
759913000852	active site
759913000853	P-loop; other site
759913000854	phosphorylation site [posttranslational modification]
759913000855	PTS_IIA, PTS system, fructose/mannitol specific IIA subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This...; Region: PTS_IIA_fru; cd00211
759913000856	active site
759913000857	phosphorylation site [posttranslational modification]
759913000858	PTS_IIA, PTS system, fructose/mannitol specific IIA subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This...; Region: PTS_IIA_fru; cd00211
759913000859	active site
759913000860	phosphorylation site [posttranslational modification]
759913000861	PTS_IIA, PTS system, fructose/mannitol specific IIA subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This...; Region: PTS_IIA_fru; cl00163
759913000862	Phosphotransferase system, galactitol-specific IIC component [Carbohydrate transport and metabolism]; Region: GatC; COG3775
759913000863	PTS system sugar-specific permease component; Region: EIIC-GAT; cl04451
759913000864	PTS_IIB_galactitol: subunit IIB of enzyme II (EII) of the galactitol-specific phosphoenolpyruvate:carbohydrate phosphotransferase system (PTS).  In this system, EII is a galactitol-specific permease with two cytoplasmic domains (IIA and IIB) and a...; Region: PTS_IIB_galactitol; cd05566
759913000865	active site
759913000866	P-loop; other site
759913000867	phosphorylation site [posttranslational modification]
759913000868	Tagatose-1,6-bisphosphate (TBP) aldolase and related Type B Class II aldolases. TBP aldolase is a tetrameric class II aldolase that catalyzes the reversible condensation of dihydroxyacetone phosphate with glyceraldehyde 3-phsophate to produce tagatose 1; Region: TBP_aldolase_IIB; cd00947
759913000869	intersubunit interface [polypeptide binding]; other site
759913000870	active site
759913000871	zinc binding site [ion binding]; other site
759913000872	Na+ binding site [ion binding]; other site
759913000873	TIM barrel proteins share a structurally conserved phosphate binding motif and in general share an eight beta/alpha closed barrel structure. Specific for this family is the conserved phosphate binding site at the edges of strands 7 and 8. The phosphate...; Region: TIM_phosphate_binding; cl17186
759913000874	TIM barrel proteins share a structurally conserved phosphate binding motif and in general share an eight beta/alpha closed barrel structure. Specific for this family is the conserved phosphate binding site at the edges of strands 7 and 8. The phosphate...; Region: TIM_phosphate_binding; cl17186
759913000875	Uncharacterized protein family UPF0047; Region: UPF0047; cl00439
759913000876	Uncharacterized protein family UPF0047; Region: UPF0047; cl00439
759913000877	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
759913000878	haloacid dehalogenase-like hydrolase; Region: Hydrolase_3; pfam08282
759913000879	active site
759913000880	motif I; other site
759913000881	motif II; other site
759913000882	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cl17915
759913000883	Transposase and inactivated derivatives, IS30 family [DNA replication, recombination, and repair]; Region: Tra8; COG2826
759913000884	Helix-turn-helix domain; Region: HTH_38; pfam13936
759913000885	Integrase core domain; Region: rve; pfam00665
759913000886	RNA polymerase sigma factor, sigma-70 family; Region: sigma70-ECF; TIGR02937
759913000887	aspartate kinase; Reviewed; Region: PRK09034
759913000888	AAK_AKiii-YclM-BS: Amino Acid Kinase Superfamily (AAK), AKiii-YclM-BS; this CD includes the N-terminal catalytic aspartokinase (AK) domain of the lysine plus threonine-sensitive aspartokinase isoenzyme AKIII, a monofunctional class enzyme found in...; Region: AAK_AKiii-YclM-BS; cd04245
759913000889	putative catalytic residues [active]
759913000890	putative nucleotide binding site [chemical binding]; other site
759913000891	putative aspartate binding site [chemical binding]; other site
759913000892	ACT domains located C-terminal to the catalytic domain of the lysine plus threonine-sensitive aspartokinase isoenzyme AKIII; Region: ACT_AKiii-YclM-BS_1; cd04911
759913000893	allosteric regulatory residue; other site
759913000894	ACT domains located C-terminal to the catalytic domain of the lysine plus threonine-sensitive aspartokinase isoenzyme AKIII; Region: ACT_AKiii-YclM-BS_2; cd04916
759913000895	tRNA pseudouridine synthase A; Validated; Region: truA; PRK00021
759913000896	Eukaryotic and bacterial pseudouridine synthases similar to E.  coli TruA; Region: PseudoU_synth_EcTruA; cd02570
759913000897	dimerization interface 3.5A [polypeptide binding]; other site
759913000898	active site
759913000899	4-amino-5-hydroxymethyl-2-methyl-pyrimidine phosphate kinase (HMPP-kinase) catalyzes two consecutive phosphorylation steps in the thiamine phosphate biosynthesis pathway, leading to the synthesis of vitamin B1. The first step is the phosphorylation of...; Region: HMPP_kinase; cd01169
759913000900	dimer interface [polypeptide binding]; other site
759913000901	substrate binding site [chemical binding]; other site
759913000902	ATP binding site [chemical binding]; other site
759913000903	Predicted membrane protein [Function unknown]; Region: COG4720
759913000904	hypothetical protein; Provisional; Region: PRK13690
759913000905	Small-conductance mechanosensitive channel [Cell envelope biogenesis, outer membrane]; Region: MscS; COG0668
759913000906	Mechanosensitive ion channel; Region: MS_channel; pfam00924
759913000907	Alpha amylase catalytic domain family; Region: AmyAc_family; cl07893
759913000908	Glycosidases [Carbohydrate transport and metabolism]; Region: AmyA; COG0366
759913000909	Alpha amylase catalytic domain family; Region: AmyAc_family; cl07893
759913000910	active site
759913000911	catalytic site [active]
759913000912	Alpha amylase, C-terminal all-beta domain; Region: Alpha-amylase_C; cl02706
759913000913	Alpha amylase catalytic domain found in bacterial Alpha-amylases (also called 1,4-alpha-D-glucan-4-glucanohydrolase); Region: AmyAc_bac1_AmyA; cd11315
759913000914	Glycosidases [Carbohydrate transport and metabolism]; Region: AmyA; COG0366
759913000915	active site
759913000916	Ca binding site [ion binding]; other site
759913000917	catalytic site [active]
759913000918	Alpha amylase, C-terminal all-beta domain; Region: Alpha-amylase_C; cl02706
759913000919	trigger factor; Provisional; Region: tig; PRK01490
759913000920	FKBP-type peptidyl-prolyl cis-trans isomerase; Region: FKBP_C; pfam00254
759913000921	Bacterial trigger factor protein (TF) C-terminus; Region: Trigger_C; pfam05698
759913000922	DNA-directed RNA polymerase delta subunit; Region: RNA_pol_delta; pfam05066
759913000923	CTP synthetase; Validated; Region: pyrG; PRK05380
759913000924	CTP synthetase (CTPs) is a two-domain protein, which consists of an N-terminal synthetase domain and C-terminal glutaminase domain. The enzymes hydrolyze the amide bond of glutamine to ammonia and glutamate at the glutaminase domains and transfer nascent...; Region: CTGs; cd03113
759913000925	Catalytic site [active]
759913000926	active site
759913000927	UTP binding site [chemical binding]; other site
759913000928	Type 1 glutamine amidotransferase (GATase1) domain found in Cytidine Triphosphate Synthetase; Region: GATase1_CTP_Synthase; cd01746
759913000929	active site
759913000930	putative oxyanion hole; other site
759913000931	catalytic triad [active]
759913000932	Putative regulator of cell autolysis [Signal transduction mechanisms]; Region: LytS; COG3275
759913000933	5TMR of 5TMR-LYT; Region: 5TM-5TMR_LYT; pfam07694
759913000934	Histidine kinase; Region: His_kinase; pfam06580
759913000935	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
759913000936	ATP binding site [chemical binding]; other site
759913000937	Mg2+ binding site [ion binding]; other site
759913000938	G-X-G motif; other site
759913000939	two-component response regulator; Provisional; Region: PRK14084
759913000940	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
759913000941	active site
759913000942	phosphorylation site [posttranslational modification]
759913000943	intermolecular recognition site; other site
759913000944	dimerization interface [polypeptide binding]; other site
759913000945	LytTr DNA-binding domain; Region: LytTR; smart00850
759913000946	LrgA family; Region: LrgA; cl00608
759913000947	antiholin-like protein LrgB; Provisional; Region: PRK04288
759913000948	Hydrolases of the alpha/beta superfamily [General function prediction only]; Region: COG1073
759913000949	Putative lysophospholipase; Region: Hydrolase_4; pfam12146
759913000950	Prolyl oligopeptidase family; Region: Peptidase_S9; pfam00326
759913000951	fructose-bisphosphate aldolase; Provisional; Region: PRK09197
759913000952	Tagatose-1,6-bisphosphate (TBP) aldolase and related Type B Class II aldolases. TBP aldolase is a tetrameric class II aldolase that catalyzes the reversible condensation of dihydroxyacetone phosphate with glyceraldehyde 3-phsophate to produce tagatose 1; Region: TBP_aldolase_IIB; cd00947
759913000953	intersubunit interface [polypeptide binding]; other site
759913000954	active site
759913000955	zinc binding site [ion binding]; other site
759913000956	Na+ binding site [ion binding]; other site
759913000957	50S ribosomal protein L28; Reviewed; Region: rpmB; PRK00359
759913000958	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG1302
759913000959	Predicted kinase related to dihydroxyacetone kinase [General function prediction only]; Region: COG1461
759913000960	DAK2 domain; Region: Dak2; pfam02734
759913000961	Membrane protease subunits, stomatin/prohibitin homologs [Posttranslational modification, protein turnover, chaperones]; Region: HflC; COG0330
759913000962	A subgroup of the band 7 domain of flotillin (reggie) like proteins. This subgroup contains proteins similar to stomatin, prohibitin, flotillin, HlfK/C and podicin.  Many of these band 7 domain-containing proteins are lipid raft-associated.  Individual...; Region: Band_7_4; cd03407
759913000963	ABC-type polar amino acid transport system, ATPase component [Amino acid transport and metabolism]; Region: GlnQ; COG1126
759913000964	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
759913000965	Walker A/P-loop; other site
759913000966	ATP binding site [chemical binding]; other site
759913000967	Q-loop/lid; other site
759913000968	ABC transporter signature motif; other site
759913000969	Walker B; other site
759913000970	D-loop; other site
759913000971	H-loop/switch region; other site
759913000972	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
759913000973	Bacterial extracellular solute-binding proteins, family 3; Region: SBP_bac_3; pfam00497
759913000974	substrate binding pocket [chemical binding]; other site
759913000975	membrane-bound complex binding site; other site
759913000976	hinge residues; other site
759913000977	ABC-type arginine transport system, permease component [Amino acid transport and metabolism]; Region: ArtQ; COG4215
759913000978	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
759913000979	dimer interface [polypeptide binding]; other site
759913000980	conserved gate region; other site
759913000981	putative PBP binding loops; other site
759913000982	ABC-ATPase subunit interface; other site
759913000983	Predicted membrane protein (DUF2207); Region: DUF2207; pfam09972
759913000984	undecaprenyl pyrophosphate phosphatase; Reviewed; Region: PRK00281
759913000985	adaptor protein; Provisional; Region: PRK02315
759913000986	UDP-N-acetylmuramyl pentapeptide phosphotransferase/UDP-N- acetylglucosamine-1-phosphate transferase [Cell envelope biogenesis, outer membrane]; Region: Rfe; COG0472
759913000987	This subfamily contains Escherichia coli WecA, Bacillus subtilis TagO and related proteins. WecA is an UDP-N-acetylglucosamine (GlcNAc):undecaprenyl-phosphate (Und-P) GlcNAc-1-phosphate transferase that catalyzes the formation of a phosphodiester bond...; Region: GT_WecA_like; cd06853
759913000988	Mg++ binding site [ion binding]; other site
759913000989	putative catalytic motif [active]
759913000990	substrate binding site [chemical binding]; other site
759913000991	Cysteine desulfurase activator ATPase [Posttranslational modification, protein turnover, chaperones]; Region: sufC; COG0396
759913000992	ABC-type transport system involved in Fe-S cluster assembly, ATPase component; Region: ABC_FeS_Assembly; cd03217
759913000993	Walker A/P-loop; other site
759913000994	ATP binding site [chemical binding]; other site
759913000995	Q-loop/lid; other site
759913000996	ABC transporter signature motif; other site
759913000997	Walker B; other site
759913000998	D-loop; other site
759913000999	H-loop/switch region; other site
759913001000	Cysteine desulfurase activator SufB [Posttranslational modification, protein turnover, chaperones]; Region: SufB; COG0719
759913001001	FeS assembly protein SufD; Region: sufD; TIGR01981
759913001002	Selenocysteine lyase/Cysteine desulfurase [Posttranslational modification, protein turnover, chaperones]; Region: csdA; COG0520
759913001003	Cysteine desulfurase (SufS)-like. This family belongs to the pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to cysteine desulfurase (SufS) and selenocysteine lyase. SufS...; Region: SufS_like; cd06453
759913001004	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
759913001005	catalytic residue [active]
759913001006	NifU homolog involved in Fe-S cluster formation [Energy production and conversion]; Region: IscU; COG0822
759913001007	Iron-sulfur cluster scaffold-like proteins; Region: IscU_like; cd06664
759913001008	trimerization site [polypeptide binding]; other site
759913001009	active site
759913001010	cysteine desulfurase activator complex subunit SufB; Provisional; Region: PRK11814; cl03223
759913001011	FeS assembly protein SufB; Region: sufB; TIGR01980
759913001012	D-alanyl-D-alanine carboxypeptidase; Region: Peptidase_S11; pfam00768
759913001013	Beta-lactamase enzyme family; Region: Beta-lactamase2; cl17872
759913001014	D-alanyl-D-alanine carboxypeptidase [Cell envelope biogenesis, outer membrane]; Region: DacC; COG1686
759913001015	Beta-lactamase enzyme family; Region: Beta-lactamase2; cl17872
759913001016	Penicillin-binding protein 5, C-terminal domain; Region: PBP5_C; smart00936
759913001017	The substrate-binding component of an ABC-type oligopetide import system contains the type 2 periplasmic binding fold; Region: PBP2_OppA; cd08504
759913001018	peptide binding site [polypeptide binding]; other site
759913001019	Bacterial extracellular solute-binding proteins, family 5 Middle; Region: SBP_bac_5; pfam00496
759913001020	ABC-type dipeptide/oligopeptide/nickel transport systems, permease components [Amino acid transport and metabolism / Inorganic ion transport and metabolism]; Region: DppB; COG0601
759913001021	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
759913001022	dimer interface [polypeptide binding]; other site
759913001023	conserved gate region; other site
759913001024	putative PBP binding loops; other site
759913001025	ABC-ATPase subunit interface; other site
759913001026	ABC-type dipeptide/oligopeptide/nickel transport systems, permease components [Amino acid transport and metabolism / Inorganic ion transport and metabolism]; Region: DppC; COG1173
759913001027	N-terminal TM domain of oligopeptide transport permease C; Region: OppC_N; pfam12911
759913001028	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
759913001029	dimer interface [polypeptide binding]; other site
759913001030	conserved gate region; other site
759913001031	putative PBP binding loops; other site
759913001032	ABC-ATPase subunit interface; other site
759913001033	ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component [Amino acid transport and metabolism / Inorganic ion transport and metabolism]; Region: DppD; COG0444
759913001034	ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257
759913001035	Walker A/P-loop; other site
759913001036	ATP binding site [chemical binding]; other site
759913001037	Q-loop/lid; other site
759913001038	ABC transporter signature motif; other site
759913001039	Walker B; other site
759913001040	D-loop; other site
759913001041	H-loop/switch region; other site
759913001042	Oligopeptide/dipeptide transporter, C-terminal region; Region: oligo_HPY; cl07097
759913001043	ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component [Amino acid transport and metabolism / Inorganic ion transport and metabolism]; Region: DppF; COG1124
759913001044	ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257
759913001045	Walker A/P-loop; other site
759913001046	ATP binding site [chemical binding]; other site
759913001047	Q-loop/lid; other site
759913001048	ABC transporter signature motif; other site
759913001049	Walker B; other site
759913001050	D-loop; other site
759913001051	H-loop/switch region; other site
759913001052	Oligopeptide/dipeptide transporter, C-terminal region; Region: oligo_HPY; pfam08352
759913001053	Transposase and inactivated derivatives, IS30 family [DNA replication, recombination, and repair]; Region: Tra8; COG2826
759913001054	Helix-turn-helix domain; Region: HTH_38; pfam13936
759913001055	Integrase core domain; Region: rve; pfam00665
759913001056	Helix-turn-helix domain; Region: HTH_38; pfam13936
759913001057	Winged helix-turn helix; Region: HTH_29; pfam13551
759913001058	Predicted hydrolase of the HAD superfamily [General function prediction only]; Region: COG2179
759913001059	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
759913001060	active site
759913001061	motif I; other site
759913001062	motif II; other site
759913001063	GTPase YqeH; Provisional; Region: PRK13796
759913001064	Circularly permuted YqeH GTPase; Region: YqeH; cd01855
759913001065	GTP/Mg2+ binding site [chemical binding]; other site
759913001066	G4 box; other site
759913001067	G5 box; other site
759913001068	G1 box; other site
759913001069	Switch I region; other site
759913001070	G2 box; other site
759913001071	G3 box; other site
759913001072	Switch II region; other site
759913001073	Predicted RNA-binding protein containing KH domain, possibly ribosomal protein [Translation, ribosomal structure and biogenesis]; Region: COG1534
759913001074	nicotinic acid mononucleotide adenylyltransferase; Provisional; Region: nadD; PRK00071
759913001075	Nicotinamide/nicotinate mononucleotide adenylyltransferase; Region: NMNAT; cd02165
759913001076	active site
759913001077	(T/H)XGH motif; other site
759913001078	Metal dependent phosphohydrolases with conserved 'HD' motif; Region: HDc; cd00077
759913001079	Zn2+ binding site [ion binding]; other site
759913001080	Mg2+ binding site [ion binding]; other site
759913001081	Cysteine hydrolases; This family contains amidohydrolases, like CSHase (N-carbamoylsarcosine amidohydrolase), involved in creatine metabolism and nicotinamidase, converting nicotinamide to nicotinic acid and ammonia in the pyridine nucleotide cycle. It...; Region: cysteine_hydrolases; cl00220
759913001082	conserved cis-peptide bond; other site
759913001083	Uncharacterized homolog of plant Iojap protein [Function unknown]; Region: COG0799
759913001084	SAM-dependent methyltransferases [Secondary metabolites biosynthesis, transport, and catabolism / General function prediction only]; Region: SmtA; COG0500
759913001085	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
759913001086	S-adenosylmethionine binding site [chemical binding]; other site
759913001087	hypothetical protein; Provisional; Region: PRK13670
759913001088	HIGH Nucleotidyl Transferase; Region: HIGH_NTase1; cl17673
759913001089	Helix-Turn-Helix DNA binding domain of the transcription regulators TipAL, Mta, and SkgA; Region: HTH_TipAL-Mta; cd01106
759913001090	MerR HTH family regulatory protein; Region: MerR_1; pfam13411
759913001091	DNA binding residues [nucleotide binding]
759913001092	dimer interface [polypeptide binding]; other site
759913001093	TipAS antibiotic-recognition domain; Region: TipAS; pfam07739
759913001094	Streptococcal histidine triad protein; Region: Strep_his_triad; pfam04270
759913001095	biotin synthase; Region: bioB; TIGR00433
759913001096	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
759913001097	FeS/SAM binding site; other site
759913001098	Biotin and Thiamin Synthesis associated domain; Region: BATS; pfam06968
759913001099	hypothetical protein; Provisional; Region: PRK12378
759913001100	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
759913001101	Bacterial extracellular solute-binding proteins, family 3; Region: SBP_bac_3; pfam00497
759913001102	substrate binding pocket [chemical binding]; other site
759913001103	membrane-bound complex binding site; other site
759913001104	hinge residues; other site
759913001105	ABC-type metal ion transport system, periplasmic component/surface antigen [Inorganic ion transport and metabolism]; Region: NlpA; COG1464
759913001106	NLPA lipoprotein; Region: Lipoprotein_9; pfam03180
759913001107	ABC-type metal ion transport system, periplasmic component/surface antigen [Inorganic ion transport and metabolism]; Region: NlpA; COG1464
759913001108	NLPA lipoprotein; Region: Lipoprotein_9; pfam03180
759913001109	hypothetical protein; Provisional; Region: PRK06446
759913001110	Uncharacterized M20 Dipeptidases; Region: M20_dipept_like_4; cd05681
759913001111	metal binding site [ion binding]; metal-binding site
759913001112	dimer interface [polypeptide binding]; other site
759913001113	ABC-type metal ion transport system, ATPase component [Inorganic ion transport and metabolism]; Region: AbcC; COG1135
759913001114	ATP-binding cassette domain of methionine transporter; Region: ABC_MetN_methionine_transporter; cd03258
759913001115	Walker A/P-loop; other site
759913001116	ATP binding site [chemical binding]; other site
759913001117	Q-loop/lid; other site
759913001118	ABC transporter signature motif; other site
759913001119	Walker B; other site
759913001120	D-loop; other site
759913001121	H-loop/switch region; other site
759913001122	NIL domain; Region: NIL; pfam09383
759913001123	ABC-type metal ion transport system, permease component [Inorganic ion transport and metabolism]; Region: AbcD; COG2011
759913001124	Branched-chain amino acid transport protein; Region: Branch_AA_trans; pfam05525
759913001125	serine/threonine transporter SstT; Provisional; Region: PRK13628
759913001126	Na+/H+-dicarboxylate symporters [Energy production and conversion]; Region: GltP; COG1301
759913001127	K+ transport systems, NAD-binding component [Inorganic ion transport and metabolism]; Region: TrkA; COG0569
759913001128	TrkA-N domain; Region: TrkA_N; pfam02254
759913001129	Trk-type K+ transport systems, membrane components [Inorganic ion transport and metabolism]; Region: TrkG; COG0168
759913001130	potassium uptake protein, TrkH family; Region: 2a38; TIGR00933
759913001131	Predicted S-adenosylmethionine-dependent methyltransferase involved in bacterial cell division [Cell envelope biogenesis, outer membrane]; Region: GidB; COG0357
759913001132	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
759913001133	S-adenosylmethionine binding site [chemical binding]; other site
759913001134	Uncharacterized conserved protein [Function unknown]; Region: LemA; COG1704
759913001135	heat shock protein HtpX; Provisional; Region: PRK04897
759913001136	Predicted metal-binding, possibly nucleic acid-binding protein [General function prediction only]; Region: COG1399
759913001137	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
759913001138	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
759913001139	active site
759913001140	phosphorylation site [posttranslational modification]
759913001141	intermolecular recognition site; other site
759913001142	dimerization interface [polypeptide binding]; other site
759913001143	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
759913001144	DNA binding site [nucleotide binding]
759913001145	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
759913001146	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
759913001147	dimerization interface [polypeptide binding]; other site
759913001148	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
759913001149	dimer interface [polypeptide binding]; other site
759913001150	phosphorylation site [posttranslational modification]
759913001151	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
759913001152	ATP binding site [chemical binding]; other site
759913001153	Mg2+ binding site [ion binding]; other site
759913001154	G-X-G motif; other site
759913001155	transcriptional regulator NrdR; Validated; Region: nrdR; PRK00464
759913001156	ATP cone domain; Region: ATP-cone; pfam03477
759913001157	Replication initiation/membrane attachment protein [DNA replication, recombination, and repair]; Region: DnaB; COG3611
759913001158	primosomal protein DnaI; Reviewed; Region: PRK08939
759913001159	Primosomal protein DnaI N-terminus; Region: DnaI_N; pfam07319
759913001160	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
759913001161	Walker A motif; other site
759913001162	ATP binding site [chemical binding]; other site
759913001163	Walker B motif; other site
759913001164	GTP-binding protein Der; Reviewed; Region: PRK00093
759913001165	EngA1 GTPase contains the first domain of EngA; Region: EngA1; cd01894
759913001166	G1 box; other site
759913001167	GTP/Mg2+ binding site [chemical binding]; other site
759913001168	Switch I region; other site
759913001169	G2 box; other site
759913001170	Switch II region; other site
759913001171	G3 box; other site
759913001172	G4 box; other site
759913001173	G5 box; other site
759913001174	EngA2 GTPase contains the second domain of EngA; Region: EngA2; cd01895
759913001175	G1 box; other site
759913001176	GTP/Mg2+ binding site [chemical binding]; other site
759913001177	Switch I region; other site
759913001178	G2 box; other site
759913001179	G3 box; other site
759913001180	Switch II region; other site
759913001181	G4 box; other site
759913001182	G5 box; other site
759913001183	SWIM zinc finger; Region: SWIM; pfam04434
759913001184	Bacterial SNF2 helicase associated; Region: SNF2_assoc; pfam08455
759913001185	SNF2 family N-terminal domain; Region: SNF2_N; pfam00176
759913001186	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
759913001187	ATP binding site [chemical binding]; other site
759913001188	putative Mg++ binding site [ion binding]; other site
759913001189	Superfamily II DNA and RNA helicases [DNA replication, recombination, and repair / Transcription / Translation, ribosomal structure and biogenesis]; Region: SrmB; COG0513
759913001190	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
759913001191	nucleotide binding region [chemical binding]; other site
759913001192	ATP-binding site [chemical binding]; other site
759913001193	UDP-N-acetylmuramate--L-alanine ligase; Provisional; Region: murC; PRK00421
759913001194	Mur ligase family, catalytic domain; Region: Mur_ligase; pfam01225
759913001195	Mur ligase middle domain; Region: Mur_ligase_M; pfam08245
759913001196	Mur ligase family, glutamate ligase domain; Region: Mur_ligase_C; pfam02875
759913001197	Acetyltransferases [General function prediction only]; Region: RimI; COG0456
759913001198	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
759913001199	Coenzyme A binding pocket [chemical binding]; other site
759913001200	Aminodeoxychorismate lyase [Coenzyme transport and metabolism]; Region: COG1559
759913001201	proteins similar to Escherichia coli yceG; Region: yceG_like; cd08010
759913001202	dimerization interface [polypeptide binding]; other site
759913001203	transcription elongation factor GreA; Reviewed; Region: greA; PRK00226
759913001204	Transcription elongation factor, N-terminal; Region: GreA_GreB_N; pfam03449
759913001205	Transcription elongation factor, GreA/GreB, C-term; Region: GreA_GreB; pfam01272
759913001206	OxaA-like protein precursor; Provisional; Region: PRK02463
759913001207	membrane protein insertase, YidC/Oxa1 family, C-terminal domain; Region: yidC_oxa1_cterm; TIGR03592
759913001208	acylphosphatase; Provisional; Region: PRK14434
759913001209	rRNA methylases [Translation, ribosomal structure and biogenesis]; Region: SpoU; COG0566
759913001210	RNA 2'-O ribose methyltransferase substrate binding; Region: SpoU_sub_bind; smart00967
759913001211	SpoU rRNA Methylase family; Region: SpoU_methylase; pfam00588
759913001212	Predicted HD superfamily hydrolase [General function prediction only]; Region: COG1418
759913001213	Metal dependent phosphohydrolases with conserved 'HD' motif; Region: HDc; cd00077
759913001214	Zn2+ binding site [ion binding]; other site
759913001215	Mg2+ binding site [ion binding]; other site
759913001216	Integral membrane protein, interacts with FtsH [General function prediction only]; Region: COG0670
759913001217	Bacterial BAX inhibitor (BI)-1/YccA-like proteins; Region: BI-1-like_bacterial; cd10432
759913001218	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3763
759913001219	glutamate racemase; Provisional; Region: PRK00865
759913001220	putative deoxyribonucleotide triphosphate pyrophosphatase/unknown domain fusion protein; Reviewed; Region: PRK02491
759913001221	NTPase/HAM1.  This family consists of the HAM1 protein and pyrophosphate-releasing xanthosine/ inosine triphosphatase. HAM1 protects the cell against mutagenesis by the base analog 6-N-hydroxylaminopurine (HAP) in E. Coli and S. cerevisiae. A...; Region: HAM1; cd00515
759913001222	active site
759913001223	dimerization interface [polypeptide binding]; other site
759913001224	Escherichia coli YfcE and related proteins, metallophosphatase domain; Region: MPP_YfcE; cd00841
759913001225	active site
759913001226	metal binding site [ion binding]; metal-binding site
759913001227	homotetramer interface [polypeptide binding]; other site
759913001228	The CBS domain, named after human CBS, is a small domain originally identified in cystathionine beta-synthase and is subsequently found in a wide range of different proteins. CBS domains usually occur in tandem repeats. They associate to form a so-called...; Region: CBS_pair_30; cd04643
759913001229	FOG: CBS domain [General function prediction only]; Region: COG0517
759913001230	site-specific tyrosine recombinase XerD-like protein; Reviewed; Region: xerD; PRK02436
759913001231	DNA breaking-rejoining enzymes, intergrase/recombinases, C-terminal catalytic domain. The tyrosine recombinase/integrase family share the same catalytic domain containing six conserved active site residues. The best-studied members of this diverse family...; Region: INT_REC_C; cd01182
759913001232	active site
759913001233	catalytic residues [active]
759913001234	DNA binding site [nucleotide binding]
759913001235	Int/Topo IB signature motif; other site
759913001236	segregation and condensation protein A; Reviewed; Region: scpA; PRK00104
759913001237	segregation and condensation protein B; Reviewed; Region: scpB; PRK00135
759913001238	16S rRNA uridine-516 pseudouridylate synthase and related pseudouridylate synthases [Translation, ribosomal structure and biogenesis]; Region: RsuA; COG1187
759913001239	S4/Hsp/ tRNA synthetase RNA-binding domain; The domain surface is populated by conserved, charged residues that define a likely RNA-binding site;  Found in stress proteins, ribosomal proteins and tRNA synthetases; This may imply a hitherto unrecognized...; Region: S4; cd00165
759913001240	RNA binding surface [nucleotide binding]; other site
759913001241	Pseudouridine synthases, RsuA subfamily; Region: PseudoU_synth_RsuA_like; cd02870
759913001242	active site
759913001243	hypothetical protein; Validated; Region: PRK00041
759913001244	Predicted rRNA methylase (SpoU class) [Translation, ribosomal structure and biogenesis]; Region: CspR; COG0219
759913001245	Predicted membrane protein [Function unknown]; Region: COG3601
759913001246	Protein of unknown function (DUF3816); Region: DUF3816; pfam12822
759913001247	PAP2_like_2 proteins. PAP2 is a super-family of phosphatases and haloperoxidases. This subgroup, which is specific to bacteria, lacks functional characterization and may act as a membrane-associated lipid phosphatase; Region: PAP2_like_2; cd03392
759913001248	Membrane-associated phospholipid phosphatase [Lipid metabolism]; Region: PgpB; COG0671
759913001249	active site
759913001250	Predicted Fe-S oxidoreductase [General function prediction only]; Region: COG1242
759913001251	Putative rRNA methylase; Region: rRNA_methylase; pfam06962
759913001252	Hemolysins and related proteins containing CBS domains [General function prediction only]; Region: TlyC; COG1253
759913001253	Domain of unknown function DUF21; Region: DUF21; pfam01595
759913001254	This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domains associated with the CorC_HlyC domain. CorC_HlyC is a transporter associated domain. This small domain is found in Na+/H+ antiporters, in proteins involved in...; Region: CBS_pair_CorC_HlyC_assoc; cd04590
759913001255	Transporter associated domain; Region: CorC_HlyC; pfam03471
759913001256	pyruvate formate-lyase 1-activating enzyme; Region: PFLA; TIGR02493
759913001257	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
759913001258	FeS/SAM binding site; other site
759913001259	putative manganese-dependent inorganic pyrophosphatase; Provisional; Region: PRK05427
759913001260	DHH family; Region: DHH; pfam01368
759913001261	DHHA2 domain; Region: DHHA2; pfam02833
759913001262	Domain of unknown function (DUF1803); Region: DUF1803; pfam08820
759913001263	Domain of unknown function (DUF1803); Region: DUF1803; pfam08820
759913001264	iron-hydroxamate transporter permease subunit; Provisional; Region: PRK10577
759913001265	Transmembrane subunit (TM), of Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters involved in the uptake of siderophores, heme, vitamin B12, or the divalent cations Mg2+ and Zn2+. PBP-dependent ABC transporters consist of...; Region: TM_ABC_iron-siderophores_like; cd06550
759913001266	ABC-ATPase subunit  interface; other site
759913001267	dimer interface [polypeptide binding]; other site
759913001268	putative PBP binding regions; other site
759913001269	iron-hydroxamate transporter permease subunit; Provisional; Region: PRK10577
759913001270	Transmembrane subunit (TM), of Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters involved in the uptake of siderophores, heme, vitamin B12, or the divalent cations Mg2+ and Zn2+. PBP-dependent ABC transporters consist of...; Region: TM_ABC_iron-siderophores_like; cd06550
759913001271	ABC-ATPase subunit  interface; other site
759913001272	dimer interface [polypeptide binding]; other site
759913001273	putative PBP binding regions; other site
759913001274	Periplasmic binding protein FeuA.  These proteins have predicted to function as initial receptors in ABC transport of metal ions in some eubacterial species.  They belong to the TroA superfamily of periplasmic metal binding proteins that share a distinct...; Region: FeuA; cd01138
759913001275	Periplasmic binding protein; Region: Peripla_BP_2; pfam01497
759913001276	putative ligand binding residues [chemical binding]; other site
759913001277	ABC-type cobalamin/Fe3+-siderophores transport systems, ATPase components [Inorganic ion transport and metabolism / Coenzyme metabolism]; Region: FepC; COG1120
759913001278	ATP-binding component of iron-siderophores, vitamin B12 and hemin transporters and related proteins; Region: ABC_Iron-Siderophores_B12_Hemin; cd03214
759913001279	Walker A/P-loop; other site
759913001280	ATP binding site [chemical binding]; other site
759913001281	Q-loop/lid; other site
759913001282	ABC transporter signature motif; other site
759913001283	Walker B; other site
759913001284	D-loop; other site
759913001285	H-loop/switch region; other site
759913001286	UDP-N-acetylmuramoylalanyl-D-glutamate--L-lysine ligase; Provisional; Region: PRK14022
759913001287	Mur ligase family, catalytic domain; Region: Mur_ligase; pfam01225
759913001288	Mur ligase middle domain; Region: Mur_ligase_M; pfam08245
759913001289	Mur ligase family, glutamate ligase domain; Region: Mur_ligase_C; pfam02875
759913001290	Membrane protein involved in the export of O-antigen and teichoic acid [General function prediction only]; Region: RfbX; COG2244
759913001291	Stage V sporulation protein B, also known as Stage III sporulation protein F, and related proteins; Region: MATE_SpoVB_like; cd13124
759913001292	Transposase and inactivated derivatives, IS30 family [DNA replication, recombination, and repair]; Region: Tra8; COG2826
759913001293	Helix-turn-helix domain; Region: HTH_38; pfam13936
759913001294	Integrase core domain; Region: rve; pfam00665
759913001295	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
759913001296	active site
759913001297	Protease subunit of ATP-dependent Clp proteases [Posttranslational modification, protein turnover, chaperones / Intracellular trafficking and secretion]; Region: ClpP; COG0740
759913001298	Caseinolytic protease (ClpP) is an ATP-dependent, highly conserved serine protease; Region: S14_ClpP_2; cd07017
759913001299	oligomer interface [polypeptide binding]; other site
759913001300	active site residues [active]
759913001301	Domain of unknown function (DUF4298); Region: DUF4298; pfam14131
759913001302	Protein of unknown function (DUF964); Region: DUF964; cl01483
759913001303	hypothetical protein; Provisional; Region: PRK02302
759913001304	ABC-type branched-chain amino acid transport systems, periplasmic component [Amino acid transport and metabolism]; Region: LivK; COG0683
759913001305	Type I periplasmic ligand-binding domain of uncharacterized ABC (Atpase Binding Cassette)-type active transport systems that are predicted to be involved in uptake of amino acids, peptides, or inorganic ions; Region: PBP1_ABC_ligand_binding_like_12; cd06347
759913001306	putative ligand binding site [chemical binding]; other site
759913001307	Branched-chain amino acid transport system / permease component; Region: BPD_transp_2; pfam02653
759913001308	Transmembrane subunit (TM) of Escherichia coli LivH and related proteins. LivH is one of two TMs of the E. coli LIV-1/LS transporter, a Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporter involved in the uptake of...; Region: TM_PBP1_LivH_like; cd06582
759913001309	TM-ABC transporter signature motif; other site
759913001310	ABC-type branched-chain amino acid transport system, permease component [Amino acid transport and metabolism]; Region: LivM; COG4177
759913001311	Transmembrane subunit (TM) of Escherichia coli LivM and related proteins. LivM is one of two TMs of the E. coli LIV-1/LS transporter, a Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporter involved in the uptake of...; Region: TM_PBP1_LivM_like; cd06581
759913001312	TM-ABC transporter signature motif; other site
759913001313	ABC-type branched-chain amino acid transport systems, ATPase component [Amino acid transport and metabolism]; Region: LivG; COG0411
759913001314	ATP-binding cassette component of branched chain amino acids transport system; Region: ABC_Mj1267_LivG_branched; cd03219
759913001315	Walker A/P-loop; other site
759913001316	ATP binding site [chemical binding]; other site
759913001317	Q-loop/lid; other site
759913001318	ABC transporter signature motif; other site
759913001319	Walker B; other site
759913001320	D-loop; other site
759913001321	H-loop/switch region; other site
759913001322	ABC-type branched-chain amino acid transport systems, ATPase component [Amino acid transport and metabolism]; Region: LivF; COG0410
759913001323	ATP-binding cassette domain of branched-chain amino acid transporter; Region: ABC_TM1139_LivF_branched; cd03224
759913001324	Walker A/P-loop; other site
759913001325	ATP binding site [chemical binding]; other site
759913001326	Q-loop/lid; other site
759913001327	ABC transporter signature motif; other site
759913001328	Walker B; other site
759913001329	D-loop; other site
759913001330	H-loop/switch region; other site
759913001331	FOG: CBS domain [General function prediction only]; Region: COG0517
759913001332	This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domains in  the acetoin utilization proteins in bacteria. Acetoin is a product of fermentative metabolism in many prokaryotic and eukaryotic microorganisms.  They produce...; Region: CBS_pair_ACT_assoc2; cd04585
759913001333	thymidylate kinase; Validated; Region: tmk; PRK00698
759913001334	Thymidine monophosphate kinase (TMPK), also known as thymidylate kinase, catalyzes the phosphorylation of thymidine monophosphate (TMP) to thymidine diphosphate (TDP) utilizing ATP as its preferred phophoryl donor. TMPK represents the rate-limiting step...; Region: TMPK; cd01672
759913001335	TMP-binding site; other site
759913001336	ATP-binding site [chemical binding]; other site
759913001337	DNA polymerase III subunit delta'; Validated; Region: PRK07276
759913001338	DNA polymerase III subunit delta'; Validated; Region: PRK08485
759913001339	PSP1 C-terminal conserved region; Region: PSP1; cl00770
759913001340	DNA replication intiation control protein YabA; Reviewed; Region: PRK13169
759913001341	Predicted methyltransferases [General function prediction only]; Region: COG0313
759913001342	Ribosomal RNA small subunit methyltransferase I, also known as rRNA (cytidine-2'-O-)-methyltransferase RsmI; Region: RsmI; cd11648
759913001343	putative SAM binding site [chemical binding]; other site
759913001344	putative homodimer interface [polypeptide binding]; other site
759913001345	CutC family; Region: CutC; pfam03932
759913001346	3-phosphoserine/phosphohydroxythreonine aminotransferase; Provisional; Region: PRK05355
759913001347	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
759913001348	catalytic residue [active]
759913001349	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
759913001350	Coenzyme A binding pocket [chemical binding]; other site
759913001351	Methylated DNA-protein cysteine methyltransferase [DNA replication, recombination, and repair]; Region: Ada; COG0350
759913001352	The DNA repair protein O6-alkylguanine-DNA alkyltransferase (ATase; also known as AGT, AGAT and MGMT) reverses O6-alkylation DNA damage by transferring O6-alkyl adducts to an active site cysteine irreversibly, without inducing DNA strand breaks. ATases...; Region: ATase; cd06445
759913001353	DNA binding site [nucleotide binding]
759913001354	active site
759913001355	Arsenate Reductase (ArsC) family, unknown subfamily; uncharacterized proteins containing a CXXC motif with similarity to thioredoxin (TRX)-fold arsenic reductases, ArsC. Proteins containing a redox active CXXC motif like TRX and glutaredoxin (GRX)...; Region: ArsC_like; cd03036
759913001356	ArsC family; Region: ArsC; pfam03960
759913001357	putative ArsC-like catalytic residues; other site
759913001358	putative TRX-like catalytic residues [active]
759913001359	Escherichia coli PhnB and similar proteins; the E. coli phnB gene is found next to an operon involved in the cleavage of carbon-phosphorus bonds in unactivated alkylphosphonates; Region: PhnB_like; cd06588
759913001360	dimer interface [polypeptide binding]; other site
759913001361	This conserved domain belongs to a superfamily including the bleomycin resistance protein, glyoxalase I, and type I ring-cleaving dioxygenases; Region: Glo_EDI_BRP_like_16; cd07263
759913001362	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
759913001363	Human Ape1-like subfamily of the ExoIII family purinic/apyrimidinic (AP) endonucleases; Region: Ape1-like_AP-endo; cd09087
759913001364	active site
759913001365	putative catalytic site [active]
759913001366	DNA binding site [nucleotide binding]
759913001367	putative phosphate binding site [ion binding]; other site
759913001368	metal binding site A [ion binding]; metal-binding site
759913001369	AP binding site [nucleotide binding]; other site
759913001370	metal binding site B [ion binding]; metal-binding site
759913001371	Protein of unknown function (DUF1648); Region: DUF1648; pfam07853
759913001372	Predicted integral membrane protein [Function unknown]; Region: COG5658
759913001373	SdpI/YhfL protein family; Region: SdpI; pfam13630
759913001374	L-lactate permease [Energy production and conversion]; Region: LldP; COG1620
759913001375	L-lactate permease; Region: Lactate_perm; cl00701
759913001376	L-lactate oxidase; Region: L_lactate_ox; TIGR02708
759913001377	L-Lactate oxidase (LOX) FMN-binding domain. LOX is a member of the family of FMN-containing alpha-hydroxyacid oxidases and catalyzes the oxidation of l-lactate using molecular oxygen to generate pyruvate and H2O2.  This family occurs in both prokaryotes...; Region: LOX_like_FMN; cd04737
759913001378	teramer interface [polypeptide binding]; other site
759913001379	active site
759913001380	FMN binding site [chemical binding]; other site
759913001381	catalytic residues [active]
759913001382	YSIRK type signal peptide; Region: YSIRK_signal; pfam04650
759913001383	Peptidase domain in the S8 and S53 families; Region: Peptidases_S8_S53; cl10459
759913001384	Peptidase S8 family domain in Streptococcal C5a peptidases; Region: Peptidases_S8_C5a_Peptidase; cd07475
759913001385	putative active site [active]
759913001386	PA_C5a_like: Protease-associated domain containing proteins like Streptococcus pyogenes C5a peptidase. This group contains various PA domain-containing proteins similar to S. pyogenes C5a, including, i) Vpr, a minor extracellular serine protease from...; Region: PA_C5a_like; cd02133
759913001387	putative integrin binding motif; other site
759913001388	PA/protease domain interface [polypeptide binding]; other site
759913001389	Peptidase S8 family domain in Streptococcal C5a peptidases; Region: Peptidases_S8_C5a_Peptidase; cd07475
759913001390	Fn3-like domain (DUF1034); Region: DUF1034; pfam06280
759913001391	C-terminal domain of CHU protein family; Region: CHU_C; cl17875
759913001392	LPXTG-motif cell wall anchor domain; Region: LPXTG_anchor; TIGR01167
759913001393	Predicted membrane protein [Function unknown]; Region: COG3619
759913001394	methionyl-tRNA synthetase; Reviewed; Region: PRK12267
759913001395	catalytic core domain of methioninyl-tRNA synthetases; Region: MetRS_core; cd00814
759913001396	active site
759913001397	HIGH motif; other site
759913001398	KMSKS motif; other site
759913001399	Anticodon-binding domain of methionyl tRNA synthetases; Region: Anticodon_Ia_Met; cd07957
759913001400	tRNA binding surface [nucleotide binding]; other site
759913001401	anticodon binding site; other site
759913001402	tRNA-binding-domain-containing Escherichia coli methionyl-tRNA synthetase (EcMetRS)-like proteins.  This family includes EcMetRS and Aquifex aeolicus Trbp111 (AaTrbp111). This domain has general tRNA binding properties.  MetRS aminoacylates methionine...; Region: tRNA_bind_EcMetRS_like; cd02800
759913001403	dimer interface [polypeptide binding]; other site
759913001404	putative tRNA-binding site [nucleotide binding]; other site
759913001405	ribonucleotide-diphosphate reductase subunit beta; Provisional; Region: nrdF2; PRK13966
759913001406	Ribonucleotide Reductase, R2/beta subunit, ferritin-like diiron-binding domain; Region: RNRR2; cd01049
759913001407	dimer interface [polypeptide binding]; other site
759913001408	putative radical transfer pathway; other site
759913001409	diiron center [ion binding]; other site
759913001410	tyrosyl radical; other site
759913001411	ribonucleotide reductase stimulatory protein; Reviewed; Region: nrdI; PRK03600
759913001412	ribonucleotide-diphosphate reductase subunit alpha; Validated; Region: PRK07187
759913001413	Ribonucleotide reductase N-terminal; Region: RNR_N; pfam08343
759913001414	Class I ribonucleotide reductase; Region: RNR_I; cd01679
759913001415	active site
759913001416	dimer interface [polypeptide binding]; other site
759913001417	catalytic residues [active]
759913001418	effector binding site; other site
759913001419	R2 peptide binding site; other site
759913001420	Branched-chain amino acid transport protein; Region: Branch_AA_trans; cl00547
759913001421	Protein of unknown function (DUF2829); Region: DUF2829; pfam11195
759913001422	3-ketoacyl-(acyl-carrier-protein) reductase; Provisional; Region: fabG; PRK06550
759913001423	classical (c) SDRs; Region: SDR_c; cd05233
759913001424	NAD(P) binding site [chemical binding]; other site
759913001425	active site
759913001426	Protein of unknown function (DUF3977); Region: DUF3977; pfam13122
759913001427	ASC-1 homology domain, subfamily similar to Enterococcus faecalis Ef3133. The ASCH domain, a small beta-barrel domain found in all three kingdoms of life, resembles the RNA-binding PUA domain and may also interact with RNA. ASCH has been proposed to...; Region: ASCH_Ef3133_like; cd06553
759913001428	Predicted dehydrogenases and related proteins [General function prediction only]; Region: MviM; COG0673
759913001429	Oxidoreductase family, NAD-binding Rossmann fold; Region: GFO_IDH_MocA; pfam01408
759913001430	Sugar phosphate permease [Carbohydrate transport and metabolism]; Region: UhpC; COG2271
759913001431	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
759913001432	putative substrate translocation pore; other site
759913001433	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase; Provisional; Region: glmU; PRK14354
759913001434	N-terminal domain of bacterial GlmU; Region: GT2_GlmU_N_bac; cd02540
759913001435	Substrate binding site; other site
759913001436	Mg++ binding site; other site
759913001437	N-acetyl-glucosamine-1-phosphate uridyltransferase (GlmU), C-terminal left-handed beta-helix (LbH) acetyltransferase domain: GlmU is also known as UDP-N-acetylglucosamine pyrophosphorylase. It is a bifunctional bacterial enzyme that catalyzes two...; Region: LbH_GlmU_C; cd03353
759913001438	active site
759913001439	substrate binding site [chemical binding]; other site
759913001440	CoA binding site [chemical binding]; other site
759913001441	ADP-ribose pyrophosphatase (ADPRase) catalyzes the hydrolysis of ADP-ribose and a variety of additional ADP-sugar conjugates to AMP and ribose-5-phosphate. Like other members of the Nudix hydrolase superfamily, it requires a divalent cation, such as Mg2+; Region: ADPRase_NUDT5; cd03424
759913001442	dimer interface [polypeptide binding]; other site
759913001443	ADP-ribose binding site [chemical binding]; other site
759913001444	active site
759913001445	nudix motif; other site
759913001446	metal binding site [ion binding]; metal-binding site
759913001447	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase; Validated; Region: PRK05584
759913001448	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase; Region: MTA/SAH-Nsdase; TIGR01704
759913001449	Mn-dependent transcriptional regulator [Transcription]; Region: TroR; COG1321
759913001450	Iron dependent repressor, N-terminal DNA binding domain; Region: Fe_dep_repress; pfam01325
759913001451	Iron dependent repressor, metal binding and dimerisation domain; Region: Fe_dep_repr_C; pfam02742
759913001452	FeoA domain; Region: FeoA; pfam04023
759913001453	ABC-type metal ion transport system, periplasmic component/surface adhesin [Inorganic ion transport and metabolism]; Region: LraI; COG0803
759913001454	Metal binding protein PsaA.  These proteins have been shown to function as initial receptors in ABC transport of Mn2+ and as surface adhesins in some eubacterial species.  They belong to the TroA superfamily of periplasmic metal binding proteins that...; Region: PsaA; cd01137
759913001455	metal binding site [ion binding]; metal-binding site
759913001456	ABC-type Mn/Zn transport systems, ATPase component [Inorganic ion transport and metabolism]; Region: ZnuC; COG1121
759913001457	ATP-binding cassette domain of the metal-type transporters; Region: ABC_Metallic_Cations; cd03235
759913001458	ABC-type Mn2+/Zn2+ transport systems, permease components [Inorganic ion transport and metabolism]; Region: ZnuB; COG1108
759913001459	Transmembrane subunit (TM), of Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters involved in the uptake of siderophores, heme, vitamin B12, or the divalent cations Mg2+ and Zn2+. PBP-dependent ABC transporters consist of...; Region: TM_ABC_iron-siderophores_like; cd06550
759913001460	ABC-ATPase subunit  interface; other site
759913001461	dimer interface [polypeptide binding]; other site
759913001462	putative PBP binding regions; other site
759913001463	Peptidyl-prolyl cis-trans isomerase (rotamase) - cyclophilin family [Posttranslational modification, protein turnover, chaperones]; Region: PpiB; COG0652
759913001464	active site
759913001465	Protein of unknown function (DUF1673); Region: DUF1673; pfam07895
759913001466	DNA segregation ATPase FtsK/SpoIIIE and related proteins [Cell division and chromosome partitioning]; Region: FtsK; COG1674
759913001467	FtsK/SpoIIIE family; Region: FtsK_SpoIIIE; pfam01580
759913001468	Ftsk gamma domain; Region: Ftsk_gamma; pfam09397
759913001469	Protein of unknown function (DUF3397); Region: DUF3397; pfam11877
759913001470	50S ribosomal protein L11; Validated; Region: rplK; PRK00140
759913001471	Ribosomal protein L11. Ribosomal protein L11, together with proteins L10 and L7/L12, and 23S rRNA, form the L7/L12 stalk on the surface of the large subunit of the ribosome. The homologous eukaryotic cytoplasmic protein is also called 60S ribosomal...; Region: Ribosomal_L11; cd00349
759913001472	23S rRNA interface [nucleotide binding]; other site
759913001473	L7/L12 interface [polypeptide binding]; other site
759913001474	putative thiostrepton binding site; other site
759913001475	L25 interface [polypeptide binding]; other site
759913001476	Ribosomal protein L1.  The L1 protein, located near the E-site of the ribosome, forms part of the L1 stalk along with 23S rRNA.  In bacteria and archaea, L1 functions both as a ribosomal protein that binds rRNA, and as a translation repressor that binds...; Region: Ribosomal_L1; cd00403
759913001477	mRNA/rRNA interface [nucleotide binding]; other site
759913001478	EcsC protein family; Region: EcsC; pfam12787
759913001479	UMP kinase (UMPK)-Ec, the microbial/chloroplast uridine monophosphate kinase (uridylate kinase) enzyme that catalyzes UMP phosphorylation and plays a key role in pyrimidine nucleotide biosynthesis; regulation of this process is via feed-back control and...; Region: AAK_UMPK-PyrH-Ec; cd04254
759913001480	putative nucleotide binding site [chemical binding]; other site
759913001481	uridine monophosphate binding site [chemical binding]; other site
759913001482	homohexameric interface [polypeptide binding]; other site
759913001483	ribosome recycling factor; Reviewed; Region: frr; PRK00083
759913001484	Ribosome recycling factor (RRF). Ribosome recycling factor dissociates the posttermination complex, composed of the ribosome, deacylated tRNA, and mRNA, after termination of translation.  Thus ribosomes are "recycled" and ready for another...; Region: RRF; cd00520
759913001485	hinge region; other site
759913001486	Predicted RNA-bindining protein (contains S1 and HTH domains) [General function prediction only]; Region: COG2996
759913001487	S1 domain; Region: S1_2; pfam13509
759913001488	methionine sulfoxide reductase A; Provisional; Region: PRK14054
759913001489	hypothetical protein; Provisional; Region: PRK13672
759913001490	Lysine Motif is a small domain involved in binding peptidoglycan; Region: LysM; cd00118
759913001491	Myosin-crossreactive antigen [Function unknown]; Region: COG4716
759913001492	Phosphate starvation-inducible protein PhoH, predicted ATPase [Signal transduction mechanisms]; Region: PhoH; COG1702
759913001493	PhoH-like protein; Region: PhoH; pfam02562
759913001494	Uncharacterized subfamily of Uracil-DNA glycosylases; Region: UDG_like_1; cd10033
759913001495	putative uracil binding site [chemical binding]; other site
759913001496	putative active site [active]
759913001497	metal-binding heat shock protein; Provisional; Region: PRK00016
759913001498	Diacylglycerol kinase [Cell envelope biogenesis, outer membrane]; Region: DgkA; COG0818
759913001499	GTPase Era; Reviewed; Region: era; PRK00089
759913001500	E. coli Ras-like protein (Era) is a multifunctional GTPase; Region: Era; cd04163
759913001501	G1 box; other site
759913001502	GTP/Mg2+ binding site [chemical binding]; other site
759913001503	Switch I region; other site
759913001504	G2 box; other site
759913001505	Switch II region; other site
759913001506	G3 box; other site
759913001507	G4 box; other site
759913001508	G5 box; other site
759913001509	KH domain; Region: KH_2; pfam07650
759913001510	Nudix hydrolase is a superfamily of enzymes found in all three kingdoms of life, and it catalyzes the hydrolysis of NUcleoside DIphosphates linked to other moieties, X. Enzymes belonging to this superfamily require a divalent cation, such as Mg2+ or Mn2+...; Region: Nudix_Hydrolase; cl00447
759913001511	A sub-family of peptidase family C39. Peptidase family C39 mostly contains bacteriocin-processing endopeptidases from bacteria. The cysteine peptidases in family C39 cleave the "double-glycine" leader peptides from the precursors of various...; Region: Peptidase_C39B; cd02418
759913001512	putative active site [active]
759913001513	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
759913001514	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
759913001515	Walker A/P-loop; other site
759913001516	ATP binding site [chemical binding]; other site
759913001517	Q-loop/lid; other site
759913001518	ABC transporter signature motif; other site
759913001519	Integrase core domain; Region: rve; pfam00665
759913001520	Integrase core domain; Region: rve_3; pfam13683
759913001521	putative transposase OrfB; Reviewed; Region: PHA02517
759913001522	HTH-like domain; Region: HTH_21; pfam13276
759913001523	Integrase core domain; Region: rve; pfam00665
759913001524	Transposase; Region: HTH_Tnp_1; pfam01527
759913001525	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG2963
759913001526	Response regulator of the LytR/AlgR family [Transcription / Signal transduction mechanisms]; Region: LytT; COG3279
759913001527	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
759913001528	active site
759913001529	phosphorylation site [posttranslational modification]
759913001530	intermolecular recognition site; other site
759913001531	dimerization interface [polypeptide binding]; other site
759913001532	LytTr DNA-binding domain; Region: LytTR; pfam04397
759913001533	Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase; Region: HATPase_c; pfam02518
759913001534	COMC family; Region: ComC; pfam03047
759913001535	bacteriocin secretion accessory protein; Region: bacteriocin_acc; TIGR01000
759913001536	HlyD family secretion protein; Region: HlyD_3; pfam13437
759913001537	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
759913001538	A sub-family of peptidase family C39. Peptidase family C39 mostly contains bacteriocin-processing endopeptidases from bacteria. The cysteine peptidases in family C39 cleave the "double-glycine" leader peptides from the precursors of various...; Region: Peptidase_C39B; cd02418
759913001539	ABC-type bacteriocin transporter; Region: bacteriocin_ABC; TIGR01193
759913001540	putative active site [active]
759913001541	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
759913001542	ATP-binding cassette domain of multidrug resistance protein-like transporters; Region: ABCC_MRP_Like; cd03228
759913001543	Walker A/P-loop; other site
759913001544	ATP binding site [chemical binding]; other site
759913001545	Q-loop/lid; other site
759913001546	ABC transporter signature motif; other site
759913001547	Walker B; other site
759913001548	D-loop; other site
759913001549	H-loop/switch region; other site
759913001550	Transposase DDE domain; Region: DDE_Tnp_1; pfam01609
759913001551	Transposase DDE domain; Region: DDE_Tnp_1_3; pfam13612
759913001552	CAAX protease self-immunity; Region: Abi; pfam02517
759913001553	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
759913001554	non-specific DNA binding site [nucleotide binding]; other site
759913001555	salt bridge; other site
759913001556	sequence-specific DNA binding site [nucleotide binding]; other site
759913001557	transcriptional activator, Rgg/GadR/MutR family, C-terminal domain; Region: RGG_Cterm; TIGR01716
759913001558	formamidopyrimidine/5-formyluracil/ 5-hydroxymethyluracil DNA glycosylase; Validated; Region: PRK01103
759913001559	N-terminal domain of Escherichia coli Fpg1/MutM and related bacterial DNA glycosylases; Region: EcFpg-like_N; cd08966
759913001560	DNA binding site [nucleotide binding]
759913001561	catalytic residue [active]
759913001562	H2TH interface [polypeptide binding]; other site
759913001563	putative catalytic residues [active]
759913001564	turnover-facilitating residue; other site
759913001565	intercalation triad [nucleotide binding]; other site
759913001566	8OG recognition residue [nucleotide binding]; other site
759913001567	putative reading head residues; other site
759913001568	Formamidopyrimidine-DNA glycosylase H2TH domain; Region: H2TH; pfam06831
759913001569	Zinc finger found in FPG and IleRS; Region: zf-FPG_IleRS; pfam06827
759913001570	Dephospho-CoA kinase [Coenzyme metabolism]; Region: CoaE; COG0237
759913001571	Dephospho-coenzyme A kinase (DPCK, EC 2.7.1.24) catalyzes the phosphorylation of dephosphocoenzyme A (dCoA) to yield CoA, which is the final step in CoA biosynthesis; Region: DPCK; cd02022
759913001572	CoA-binding site [chemical binding]; other site
759913001573	ATP-binding [chemical binding]; other site
759913001574	ABC-type Mn/Zn transport systems, ATPase component [Inorganic ion transport and metabolism]; Region: ZnuC; COG1121
759913001575	ATP-binding cassette domain of the drug resistance transporter and related proteins, subfamily A; Region: ABC_DR_subfamily_A; cd03230
759913001576	Walker A/P-loop; other site
759913001577	ATP binding site [chemical binding]; other site
759913001578	Q-loop/lid; other site
759913001579	ABC transporter signature motif; other site
759913001580	Walker B; other site
759913001581	D-loop; other site
759913001582	H-loop/switch region; other site
759913001583	Bacterial protein of unknown function (DUF853); Region: DUF853; pfam05872
759913001584	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cl17189
759913001585	Walker A motif; other site
759913001586	ATP binding site [chemical binding]; other site
759913001587	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
759913001588	putative substrate translocation pore; other site
759913001589	Major Facilitator Superfamily; Region: MFS_1; pfam07690
759913001590	50S ribosomal protein L33; Validated; Region: rpmG; PRK00595
759913001591	preprotein translocase subunit SecG; Reviewed; Region: secG; PRK06870
759913001592	ribonuclease R; Region: RNase_R; TIGR02063
759913001593	Ribonuclease B OB domain; Region: OB_RNB; pfam08206
759913001594	RNB domain; Region: RNB; pfam00773
759913001595	S1_RNase_R: RNase R C-terminal S1 domain. RNase R is a processive 3' to 5' exoribonuclease, which is a homolog of RNase II. RNase R degrades RNA with secondary structure having a 3' overhang of at least 7 nucleotides. RNase R and PNPase...; Region: S1_RNase_R; cd04471
759913001596	RNA binding site [nucleotide binding]; other site
759913001597	Small protein B (SmpB) is a component of the trans-translation system in prokaryotes for releasing stalled ribosome from damaged messenger RNAs; Region: SmpB; cd09294
759913001598	SmpB-tmRNA interface; other site
759913001599	undecaprenyl phosphate 4-deoxy-4-formamido-L-arabinose transferase; Provisional; Region: PRK10714
759913001600	Bacterial DPM1_like enzymes are related to eukaryotic DPM1; Region: DPM1_like_bac; cd04187
759913001601	Ligand binding site; other site
759913001602	Putative Catalytic site; other site
759913001603	DXD motif; other site
759913001604	DNA/RNA non-specific endonuclease; Region: Endonuclea_NS_2; cl17626
759913001605	DNA/RNA non-specific endonuclease; Region: Endonuclease_NS; smart00892
759913001606	Glyoxalase I catalyzes the isomerization of the hemithioacetal, formed by a 2-oxoaldehyde and glutathione, to S-D-lactoylglutathione; Region: Glyoxalase_I; cd07233
759913001607	dimer interface [polypeptide binding]; other site
759913001608	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
759913001609	active site
759913001610	metal binding site [ion binding]; metal-binding site
759913001611	glutathione binding site [chemical binding]; other site
759913001612	NAD(P)H:FMN oxidoreductase family. This domain catalyzes the reduction of flavin, nitrocompound, quinones and azo compounds using NADH or NADPH as an electron donor. The enzyme is a homodimer, and each monomer binds a FMN as co-factor. This family...; Region: NfsB_like_nitroreductase; cd02149
759913001613	dimer interface [polypeptide binding]; other site
759913001614	FMN binding site [chemical binding]; other site
759913001615	Xaa-Pro aminopeptidase [Amino acid transport and metabolism]; Region: PepP; COG0006
759913001616	Creatinase/Prolidase N-terminal domain; Region: Creatinase_N; pfam01321
759913001617	Similar to Prolidase and Aminopeptidase P. The members of this subfamily presumably catalyse hydrolysis of Xaa-Pro dipeptides and/or release of any N-terminal amino acid, including proline, that is linked with proline; Region: APP-like; cd01092
759913001618	active site
759913001619	catabolite control protein A; Region: ccpA; TIGR01481
759913001620	Helix-turn-helix (HTH) DNA binding domain of the LacI family of transcriptional regulators; Region: HTH_LacI; cd01392
759913001621	DNA binding site [nucleotide binding]
759913001622	domain linker motif; other site
759913001623	Ligand-binding domain of the catabolite control protein A (CcpA), which functions as the major transcriptional regulator of carbon catabolite repression/regulation; Region: PBP1_CcpA_like; cd06298
759913001624	dimerization interface [polypeptide binding]; other site
759913001625	effector binding site; other site
759913001626	cytoplasmic alpha-amylase; Reviewed; Region: PRK09441
759913001627	Alpha amylase catalytic domain found in bacterial and fungal Alpha amylases (also called 1,4-alpha-D-glucan-4-glucanohydrolase); Region: AmyAc_bac_fung_AmyA; cd11318
759913001628	active site
759913001629	Na/Ca binding site [ion binding]; other site
759913001630	catalytic site [active]
759913001631	Domain of unknown function (DUF1939); Region: DUF1939; pfam09154
759913001632	Glycosyltransferase [Cell envelope biogenesis, outer membrane]; Region: RfaG; COG0438
759913001633	Glycosyltransferases catalyze the transfer of sugar moieties from activated donor molecules to specific acceptor molecules, forming glycosidic bonds. The acceptor molecule can be a lipid, a protein, a heterocyclic compound, or another carbohydrate...; Region: Glycosyltransferase_GTB_type; cl10013
759913001634	Glycosyltransferase [Cell envelope biogenesis, outer membrane]; Region: RfaG; COG0438
759913001635	This family is most closely related to the GT1 family of glycosyltransferases. UDP-glucose-diacylglycerol glucosyltransferase (UGDG; also known as 1,2-diacylglycerol 3-glucosyltransferase) catalyzes the transfer of glucose from UDP-glucose to 1; Region: GT1_UGDG_like; cd03817
759913001636	putative ADP-binding pocket [chemical binding]; other site
759913001637	threonyl-tRNA synthetase; Reviewed; Region: thrS; PRK00413
759913001638	TGS _ThrRS_N:  ThrRS (threonyl-tRNA Synthetase)  is a class II tRNA synthetase that couples threonine to its cognate tRNA.  In addition to its catalytic and anticodon-binding domains, ThrRS has an N-terminal TGS domain, named after the ThrRS, GTPase, and...; Region: TGS_ThrRS_N; cd01667
759913001639	Threonyl and Alanyl tRNA synthetase second additional domain; Region: tRNA_SAD; smart00863
759913001640	Threonyl-tRNA synthetase (ThrRS) class II core catalytic domain. ThrRS is a homodimer. It is responsible for the attachment of threonine to the 3' OH group of ribose of the appropriate tRNA. This domain is primarily responsible for ATP-dependent...; Region: ThrRS_core; cd00771
759913001641	active site
759913001642	dimer interface [polypeptide binding]; other site
759913001643	motif 1; other site
759913001644	motif 2; other site
759913001645	motif 3; other site
759913001646	ThrRS Threonyl-anticodon binding domain. ThrRS belongs to class II aminoacyl-tRNA synthetases (aaRS). This alignment contains the anticodon binding domain, which is responsible for specificity in tRNA-binding, so that the activated amino acid is...; Region: ThrRS_anticodon; cd00860
759913001647	anticodon binding site; other site
759913001648	ABC-type uncharacterized transport system, ATPase component [General function prediction only]; Region: COG4586
759913001649	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
759913001650	Walker A/P-loop; other site
759913001651	ATP binding site [chemical binding]; other site
759913001652	Q-loop/lid; other site
759913001653	ABC transporter signature motif; other site
759913001654	Walker B; other site
759913001655	D-loop; other site
759913001656	H-loop/switch region; other site
759913001657	ABC-type uncharacterized transport system, permease component [General function prediction only]; Region: COG4587
759913001658	ABC-2 family transporter protein; Region: ABC2_membrane_6; cl01496
759913001659	ABC-type uncharacterized transport system, permease component [General function prediction only]; Region: COG3694
759913001660	DhaKLM operon coactivator DhaQ; Provisional; Region: PRK14483
759913001661	Dihydroxyacetone kinase [Carbohydrate transport and metabolism]; Region: DAK1; COG2376
759913001662	probable dihydroxyacetone kinase regulator; Region: DHAK_reg; TIGR02366
759913001663	dihydroxyacetone kinase subunit DhaK; Provisional; Region: PRK14481
759913001664	Dihydroxyacetone kinase [Carbohydrate transport and metabolism]; Region: DAK1; COG2376
759913001665	dihydroxyacetone kinase, phosphoprotein-dependent, L subunit; Region: dha_L_ycgS; TIGR02365
759913001666	phosphotransferase mannnose-specific family component IIA; Provisional; Region: PRK14484
759913001667	Major intrinsic protein (MIP) superfamily. Members of the MIP superfamily function as membrane channels that selectively transport water, small neutral molecules, and ions out of and between cells. The channel proteins share a common fold: the N-terminal...; Region: MIP; cd00333
759913001668	amphipathic channel; other site
759913001669	Asn-Pro-Ala signature motifs; other site
759913001670	The hotdog fold was initially identified in the E. coli FabA (beta-hydroxydecanoyl-acyl carrier protein (ACP)-dehydratase) structure and subsequently in 4HBT (4-hydroxybenzoyl-CoA thioesterase) from Pseudomonas. A number of other seemingly unrelated...; Region: hot_dog; cl00509
759913001671	active site 2 [active]
759913001672	active site 1 [active]
759913001673	Thiolase are ubiquitous enzymes that catalyze the reversible thiolytic cleavage of 3-ketoacyl-CoA into acyl-CoA and acetyl-CoA, a 2-step reaction involving a covalent intermediate formed with a catalytic cysteine. They are found in prokaryotes and...; Region: thiolase; cd00751
759913001674	acetyl-CoA acetyltransferases; Region: AcCoA-C-Actrans; TIGR01930
759913001675	dimer interface [polypeptide binding]; other site
759913001676	active site
759913001677	D-alanine--poly(phosphoribitol) ligase, subunit 1; Region: D-ala-DACP-lig; TIGR01734
759913001678	Adenylate forming domain, Class I; Region: AFD_class_I; cl17068
759913001679	AMP binding site [chemical binding]; other site
759913001680	active site
759913001681	acyl-activating enzyme (AAE) consensus motif; other site
759913001682	CoA binding site [chemical binding]; other site
759913001683	Protein of unknown function (DUF3114); Region: DUF3114; pfam11311
759913001684	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
759913001685	dimer interface [polypeptide binding]; other site
759913001686	conserved gate region; other site
759913001687	putative PBP binding loops; other site
759913001688	ABC-ATPase subunit interface; other site
759913001689	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
759913001690	dimer interface [polypeptide binding]; other site
759913001691	conserved gate region; other site
759913001692	putative PBP binding loops; other site
759913001693	ABC-ATPase subunit interface; other site
759913001694	bifunctional adhesin/ABC transporter aspartate/glutamate-binding protein; Reviewed; Region: PRK11917
759913001695	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
759913001696	substrate binding pocket [chemical binding]; other site
759913001697	membrane-bound complex binding site; other site
759913001698	hinge residues; other site
759913001699	ABC-type polar amino acid transport system, ATPase component [Amino acid transport and metabolism]; Region: GlnQ; COG1126
759913001700	ATP-binding cassette domain of the histidine and glutamine transporters; Region: ABC_HisP_GlnQ; cd03262
759913001701	Walker A/P-loop; other site
759913001702	ATP binding site [chemical binding]; other site
759913001703	Q-loop/lid; other site
759913001704	ABC transporter signature motif; other site
759913001705	Walker B; other site
759913001706	D-loop; other site
759913001707	H-loop/switch region; other site
759913001708	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
759913001709	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
759913001710	active site
759913001711	phosphorylation site [posttranslational modification]
759913001712	intermolecular recognition site; other site
759913001713	dimerization interface [polypeptide binding]; other site
759913001714	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
759913001715	DNA binding site [nucleotide binding]
759913001716	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: VicK; COG5002
759913001717	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
759913001718	putative active site [active]
759913001719	heme pocket [chemical binding]; other site
759913001720	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
759913001721	dimer interface [polypeptide binding]; other site
759913001722	phosphorylation site [posttranslational modification]
759913001723	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
759913001724	ATP binding site [chemical binding]; other site
759913001725	Mg2+ binding site [ion binding]; other site
759913001726	G-X-G motif; other site
759913001727	Metal-dependent hydrolases of the beta-lactamase superfamily I [General function prediction only]; Region: PhnP; COG1235
759913001728	Predicted Zn-dependent hydrolases of the beta-lactamase fold [General function prediction only]; Region: COG2220
759913001729	Transposase DDE domain; Region: DDE_Tnp_1; pfam01609
759913001730	Transposase DDE domain; Region: DDE_Tnp_1_3; pfam13612
759913001731	ribonuclease III; Reviewed; Region: rnc; PRK00102
759913001732	RIBOc. Ribonuclease III C terminal domain. This group consists of eukaryotic, bacterial and archeal ribonuclease III (RNAse III) proteins. RNAse III is a double stranded RNA-specific endonuclease. Prokaryotic RNAse III is important in...; Region: RIBOc; cd00593
759913001733	dimerization interface [polypeptide binding]; other site
759913001734	active site
759913001735	metal binding site [ion binding]; metal-binding site
759913001736	Double-stranded RNA binding motif. Binding is not sequence specific but is highly specific for double stranded RNA. Found in a variety of proteins including dsRNA dependent protein kinase PKR, RNA helicases, Drosophila staufen protein, E. coli RNase III; Region: DSRM; cd00048
759913001737	dsRNA binding site [nucleotide binding]; other site
759913001738	Chromosome segregation ATPases [Cell division and chromosome partitioning]; Region: Smc; COG1196
759913001739	ATP-binding cassette domain of barmotin, a member of the SMC protein family; Region: ABC_SMC_barmotin; cd03278
759913001740	Walker A/P-loop; other site
759913001741	ATP binding site [chemical binding]; other site
759913001742	Q-loop/lid; other site
759913001743	SMC proteins Flexible Hinge Domain; Region: SMC_hinge; smart00968
759913001744	ATP-binding cassette domain of barmotin, a member of the SMC protein family; Region: ABC_SMC_barmotin; cd03278
759913001745	ABC transporter signature motif; other site
759913001746	Walker B; other site
759913001747	D-loop; other site
759913001748	H-loop/switch region; other site
759913001749	YSIRK type signal peptide; Region: YSIRK_signal; pfam04650
759913001750	Peptidase domain in the S8 and S53 families; Region: Peptidases_S8_S53; cl10459
759913001751	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
759913001752	haloacid dehalogenase-like hydrolase; Region: Hydrolase_3; pfam08282
759913001753	active site
759913001754	motif I; other site
759913001755	motif II; other site
759913001756	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
759913001757	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
759913001758	haloacid dehalogenase-like hydrolase; Region: Hydrolase_3; pfam08282
759913001759	active site
759913001760	motif I; other site
759913001761	motif II; other site
759913001762	haloacid dehalogenase-like hydrolase; Region: HAD; cl17202
759913001763	signal recognition particle-docking protein FtsY; Provisional; Region: PRK10416
759913001764	SRP54-type protein, helical bundle domain; Region: SRP54_N; pfam02881
759913001765	The signal recognition particle (SRP) mediates the transport to or across the plasma membrane in bacteria and the endoplasmic reticulum in eukaryotes. SRP recognizes N-terminal sighnal sequences of newly synthesized polypeptides at the ribosome. The...; Region: SRP; cd03115
759913001766	P loop; other site
759913001767	GTP binding site [chemical binding]; other site
759913001768	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
759913001769	Major Facilitator Superfamily; Region: MFS_1; pfam07690
759913001770	putative substrate translocation pore; other site
759913001771	transcriptional antiterminator BglG; Provisional; Region: PRK09772
759913001772	CAT RNA binding domain; Region: CAT_RBD; smart01061
759913001773	PRD domain; Region: PRD; pfam00874
759913001774	PRD domain; Region: PRD; pfam00874
759913001775	PTS system, beta-glucoside-specific IIABC component; Region: PTS-II-ABC-beta; TIGR01995
759913001776	PTS_IIB, PTS system, glucose/sucrose specific IIB subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This family...; Region: PTS_IIB_glc; cd00212
759913001777	active site turn [active]
759913001778	phosphorylation site [posttranslational modification]
759913001779	Phosphotransferase system IIC components, glucose/maltose/N-acetylglucosamine-specific [Carbohydrate transport and metabolism]; Region: PtsG; COG1263
759913001780	Phosphotransferase system IIA components [Carbohydrate transport and metabolism]; Region: NagE; COG2190
759913001781	HPr interaction site; other site
759913001782	glycerol kinase (GK) interaction site [polypeptide binding]; other site
759913001783	active site
759913001784	phosphorylation site [posttranslational modification]
759913001785	Beta-glucosidase/6-phospho-beta-glucosidase/beta- galactosidase [Carbohydrate transport and metabolism]; Region: BglB; COG2723
759913001786	beta-galactosidase; Region: BGL; TIGR03356
759913001787	Predicted membrane protein [Function unknown]; Region: COG3689
759913001788	Predicted permeases [General function prediction only]; Region: COG0701
759913001789	Uncharacterized conserved protein [Function unknown]; Region: COG3542
759913001790	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
759913001791	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
759913001792	active site
759913001793	phosphorylation site [posttranslational modification]
759913001794	intermolecular recognition site; other site
759913001795	dimerization interface [polypeptide binding]; other site
759913001796	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
759913001797	DNA binding site [nucleotide binding]
759913001798	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
759913001799	dimer interface [polypeptide binding]; other site
759913001800	phosphorylation site [posttranslational modification]
759913001801	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
759913001802	ATP binding site [chemical binding]; other site
759913001803	G-X-G motif; other site
759913001804	PBP superfamily domain; Region: PBP_like_2; cl17296
759913001805	ABC-type phosphate transport system, periplasmic component [Inorganic ion transport and metabolism]; Region: PstS; COG0226
759913001806	ABC-type phosphate transport system, permease component [Inorganic ion transport and metabolism]; Region: PstC; COG0573
759913001807	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
759913001808	dimer interface [polypeptide binding]; other site
759913001809	conserved gate region; other site
759913001810	putative PBP binding loops; other site
759913001811	ABC-ATPase subunit interface; other site
759913001812	phosphate ABC transporter, permease protein PstA; Region: 3a0107s02c; TIGR00974
759913001813	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
759913001814	dimer interface [polypeptide binding]; other site
759913001815	conserved gate region; other site
759913001816	putative PBP binding loops; other site
759913001817	ABC-ATPase subunit interface; other site
759913001818	phosphate transporter ATP-binding protein; Provisional; Region: PRK14240
759913001819	ATP-binding cassette domain of the phosphate transport system; Region: ABC_PstB_phosphate_transporter; cd03260
759913001820	Walker A/P-loop; other site
759913001821	ATP binding site [chemical binding]; other site
759913001822	Q-loop/lid; other site
759913001823	ABC transporter signature motif; other site
759913001824	Walker B; other site
759913001825	D-loop; other site
759913001826	H-loop/switch region; other site
759913001827	phosphate transport system regulatory protein PhoU; Region: phoU_full; TIGR02135
759913001828	PhoU domain; Region: PhoU; pfam01895
759913001829	PhoU domain; Region: PhoU; pfam01895
759913001830	Transcriptional accessory protein [Transcription]; Region: Tex; COG2183
759913001831	Tex-like protein N-terminal domain; Region: Tex_N; pfam09371
759913001832	Likely ribonuclease with RNase H fold; Region: YqgFc; smart00732
759913001833	S1_Tex: The C-terminal S1 domain of a transcription accessory factor called Tex, which has been characterized in Bordetella pertussis and Pseudomonas aeruginosa. The tex gene is essential in Bortella pertusis and is named for its role in toxin expression; Region: S1_Tex; cd05685
759913001834	RNA binding site [nucleotide binding]; other site
759913001835	Zn-dependent metalloprotease, SprT family [General function prediction only]; Region: SprT; COG3091
759913001836	hypothetical protein; Provisional; Region: PRK04351
759913001837	Putative stress-responsive transcriptional regulator [Transcription / Signal transduction mechanisms]; Region: PspC; COG1983
759913001838	HPr kinase/phosphorylase; Provisional; Region: PRK05428
759913001839	HPr Serine kinase N terminus; Region: Hpr_kinase_N; pfam02603
759913001840	HprK/P, the bifunctional histidine-containing protein kinase/phosphatase, controls the phosphorylation state of the phosphocarrier protein HPr and regulates the utilization of carbon sources by gram-positive bacteria. It catalyzes both the ATP-dependent...; Region: HprK_C; cd01918
759913001841	Hpr binding site; other site
759913001842	active site
759913001843	homohexamer subunit interaction site [polypeptide binding]; other site
759913001844	prolipoprotein diacylglyceryl transferase; Reviewed; Region: PRK12437
759913001845	Uncharacterized protein containing a divergent version of the methyl-accepting chemotaxis-like domain [General function prediction only]; Region: COG4768
759913001846	YtxH-like protein; Region: YtxH; pfam12732
759913001847	Protein of unknown function (DUF3270); Region: DUF3270; pfam11674
759913001848	Collagenase and related proteases [Posttranslational modification, protein turnover, chaperones]; Region: COG0826
759913001849	Phosphoribosyltransferase (PRTase) type II; This family contains two enzymes that play an important role in NAD production by either allowing quinolinic acid (QA) , quinolinate phosphoribosyl transferase (QAPRTase), or nicotinic acid (NA), nicotinate...; Region: PRTase_typeII; cl17275
759913001850	Peptidase family U32; Region: Peptidase_U32; pfam01136
759913001851	Collagenase and related proteases [Posttranslational modification, protein turnover, chaperones]; Region: COG0826
759913001852	Peptidase family U32; Region: Peptidase_U32; pfam01136
759913001853	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4443
759913001854	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox_3; pfam13738
759913001855	Ammonium Transporter Family; Region: Ammonium_transp; cl03012
759913001856	Ammonium Transporter Family; Region: Ammonium_transp; cl03012
759913001857	lysyl-tRNA synthetase; Reviewed; Region: lysS; PRK00484
759913001858	LysRS_N: N-terminal, anticodon recognition domain of lysyl-tRNA synthetases (LysRS). These enzymes are homodimeric class 2b aminoacyl-tRNA synthetases (aaRSs). This domain is a beta-barrel domain (OB fold) involved in binding the tRNA anticodon stem-loop; Region: LysRS_N; cd04322
759913001859	dimer interface [polypeptide binding]; other site
759913001860	putative anticodon binding site; other site
759913001861	Lys_tRNA synthetase (LysRS) class II core domain. Class II LysRS is a dimer which attaches a lysine to the 3' OH group of ribose of the appropriate tRNA. Its assignment to class II aaRS is based upon its structure and the presence of three...; Region: LysRS_core; cd00775
759913001862	motif 1; other site
759913001863	active site
759913001864	motif 2; other site
759913001865	motif 3; other site
759913001866	Predicted hydrolase (HAD superfamily) [General function prediction only]; Region: COG1011
759913001867	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
759913001868	motif II; other site
759913001869	Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067
759913001870	catalytic core [active]
759913001871	hypothetical protein; Provisional; Region: PRK11770
759913001872	Domain of unknown function (DUF307); Region: DUF307; pfam03733
759913001873	Domain of unknown function (DUF307); Region: DUF307; pfam03733
759913001874	This CD includes cysteinyl-tRNA(Pro) deacylases from Haemophilus influenzae and Escherichia coli and other related bacterial proteins. These trans-acting, single-domain proteins are homologs of ProX and also the cis-acting prolyl-tRNA synthetase (ProRS)...; Region: YbaK_deacylase; cd00002
759913001875	putative deacylase active site [active]
759913001876	Thiamine transporter protein (Thia_YuaJ); Region: Thia_YuaJ; cl17491
759913001877	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3666
759913001878	Transposase DDE domain; Region: DDE_Tnp_1; pfam01609
759913001879	Transposase DDE domain; Region: DDE_Tnp_1_6; pfam13751
759913001880	PlyB is a bacteriophage endolysin that displays potent lytic activity toward Bacillus anthracis.  PlyB has an N-terminal glycosyl hydrolase family 25 (GH25) catalytic domain and a C-terminal bacterial SH3-like domain, SH3b.  Both domains are required for...; Region: GH25_PlyB-like; cd06523
759913001881	Glycosyl hydrolases family 25; Region: Glyco_hydro_25; pfam01183
759913001882	active site
759913001883	Transposase; Region: DEDD_Tnp_IS110; pfam01548
759913001884	Transposase IS116/IS110/IS902 family; Region: Transposase_20; pfam02371
759913001885	Glutathione (GSH) peroxidase family; tetrameric selenoenzymes that catalyze the reduction of a variety of hydroperoxides including lipid peroxidases, using GSH as a specific electron donor substrate. GSH peroxidase contains one selenocysteine residue per...; Region: GSH_Peroxidase; cd00340
759913001886	catalytic residues [active]
759913001887	dimer interface [polypeptide binding]; other site
759913001888	oligoendopeptidase F; Region: pepF; TIGR00181
759913001889	Peptidase Gluzincin family (thermolysin-like proteinases, TLPs) includes peptidases M1, M2, M3, M4, M13, M32 and M36 (fungalysins); Region: GluZincin; cl14813
759913001890	Zn binding site [ion binding]; other site
759913001891	phosphoenolpyruvate carboxylase; Reviewed; Region: PRK00009
759913001892	Phosphoenolpyruvate carboxylase [Energy production and conversion]; Region: Ppc; COG2352
759913001893	Bacterial cell division membrane protein [Cell division and chromosome partitioning]; Region: FtsW; COG0772
759913001894	RNA polymerase sigma factor, sigma-70 family; Region: sigma70-ECF; TIGR02937
759913001895	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
759913001896	DNA binding residues [nucleotide binding]
759913001897	Sigma factor regulator N-terminal; Region: Sigma_reg_N; pfam13800
759913001898	Sigma factor regulator C-terminal; Region: Sigma_reg_C; pfam13791
759913001899	elongation factor Tu; Reviewed; Region: PRK00049
759913001900	Elongation Factor Tu (EF-Tu) GTP-binding proteins; Region: EF_Tu; cd01884
759913001901	G1 box; other site
759913001902	GEF interaction site [polypeptide binding]; other site
759913001903	GTP/Mg2+ binding site [chemical binding]; other site
759913001904	Switch I region; other site
759913001905	G2 box; other site
759913001906	G3 box; other site
759913001907	Switch II region; other site
759913001908	G4 box; other site
759913001909	G5 box; other site
759913001910	EFTU_II: Elongation factor Tu domain II. Elongation factors Tu (EF-Tu) are three-domain GTPases with an essential function in the elongation phase of mRNA translation. The GTPase center of EF-Tu is in the N-terminal domain (domain I), also known as the...; Region: EFTU_II; cd03697
759913001911	Domain III of elongation factor (EF) Tu. Ef-Tu consists of three structural domains, designated I, II and III. Domain III adopts a beta barrel structure. Domain III is involved in binding to both charged tRNA and binding to elongation factor Ts (EF-Ts); Region: EFTU_III; cd03707
759913001912	Antibiotic Binding Site [chemical binding]; other site
759913001913	N-glycosyltransferase; Provisional; Region: PRK11204
759913001914	CESA_like is  the cellulose synthase superfamily; Region: CESA_like; cd06423
759913001915	DXD motif; other site
759913001916	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3666
759913001917	Transposase DDE domain; Region: DDE_Tnp_1; pfam01609
759913001918	Transposase DDE domain; Region: DDE_Tnp_1_6; pfam13751
759913001919	Glycosyltransferases, probably involved in cell wall biogenesis [Cell envelope biogenesis, outer membrane]; Region: COG1215
759913001920	Glycosyl transferase family group 2; Region: Glyco_trans_2_3; pfam13632
759913001921	triosephosphate isomerase; Provisional; Region: PRK14567
759913001922	Triosephosphate isomerase (TIM) is a glycolytic enzyme that catalyzes the interconversion of dihydroxyacetone phosphate and D-glyceraldehyde-3-phosphate. The reaction is very efficient and requires neither cofactors nor metal ions. TIM, usually...; Region: TIM; cd00311
759913001923	substrate binding site [chemical binding]; other site
759913001924	dimer interface [polypeptide binding]; other site
759913001925	catalytic triad [active]
759913001926	putative transposase OrfB; Reviewed; Region: PHA02517
759913001927	HTH-like domain; Region: HTH_21; pfam13276
759913001928	Integrase core domain; Region: rve; pfam00665
759913001929	Integrase core domain; Region: rve_2; pfam13333
759913001930	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG2963
759913001931	Transposase; Region: HTH_Tnp_1; cl17663
759913001932	Integrase core domain; Region: rve; pfam00665
759913001933	Integrase core domain; Region: rve_3; pfam13683
759913001934	HTH-like domain; Region: HTH_21; pfam13276
759913001935	Integrase core domain; Region: rve; pfam00665
759913001936	Transposase; Region: HTH_Tnp_1; pfam01527
759913001937	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG2963
759913001938	TIM barrel proteins share a structurally conserved phosphate binding motif and in general share an eight beta/alpha closed barrel structure. Specific for this family is the conserved phosphate binding site at the edges of strands 7 and 8. The phosphate...; Region: TIM_phosphate_binding; cl17186
759913001939	FemAB family; Region: FemAB; pfam02388
759913001940	Acetyltransferase (GNAT) domain; Region: Acetyltransf_6; pfam13480
759913001941	FemAB family; Region: FemAB; pfam02388
759913001942	Acetyltransferase (GNAT) domain; Region: Acetyltransf_6; pfam13480
759913001943	sugar phosphate phosphatase; Provisional; Region: PRK10513
759913001944	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
759913001945	motif II; other site
759913001946	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
759913001947	haloacid dehalogenase-like hydrolase; Region: HAD; cl17202
759913001948	HD superfamily phosphohydrolases [General function prediction only]; Region: COG1078
759913001949	Metal dependent phosphohydrolases with conserved 'HD' motif; Region: HDc; cd00077
759913001950	Zn2+ binding site [ion binding]; other site
759913001951	Mg2+ binding site [ion binding]; other site
759913001952	Domain of unknown function (DUF1934); Region: DUF1934; pfam09148
759913001953	Cation transport ATPase [Inorganic ion transport and metabolism]; Region: MgtA; COG0474
759913001954	Cation transporter/ATPase, N-terminus; Region: Cation_ATPase_N; pfam00690
759913001955	E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122
759913001956	Putative hydrolase of sodium-potassium ATPase alpha subunit; Region: Hydrolase_like2; pfam13246
759913001957	haloacid dehalogenase-like hydrolase; Region: HAD; pfam12710
759913001958	Cation transporting ATPase, C-terminus; Region: Cation_ATPase_C; pfam00689
759913001959	Transcriptional regulators [Transcription]; Region: PurR; COG1609
759913001960	Helix-turn-helix (HTH) DNA binding domain of the LacI family of transcriptional regulators; Region: HTH_LacI; cd01392
759913001961	DNA binding site [nucleotide binding]
759913001962	domain linker motif; other site
759913001963	Ligand-binding domain of DNA transcription repressor RegR and other putative regulators such as KdgR and EndR; Region: PBP1_RegR_EndR_KdgR_like; cd06283
759913001964	putative dimerization interface [polypeptide binding]; other site
759913001965	putative ligand binding site [chemical binding]; other site
759913001966	Heparinase II/III-like protein; Region: Hepar_II_III; pfam07940
759913001967	Phosphotransferase system, mannose/fructose/N-acetylgalactosamine-specific component IID [Carbohydrate transport and metabolism]; Region: ManZ; COG3716
759913001968	Phosphotransferase system, mannose/fructose/N-acetylgalactosamine-specific component IIC [Carbohydrate transport and metabolism]; Region: ManY; COG3715
759913001969	PTS_IIB, PTS system, Mannose/sorbose specific IIB subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This family...; Region: PTS_IIB_man; cd00001
759913001970	active site
759913001971	phosphorylation site [posttranslational modification]
759913001972	Glycosyl Hydrolase Family 88; Region: Glyco_hydro_88; pfam07470
759913001973	PTS_IIA, PTS system, mannose/sorbose specific IIA subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This family...; Region: PTS_IIA_man; cd00006
759913001974	active pocket/dimerization site; other site
759913001975	active site
759913001976	phosphorylation site [posttranslational modification]
759913001977	gluconate 5-dehydrogenase; Provisional; Region: PRK07097
759913001978	gluconate 5-dehydrogenase (Ga5DH)-like, classical (c) SDRs; Region: Ga5DH-like_SDR_c; cd05347
759913001979	NADP binding site [chemical binding]; other site
759913001980	homodimer interface [polypeptide binding]; other site
759913001981	active site
759913001982	hypothetical protein; Provisional; Region: PRK09273
759913001983	Ribose 5-phosphate isomerase RpiB [Carbohydrate transport and metabolism]; Region: RpiB; COG0698
759913001984	Ribose-5-phosphate isomerase; Region: DUF3666; pfam12408
759913001985	Sugar kinases, ribokinase family [Carbohydrate transport and metabolism]; Region: RbsK; COG0524
759913001986	2-keto-3-deoxygluconate kinase (KdgK) phosphorylates 2-keto-3-deoxygluconate (KDG) to form 2-keto-3-deoxy-6-phosphogluconate (KDGP). KDG is the common intermediate product, that allows organisms to channel D-glucuronate and/or D-galacturinate into the...; Region: KdgK; cd01166
759913001987	substrate binding site [chemical binding]; other site
759913001988	ATP binding site [chemical binding]; other site
759913001989	2-keto-3-deoxy-6-phosphogluconate aldolase [Carbohydrate transport and metabolism]; Region: Eda; COG0800
759913001990	KDPG and KHG aldolase; Region: KDPG_aldolase; cd00452
759913001991	active site
759913001992	intersubunit interface [polypeptide binding]; other site
759913001993	catalytic residue [active]
759913001994	Glycosaminoglycan (GAG) polysaccharide lyase family. This family consists of a group of secreted bacterial lyase enzymes capable of acting on glycosaminoglycans, such as hyaluronan and chondroitin, in the extracellular matrix of host tissues; Region: GAG_Lyase; cd01083
759913001995	substrate binding site [chemical binding]; other site
759913001996	catalytic residues [active]
759913001997	Calcineurin-like phosphoesterase; Region: Metallophos; pfam00149
759913001998	metallophosphatase superfamily, metallophosphatase domain; Region: MPP_superfamily; cd00838
759913001999	active site
759913002000	metal binding site [ion binding]; metal-binding site
759913002001	Tunnelling fold (T-fold). The five known T-folds are found in five different enzymes with different functions: dihydroneopterin-triphosphate epimerase (DHNTPE), dihydroneopterin aldolase (DHNA) , GTP cyclohydrolase I (GTPCH-1),  6-pyrovoyl...; Region: TFold; cl00263
759913002002	putative transposase OrfB; Reviewed; Region: PHA02517
759913002003	HTH-like domain; Region: HTH_21; pfam13276
759913002004	Integrase core domain; Region: rve; pfam00665
759913002005	Integrase core domain; Region: rve_3; cl15866
759913002006	Transposase; Region: HTH_Tnp_1; pfam01527
759913002007	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG2963
759913002008	Haloacid dehalogenase-like hydrolase; Region: HAD_2; pfam13419
759913002009	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
759913002010	motif II; other site
759913002011	Firmicute fructose-1,6-bisphosphatase; Region: FBPase_2; pfam06874
759913002012	epoxyqueuosine reductase; Region: TIGR00276
759913002013	Domain of unknown function (DUF1730); Region: DUF1730; pfam08331
759913002014	PCRF domain; Region: PCRF; pfam03462
759913002015	Protein chain release factor B [Translation, ribosomal structure and biogenesis]; Region: PrfB; COG1186
759913002016	RF-1 domain; Region: RF-1; pfam00472
759913002017	Predicted ATPase involved in cell division [Cell division and chromosome partitioning]; Region: FtsE; COG2884
759913002018	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
759913002019	Walker A/P-loop; other site
759913002020	ATP binding site [chemical binding]; other site
759913002021	Q-loop/lid; other site
759913002022	ABC transporter signature motif; other site
759913002023	Walker B; other site
759913002024	D-loop; other site
759913002025	H-loop/switch region; other site
759913002026	Cell division protein [Cell division and chromosome partitioning]; Region: FtsX; COG2177
759913002027	cell division ABC transporter subunit FtsX; Provisional; Region: ftsX; PRK11026
759913002028	FtsX-like permease family; Region: FtsX; pfam02687
759913002029	Zn-dependent hydrolases, including glyoxylases [General function prediction only]; Region: GloB; COG0491
759913002030	bifunctional ATP-dependent DNA helicase/DNA polymerase III subunit epsilon; Validated; Region: PRK07246
759913002031	DEDDh 3'-5' exonuclease domain family; Region: DEDDh; cd06127
759913002032	active site
759913002033	catalytic site [active]
759913002034	substrate binding site [chemical binding]; other site
759913002035	DEAD/DEAH box helicase; Region: DEAD; pfam00270
759913002036	ATP binding site [chemical binding]; other site
759913002037	Helicase C-terminal domain; Region: Helicase_C_2; pfam13307
759913002038	aspartate aminotransferase; Provisional; Region: PRK05764
759913002039	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
759913002040	pyridoxal 5'-phosphate binding site [chemical binding]; other site
759913002041	homodimer interface [polypeptide binding]; other site
759913002042	catalytic residue [active]
759913002043	asparaginyl-tRNA synthetase; Validated; Region: asnC; PRK03932
759913002044	AsnRS_cyto_like_N: N-terminal, anticodon recognition domain of the type found in human and Saccharomyces cerevisiae cytoplasmic asparaginyl-tRNA synthetase (AsnRS), in Brugia malayai AsnRs and, in various putative bacterial AsnRSs.  This domain is a...; Region: AsnRS_cyto_like_N; cd04323
759913002045	putative dimer interface [polypeptide binding]; other site
759913002046	putative anticodon binding site; other site
759913002047	Asx tRNA synthetase (AspRS/AsnRS) class II core domain.  Assignment to class II aminoacyl-tRNA synthetases (aaRS) based upon its structure and the presence of three characteristic sequence motifs in the core domain. This family includes AsnRS as well as...; Region: AsxRS_core; cd00776
759913002048	homodimer interface [polypeptide binding]; other site
759913002049	motif 1; other site
759913002050	motif 2; other site
759913002051	active site
759913002052	motif 3; other site
759913002053	Protein of unknown function (DUF1003); Region: DUF1003; pfam06210
759913002054	glmZ(sRNA)-inactivating NTPase; Provisional; Region: PRK05416
759913002055	conserved hypothetical protein, cofD-related; Region: CofD_related; TIGR01826
759913002056	Family of CofD-like proteins and proteins related to YvcK; Region: CofD_YvcK; cd07044
759913002057	dimer interface [polypeptide binding]; other site
759913002058	phosphate binding site [ion binding]; other site
759913002059	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG1481
759913002060	Sporulation Regulator WhiA N terminal; Region: WhiA_N; pfam10298
759913002061	Peptidase family C69; Region: Peptidase_C69; pfam03577
759913002062	ABC-type metal ion transport system, periplasmic component/surface adhesin [Inorganic ion transport and metabolism]; Region: LraI; COG0803
759913002063	Metal binding protein AcdA.  These proteins have been shown to function in the ABC uptake of Zn2+ and Mn2+ and in competence for genetic transformation and adhesion. The AcdA proteins belong to the TroA superfamily of helical backbone metal receptor...; Region: AdcA; cd01017
759913002064	metal binding site [ion binding]; metal-binding site
759913002065	YodA lipocalin-like domain; Region: YodA; pfam09223
759913002066	Transcriptional regulators [Transcription]; Region: PhnF; COG2188
759913002067	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
759913002068	DNA-binding site [nucleotide binding]; DNA binding site
759913002069	UTRA domain; Region: UTRA; pfam07702
759913002070	putative sugar isomerase, AgaS family; Region: agaS_fam; TIGR02815
759913002071	SIS (Sugar ISomerase) domain repeat 1 found in Glucosamine 6-phosphate synthase (GlmS) and Glucosamine-6-phosphate deaminase (GlmD). The SIS domain is found in many phosphosugar isomerases and phosphosugar binding proteins. GlmS contains a N-terminal...; Region: SIS_GlmS_GlmD_1; cd05008
759913002072	dimer interface [polypeptide binding]; other site
759913002073	active site
759913002074	AgaS-like protein. AgaS contains a SIS (Sugar ISomerase) domain which is found in many phosphosugar isomerases and phosphosugar binding proteins. AgaS is a putative isomerase in Escherichia coli. It is similar to the glucosamine-6-phosphate synthases; Region: SIS_AgaS_like; cd05010
759913002075	putative active site [active]
759913002076	tagatose 1,6-diphosphate aldolase; Reviewed; Region: PRK12399
759913002077	Transcriptional regulators [Transcription]; Region: PhnF; COG2188
759913002078	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
759913002079	DNA-binding site [nucleotide binding]; DNA binding site
759913002080	The UbiC transcription regulator-associated (UTRA) domain is a conserved ligand-binding domain; Region: UTRA; smart00866
759913002081	Glycosyl hydrolases family 35; Region: Glyco_hydro_35; pfam01301
759913002082	PTS_IIB, PTS system, Mannose/sorbose specific IIB subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This family...; Region: PTS_IIB_man; cd00001
759913002083	active site
759913002084	phosphorylation site [posttranslational modification]
759913002085	Phosphotransferase system, mannose/fructose/N-acetylgalactosamine-specific component IIC [Carbohydrate transport and metabolism]; Region: ManY; COG3715
759913002086	PTS system mannose/fructose/sorbose family IID component; Region: EIID-AGA; pfam03613
759913002087	PTS_IIA, PTS system, mannose/sorbose specific IIA subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This family...; Region: PTS_IIA_man; cd00006
759913002088	active pocket/dimerization site; other site
759913002089	active site
759913002090	phosphorylation site [posttranslational modification]
759913002091	50S ribosomal protein L31 type B; Reviewed; Region: rpmE2; PRK01678
759913002092	Transposase and inactivated derivatives, IS30 family [DNA replication, recombination, and repair]; Region: Tra8; COG2826
759913002093	Helix-turn-helix domain; Region: HTH_38; pfam13936
759913002094	Integrase core domain; Region: rve; pfam00665
759913002095	Transposase and inactivated derivatives, IS30 family [DNA replication, recombination, and repair]; Region: Tra8; COG2826
759913002096	Helix-turn-helix domain; Region: HTH_38; pfam13936
759913002097	Integrase core domain; Region: rve; pfam00665
759913002098	Exopolyphosphatase-related proteins [General function prediction only]; Region: COG0618
759913002099	DHH family; Region: DHH; pfam01368
759913002100	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cl17182
759913002101	putative S-transferase; Provisional; Region: PRK11752
759913002102	GST_N family, Ure2p-like subfamily; composed of the Saccharomyces cerevisiae Ure2p and related GSTs. Ure2p is a regulator for nitrogen catabolism in yeast. It represses the expression of several gene products involved in the use of poor nitrogen sources...; Region: GST_N_Ure2p_like; cd03048
759913002103	C-terminal domain interface [polypeptide binding]; other site
759913002104	GSH binding site (G-site) [chemical binding]; other site
759913002105	dimer interface [polypeptide binding]; other site
759913002106	C-terminal, alpha helical domain of the Glutathione S-transferase family; Region: GST_C_family; cl02776
759913002107	N-terminal domain interface [polypeptide binding]; other site
759913002108	dimer interface [polypeptide binding]; other site
759913002109	substrate binding pocket (H-site) [chemical binding]; other site
759913002110	Adenosine deaminase [Nucleotide transport and metabolism]; Region: Add; COG1816
759913002111	Superfamily of metallo-dependent hydrolases (also called amidohydrolase superfamily) is a large group of proteins that show conservation in their 3-dimensional fold (TIM barrel) and in details of their active site. The vast majority of the members have a...; Region: metallo-dependent_hydrolases; cl00281
759913002112	active site
759913002113	flavodoxin; Validated; Region: PRK07308
759913002114	hypothetical protein; Provisional; Region: PRK07248
759913002115	Chloride channel protein EriC [Inorganic ion transport and metabolism]; Region: EriC; COG0038
759913002116	CLC voltage-gated chloride channel. The ClC chloride channels catalyse the selective flow of Cl- ions across cell membranes, thereby regulating electrical excitation in skeletal muscle and the flow of salt and water across epithelial barriers. This...; Region: Voltage_gated_ClC; cl02915
759913002117	Cl- selectivity filter; other site
759913002118	Cl- binding residues [ion binding]; other site
759913002119	pore gating glutamate residue; other site
759913002120	dimer interface [polypeptide binding]; other site
759913002121	50S ribosomal protein L19; Provisional; Region: rplS; PRK05338
759913002122	rod shape-determining protein RodA; Region: rodA_shape; TIGR02210
759913002123	haloacid dehalogenase superfamily, subfamily IA, variant 1 with third motif having Dx(3-4)D or Dx(3-4)E; Region: HAD-SF-IA-v1; TIGR01549
759913002124	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
759913002125	motif II; other site
759913002126	DNA gyrase subunit B; Validated; Region: gyrB; PRK05644
759913002127	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
759913002128	Mg2+ binding site [ion binding]; other site
759913002129	G-X-G motif; other site
759913002130	TopoIIA_Trans_DNA_gyrase: Transducer domain, having a ribosomal S5 domain 2-like fold, of the type found in proteins of the type IIA family of DNA topoisomerases similar to the B subunits of E. coli DNA gyrase and E. coli Topoisomerase IV which are; Region: TopoII_Trans_DNA_gyrase; cd00822
759913002131	anchoring element; other site
759913002132	dimer interface [polypeptide binding]; other site
759913002133	ATP binding site [chemical binding]; other site
759913002134	TOPRIM_TopoIIA_GyrB: topoisomerase-primase (TOPRIM) nucleotidyl transferase/hydrolase domain of the type found in proteins of the type IIA family of DNA topoisomerases similar to the Escherichia coli GyrB subunit. TopoIIA enzymes cut both strands of the...; Region: TOPRIM_TopoIIA_GyrB; cd03366
759913002135	active site
759913002136	putative metal-binding site [ion binding]; other site
759913002137	DNA gyrase B subunit, carboxyl terminus; Region: DNA_gyraseB_C; pfam00986
759913002138	septation ring formation regulator EzrA; Provisional; Region: PRK04778
759913002139	Phosphoserine phosphatase [Amino acid transport and metabolism]; Region: SerB; COG0560
759913002140	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
759913002141	motif II; other site
759913002142	Protein of unknown function (DUF1694); Region: DUF1694; cl02318
759913002143	enolase; Provisional; Region: eno; PRK00077
759913002144	Enolase: Enolases are homodimeric enzymes that catalyse the reversible dehydration of 2-phospho-D-glycerate to phosphoenolpyruvate as part of the glycolytic and gluconeogenesis pathways. The reaction is facilitated by the presence of metal ions; Region: enolase; cd03313
759913002145	dimer interface [polypeptide binding]; other site
759913002146	metal binding site [ion binding]; metal-binding site
759913002147	substrate binding pocket [chemical binding]; other site
759913002148	bacteriocin protoxin, streptolysin S family; Region: streptolysinS; TIGR03602
759913002149	This family is the oxydase domain of NRPS (non-ribosomal peptide synthetase) and other proteins that modify polypeptides by cyclizing a thioester to form a ring. These include epoB, part of the epothilone biosynthesis pathway; tubD, part of the tubulysin...; Region: mcbC-like_oxidoreductase; cd02142
759913002150	putative FMN binding site [chemical binding]; other site
759913002151	NADPH bind site [chemical binding]; other site
759913002152	thiazole/oxazole-forming peptide maturase, SagC family component; Region: cyclo_dehy_ocin; TIGR03603
759913002153	thiazole/oxazole-forming peptide maturase, SagD family component; Region: TOMM_cyclo_SagD; TIGR03604
759913002154	YcaO-like family; Region: YcaO; pfam02624
759913002155	CAAX protease self-immunity; Region: Abi; pfam02517
759913002156	ABC-type multidrug transport system, ATPase component [Defense mechanisms]; Region: CcmA; COG1131
759913002157	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
759913002158	Walker A/P-loop; other site
759913002159	ATP binding site [chemical binding]; other site
759913002160	Q-loop/lid; other site
759913002161	ABC transporter signature motif; other site
759913002162	Walker B; other site
759913002163	D-loop; other site
759913002164	H-loop/switch region; other site
759913002165	ABC-2 family transporter protein; Region: ABC2_membrane_3; pfam12698
759913002166	ABC-2 type transporter; Region: ABC2_membrane; pfam01061
759913002167	ABC-type multidrug transport system, permease component [Defense mechanisms]; Region: COG0842
759913002168	ABC-2 type transporter; Region: ABC2_membrane; pfam01061
759913002169	Predicted extracellular nuclease [General function prediction only]; Region: COG2374
759913002170	YhcR_OBF_like: A subfamily of OB-fold domains similar to the OB folds of Bacillus subtilis YhcR. YhcR is a sugar-nonspecific nuclease, which is active in the presence of Ca2+ and Mn2+. It cleaves RNA endonucleolytically, producing 3'-monophosphate...; Region: YhcR_OBF_like; cd04486
759913002171	generic binding surface II; other site
759913002172	generic binding surface I; other site
759913002173	YhcR_OBF_like: A subfamily of OB-fold domains similar to the OB folds of Bacillus subtilis YhcR. YhcR is a sugar-nonspecific nuclease, which is active in the presence of Ca2+ and Mn2+. It cleaves RNA endonucleolytically, producing 3'-monophosphate...; Region: YhcR_OBF_like; cd04486
759913002174	generic binding surface II; other site
759913002175	generic binding surface I; other site
759913002176	Exonuclease-Endonuclease-Phosphatase (EEP) domain superfamily; Region: EEP; cl00490
759913002177	putative catalytic site [active]
759913002178	putative metal binding site [ion binding]; other site
759913002179	putative phosphate binding site [ion binding]; other site
759913002180	Gram positive anchor; Region: Gram_pos_anchor; pfam00746
759913002181	Predicted membrane protein [Function unknown]; Region: COG4708
759913002182	NAD-dependent DNA ligase LigA; Validated; Region: ligA; PRK07956
759913002183	NAD+ dependent DNA ligase adenylation domain. DNA ligases catalyze the crucial step of joining the breaks in duplex DNA during DNA replication, repair and recombination, utilizing either ATP or NAD(+) as a cofactor, but using the same basic reaction...; Region: LIGANc; cd00114
759913002184	nucleotide binding pocket [chemical binding]; other site
759913002185	K-X-D-G motif; other site
759913002186	catalytic site [active]
759913002187	NAD-dependent DNA ligase OB-fold domain; Region: DNA_ligase_OB; pfam03120
759913002188	NAD-dependent DNA ligase C4 zinc finger domain; Region: DNA_ligase_ZBD; pfam03119
759913002189	Breast Cancer Suppressor Protein (BRCA1), carboxy-terminal domain. The BRCT domain is found within many DNA damage repair and cell cycle checkpoint proteins. The unique diversity of this domain superfamily allows BRCT modules to interact forming homo...; Region: BRCT; cd00027
759913002190	Dimer interface [polypeptide binding]; other site
759913002191	BRCT sequence motif; other site
759913002192	putative lipid kinase; Reviewed; Region: PRK13055
759913002193	Diacylglycerol kinase catalytic domain; Region: DAGK_cat; pfam00781
759913002194	Family 41 Carbohydrate-Binding Module from pullulanase-like enzymes; Region: CBM41_pullulanase; cd10315
759913002195	carbohydrate binding site [chemical binding]; other site
759913002196	pullulanase, type I; Region: pulA_typeI; TIGR02104
759913002197	Early set domain associated with the catalytic domain of pullulanase (also called dextrinase and alpha-dextrin endo-1,6-alpha glucosidase); Region: E_set_Pullulanase; cd02860
759913002198	Alpha amylase catalytic domain found in Pullulanase (also called dextrinase; alpha-dextrin endo-1,6-alpha glucosidase), limit dextrinase, and related proteins; Region: AmyAc_Pullulanase_LD-like; cd11341
759913002199	Ca binding site [ion binding]; other site
759913002200	active site
759913002201	catalytic site [active]
759913002202	glycogen branching enzyme; Provisional; Region: PRK12313
759913002203	N-terminal Early set domain associated with the catalytic domain of prokaryotic glycogen branching enzyme; Region: E_set_GBE_prok_N; cd02855
759913002204	Alpha amylase catalytic domain found in the Glycogen branching enzyme (also called 1,4-alpha-glucan branching enzyme); Region: AmyAc_Glg_BE; cd11322
759913002205	active site
759913002206	catalytic site [active]
759913002207	Alpha amylase, C-terminal all-beta domain; Region: Alpha-amylase_C; pfam02806
759913002208	glucose-1-phosphate adenylyltransferase; Provisional; Region: glgC; PRK05293
759913002209	ADP-glucose pyrophosphorylase is involved in the biosynthesis of glycogen or starch; Region: ADP_Glucose_PP; cd02508
759913002210	ligand binding site; other site
759913002211	oligomer interface; other site
759913002212	Glucose-1-phosphate adenylyltransferase, C-terminal Left-handed parallel beta helix (LbH) domain: Glucose-1-phosphate adenylyltransferase is also known as ADP-glucose synthase or ADP-glucose pyrophosphorylase. It catalyzes the first committed and...; Region: LbH_G1P_AT_C; cd04651
759913002213	dimer interface [polypeptide binding]; other site
759913002214	N-terminal domain interface [polypeptide binding]; other site
759913002215	glucose-1-phosphate adenylyltransferase, GlgD subunit; Region: glgD; TIGR02092
759913002216	Glycosyltransferase family A (GT-A) includes diverse families of glycosyl transferases with a common GT-A type structural fold; Region: Glyco_tranf_GTA_type; cl11394
759913002217	active site
759913002218	Glucose-1-phosphate adenylyltransferase, C-terminal Left-handed parallel beta helix (LbH) domain: Glucose-1-phosphate adenylyltransferase is also known as ADP-glucose synthase or ADP-glucose pyrophosphorylase. It catalyzes the first committed and...; Region: LbH_G1P_AT_C; cd04651
759913002219	dimer interface [polypeptide binding]; other site
759913002220	N-terminal domain interface [polypeptide binding]; other site
759913002221	sulfate 1 binding site; other site
759913002222	glycogen synthase; Provisional; Region: glgA; PRK00654
759913002223	This family is most closely related to the GT1 family of glycosyltransferases. Glycogen synthase catalyzes the formation and elongation of the alpha-1,4-glucose backbone using ADP-glucose, the second and key step of glycogen biosynthesis. This family...; Region: GT1_Glycogen_synthase_DULL1_like; cd03791
759913002224	ADP-binding pocket [chemical binding]; other site
759913002225	homodimer interface [polypeptide binding]; other site
759913002226	F0F1 ATP synthase subunit C; Provisional; Region: PRK13467
759913002227	F0F1-type ATP synthase, subunit a [Energy production and conversion]; Region: AtpB; COG0356
759913002228	F0F1 ATP synthase subunit A; Validated; Region: PRK05815
759913002229	F0F1-type ATP synthase, subunit b [Energy production and conversion]; Region: AtpF; COG0711
759913002230	F0F1 ATP synthase subunit B; Validated; Region: PRK05759
759913002231	F0F1 ATP synthase subunit delta; Validated; Region: PRK05758
759913002232	ATP synthase delta (OSCP) subunit; Region: OSCP; pfam00213
759913002233	F0F1 ATP synthase subunit alpha; Validated; Region: PRK09281
759913002234	ATP synthase alpha/beta family, beta-barrel domain; Region: ATP-synt_ab_N; pfam02874
759913002235	F1 ATP synthase alpha, central domain. The F-ATPase is found in bacterial plasma membranes, mitochondrial inner membranes and in chloroplast thylakoid membranes. It has also been found in the archaea Methanosarcina barkeri. It uses a proton gradient to...; Region: F1_ATPase_alpha; cd01132
759913002236	beta subunit interaction interface [polypeptide binding]; other site
759913002237	Walker A motif; other site
759913002238	ATP binding site [chemical binding]; other site
759913002239	Walker B motif; other site
759913002240	ATP synthase alpha/beta chain, C terminal domain; Region: ATP-synt_ab_C; pfam00306
759913002241	mitochondrial ATP synthase gamma subunit; Region: F1-ATPase_gamma; cd12151
759913002242	core domain interface [polypeptide binding]; other site
759913002243	delta subunit interface [polypeptide binding]; other site
759913002244	epsilon subunit interface [polypeptide binding]; other site
759913002245	F0F1 ATP synthase subunit beta; Validated; Region: PRK09280
759913002246	ATP synthase alpha/beta family, beta-barrel domain; Region: ATP-synt_ab_N; pfam02874
759913002247	F1 ATP synthase beta subunit, nucleotide-binding domain. The F-ATPase is found in bacterial plasma membranes, mitochondrial inner membranes and in chloroplast thylakoid membranes. It has also been found in the archaea Methanosarcina barkeri. It uses a...; Region: F1-ATPase_beta; cd01133
759913002248	alpha subunit interaction interface [polypeptide binding]; other site
759913002249	Walker A motif; other site
759913002250	ATP binding site [chemical binding]; other site
759913002251	Walker B motif; other site
759913002252	inhibitor binding site; inhibition site
759913002253	ATP synthase alpha/beta chain, C terminal domain; Region: ATP-synt_ab_C; pfam00306
759913002254	ATP synthase CF1 epsilon subunit; Region: atpE; CHL00063
759913002255	mitochondrial ATP synthase delta subunit; Region: F1-ATPase_delta; cd12152
759913002256	gamma subunit interface [polypeptide binding]; other site
759913002257	epsilon subunit interface [polypeptide binding]; other site
759913002258	LBP interface [polypeptide binding]; other site
759913002259	conserved hypothetical integral membrane protein; Region: int_mem_ywzB; TIGR02327
759913002260	UDP-N-acetylglucosamine 1-carboxyvinyltransferase; Region: murA; TIGR01072
759913002261	UDP-N-acetylglucosamine enolpyruvyl transferase catalyzes enolpyruvyl transfer as part of the first step in the biosynthesis of peptidoglycan, a component of the bacterial cell wall. The reaction is phosphoenolpyruvate + UDP-N-acetyl-D-glucosamine =...; Region: UdpNAET; cd01555
759913002262	hinge; other site
759913002263	active site
759913002264	DNA-directed RNA polymerase subunit beta; Region: EpuA; pfam11772
759913002265	DNA/RNA non-specific endonuclease; Region: Endonuclease_NS; smart00892
759913002266	DNA/RNA non-specific endonuclease; Region: Endonuclea_NS_2; cl17626
759913002267	phenylalanyl-tRNA synthetase subunit alpha; Validated; Region: pheS; PRK00488
759913002268	Aminoacyl tRNA synthetase class II, N-terminal domain; Region: Phe_tRNA-synt_N; pfam02912
759913002269	Phenylalanyl-tRNA synthetase (PheRS) alpha chain catalytic core domain. PheRS belongs to class II aminoacyl-tRNA synthetases (aaRS) based upon its structure and the presence of three characteristic sequence motifs. This domain is primarily responsible...; Region: PheRS_alpha_core; cd00496
759913002270	dimer interface [polypeptide binding]; other site
759913002271	motif 1; other site
759913002272	active site
759913002273	motif 2; other site
759913002274	motif 3; other site
759913002275	phenylalanyl-tRNA synthetase subunit beta; Reviewed; Region: pheT; PRK00629
759913002276	tRNA-binding-domain-containing prokaryotic phenylalanly tRNA synthetase (PheRS) beta chain.  PheRS aminoacylate phenylalanine transfer RNAs (tRNAphe). PheRSs belong structurally to class II aminoacyl tRNA synthetases (aaRSs) but, as they aminoacylate...; Region: tRNA_bind_bactPheRS; cd02796
759913002277	putative tRNA-binding site [nucleotide binding]; other site
759913002278	B3/4 domain; Region: B3_4; pfam03483
759913002279	tRNA synthetase B5 domain; Region: B5; smart00874
759913002280	Phenylalanyl-tRNA synthetase (PheRS) beta chain core domain. PheRS belongs to class II aminoacyl-tRNA synthetases (aaRS) based upon its structure. While class II aaRSs generally aminoacylate the 3'-OH ribose of the appropriate tRNA,  PheRS is an...; Region: PheRS_beta_core; cd00769
759913002281	dimer interface [polypeptide binding]; other site
759913002282	motif 1; other site
759913002283	motif 3; other site
759913002284	motif 2; other site
759913002285	Ferredoxin-fold anticodon binding domain; Region: FDX-ACB; smart00896
759913002286	OsmC-like protein; Region: OsmC; cl00767
759913002287	Protein of unknown function (DUF1722); Region: DUF1722; pfam08349
759913002288	MacB-like periplasmic core domain; Region: MacB_PCD; pfam12704
759913002289	ABC-type antimicrobial peptide transport system, ATPase component [Defense mechanisms]; Region: SalX; COG1136
759913002290	ATP-binding cassette domain of the transporters involved in export of lipoprotein and macrolide, and cell division protein; Region: ABC_MJ0796_LolCDE_FtsE; cd03255
759913002291	Walker A/P-loop; other site
759913002292	ATP binding site [chemical binding]; other site
759913002293	Q-loop/lid; other site
759913002294	ABC transporter signature motif; other site
759913002295	Walker B; other site
759913002296	D-loop; other site
759913002297	H-loop/switch region; other site
759913002298	Predicted metalloprotease [General function prediction only]; Region: COG2321
759913002299	Putative neutral zinc metallopeptidase; Region: Zn_peptidase; pfam04228
759913002300	ATP-dependent nuclease subunit B; Region: rexB_recomb; TIGR02774
759913002301	PD-(D/E)XK nuclease superfamily; Region: PDDEXK_1; pfam12705
759913002302	helicase-exonuclease AddAB, AddA subunit, Firmicutes type; Region: addA_Gpos; TIGR02785
759913002303	Part of AAA domain; Region: AAA_19; pfam13245
759913002304	Family description; Region: UvrD_C_2; pfam13538
759913002305	PD-(D/E)XK nuclease superfamily; Region: PDDEXK_1; pfam12705
759913002306	transaminase; Validated; Region: PRK07324
759913002307	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
759913002308	pyridoxal 5'-phosphate binding site [chemical binding]; other site
759913002309	homodimer interface [polypeptide binding]; other site
759913002310	catalytic residue [active]
759913002311	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
759913002312	Bacterial extracellular solute-binding proteins, family 3; Region: SBP_bac_3; pfam00497
759913002313	substrate binding pocket [chemical binding]; other site
759913002314	membrane-bound complex binding site; other site
759913002315	hinge residues; other site
759913002316	30S ribosomal protein S21; Reviewed; Region: rpsU; PRK00270
759913002317	Large-conductance mechanosensitive channel [Cell envelope biogenesis, outer membrane]; Region: MscL; COG1970
759913002318	large-conductance mechanosensitive channel; Reviewed; Region: mscL; PRK00567
759913002319	DNA primase; Validated; Region: dnaG; PRK05667
759913002320	CHC2 zinc finger; Region: zf-CHC2; pfam01807
759913002321	DNA primase catalytic core, N-terminal domain; Region: Toprim_N; pfam08275
759913002322	TOPRIM_DnaG_primases: The topoisomerase-primase (TORPIM) nucleotidyl transferase/hydrolase domain found in the active site regions of proteins similar to Escherichia coli DnaG. Primases synthesize RNA primers for the initiation of DNA replication. DnaG...; Region: TOPRIM_DnaG_primases; cd03364
759913002323	active site
759913002324	metal binding site [ion binding]; metal-binding site
759913002325	interdomain interaction site; other site
759913002326	DnaB-helicase binding domain of primase; Region: DnaB_bind; pfam10410
759913002327	RNA polymerase sigma factor RpoD; Validated; Region: PRK09210
759913002328	Sigma-70 factor, region 1.1; Region: Sigma70_r1_1; pfam03979
759913002329	Sigma-70 factor, region 1.2; Region: Sigma70_r1_2; pfam00140
759913002330	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
759913002331	Sigma-70 region 3; Region: Sigma70_r3; pfam04539
759913002332	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
759913002333	DNA binding residues [nucleotide binding]
759913002334	Predicted metal-sulfur cluster biosynthetic enzyme [General function prediction only]; Region: PaaD; COG2151
759913002335	dTDP-6-deoxy-L-lyxo-4-hexulose reductase and related proteins, extended (e) SDRs; Region: dTDP_HR_like_SDR_e; cd05254
759913002336	RmlD substrate binding domain; Region: RmlD_sub_bind; pfam04321
759913002337	NADP binding site [chemical binding]; other site
759913002338	active site
759913002339	putative substrate binding site [chemical binding]; other site
759913002340	This family is most closely related to the GT1 family of glycosyltransferases. Glycosyltransferases catalyze the transfer of sugar moieties from activated donor molecules to specific acceptor molecules, forming glycosidic bonds. The acceptor molecule can...; Region: GT1_like_6; cd04955
759913002341	Glycosyltransferase [Cell envelope biogenesis, outer membrane]; Region: RfaG; COG0438
759913002342	Glycosyltransferases involved in cell wall biogenesis [Cell envelope biogenesis, outer membrane]; Region: WcaA; COG0463
759913002343	Subfamily of Glycosyltransferase Family GT2 of unknown function; Region: GT_2_like_d; cd04196
759913002344	Probable Catalytic site; other site
759913002345	ABC-type polysaccharide/polyol phosphate export systems, permease component [Carbohydrate transport and metabolism / Cell envelope biogenesis, outer membrane]; Region: TagG; COG1682
759913002346	ABC-2 type transporter; Region: ABC2_membrane; pfam01061
759913002347	ABC-type polysaccharide/polyol phosphate transport system, ATPase component [Carbohydrate transport and metabolism / Cell envelope biogenesis, outer membrane]; Region: TagH; COG1134
759913002348	ATP-binding cassette component of polysaccharide transport system; Region: ABC_KpsT_Wzt; cd03220
759913002349	Walker A/P-loop; other site
759913002350	ATP binding site [chemical binding]; other site
759913002351	Q-loop/lid; other site
759913002352	ABC transporter signature motif; other site
759913002353	Walker B; other site
759913002354	D-loop; other site
759913002355	H-loop/switch region; other site
759913002356	Glycosyltransferases involved in cell wall biogenesis [Cell envelope biogenesis, outer membrane]; Region: WcaA; COG0463
759913002357	Glycosyl transferase family 2; Region: Glycos_transf_2; pfam00535
759913002358	active site
759913002359	Lipopolysaccharide biosynthesis protein [Cell envelope biogenesis, outer membrane]; Region: RgpF; COG3754
759913002360	Phosphoglycerol transferase and related proteins, alkaline phosphatase superfamily [Cell envelope biogenesis, outer membrane]; Region: MdoB; COG1368
759913002361	Sulfatase; Region: Sulfatase; pfam00884
759913002362	dolichyl-phosphate beta-D-mannosyltransferase; Region: PLN02726
759913002363	DPM_DPG-synthase_like is a member of the Glycosyltransferase 2 superfamily; Region: DPM_DPG-synthase_like; cd04179
759913002364	Ligand binding site; other site
759913002365	Putative Catalytic site; other site
759913002366	DXD motif; other site
759913002367	Uncharacterized conserved protein (DUF2304); Region: DUF2304; cl01034
759913002368	Membrane protein involved in the export of O-antigen and teichoic acid [General function prediction only]; Region: RfbX; COG2244
759913002369	Multidrug and toxic compound extrusion family and similar proteins; Region: MATE_like; cl09326
759913002370	Predicted membrane protein [Function unknown]; Region: COG4713
759913002371	peptidase T; Region: peptidase-T; TIGR01882
759913002372	M20 Peptidase T specifically cleaves tripeptides; Region: M20_peptT; cd03892
759913002373	metal binding site [ion binding]; metal-binding site
759913002374	dimer interface [polypeptide binding]; other site
759913002375	Ferredoxin [Energy production and conversion]; Region: Fer; COG1141
759913002376	cytidylate kinase; Provisional; Region: cmk; PRK00023
759913002377	Cytidine monophosphate kinase (CMPK) catalyzes the reversible phosphorylation of cytidine monophosphate (CMP) to produce cytidine diphosphate (CDP), using ATP as the preferred phosphoryl donor; Region: CMPK; cd02020
759913002378	CMP-binding site; other site
759913002379	The sites determining sugar specificity; other site
759913002380	translation initiation factor IF-3; Reviewed; Region: infC; PRK00028
759913002381	Translation initiation factor IF-3, N-terminal domain; Region: IF3_N; pfam05198
759913002382	Translation initiation factor IF-3, C-terminal domain; Region: IF3_C; pfam00707
759913002383	50S ribosomal protein L35; Reviewed; Region: rpmI; PRK00172
759913002384	Ribosomal protein L20; Region: Ribosomal_L20; cd07026
759913002385	23S rRNA binding site [nucleotide binding]; other site
759913002386	L21 binding site [polypeptide binding]; other site
759913002387	L13 binding site [polypeptide binding]; other site
759913002388	Phosphoglycerol transferase and related proteins, alkaline phosphatase superfamily [Cell envelope biogenesis, outer membrane]; Region: MdoB; COG1368
759913002389	Sulfatase; Region: Sulfatase; pfam00884
759913002390	Predicted SAM-dependent methyltransferases [General function prediction only]; Region: COG1092
759913002391	Middle domain of the SAM-dependent methyltransferase RlmI and related proteins; Region: RlmI_M_like; cd11572
759913002392	putative RNA binding site [nucleotide binding]; other site
759913002393	Methyltransferase domain; Region: Methyltransf_26; pfam13659
759913002394	3-dehydroquinate dehydratase [Amino acid transport and metabolism]; Region: AroD; COG0710
759913002395	Type I 3-dehydroquinase, (3-dehydroquinate dehydratase or DHQase); Region: DHQase_I; cd00502
759913002396	active site
759913002397	catalytic residue [active]
759913002398	dimer interface [polypeptide binding]; other site
759913002399	Chorismate synthase [Amino acid transport and metabolism]; Region: AroC; COG0082
759913002400	Chorismase synthase, the enzyme catalyzing the final step of the shikimate pathway; Region: Chorismate_synthase; cd07304
759913002401	Tetramer interface [polypeptide binding]; other site
759913002402	active site
759913002403	FMN-binding site [chemical binding]; other site
759913002404	hypothetical protein; Provisional; Region: PRK13676
759913002405	glutathione reductase; Validated; Region: PRK06116
759913002406	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
759913002407	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
759913002408	Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain; Region: Pyr_redox_dim; pfam02852
759913002409	folylpolyglutamate synthase/dihydrofolate synthase; Region: folC; TIGR01499
759913002410	Mur ligase family, glutamate ligase domain; Region: Mur_ligase_C; pfam02875
759913002411	Cysteine sulfinate desulfinase/cysteine desulfurase and related enzymes [Amino acid transport and metabolism]; Region: NifS; COG1104
759913002412	cysteine desulfurase NifS; Region: FeS_nifS; TIGR03402
759913002413	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
759913002414	catalytic residue [active]
759913002415	thiamine biosynthesis protein ThiI; Provisional; Region: PRK01565
759913002416	THUMP domain of thiamine biosynthesis protein ThiI; Region: THUMP_ThiI; cd11716
759913002417	ThiI is required for thiazole synthesis in the thiamine biosynthesis pathway. It belongs to the Adenosine Nucleotide Hydrolysis suoerfamily and predicted to bind to Adenosine nucleotide; Region: ThiI; cd01712
759913002418	Ligand Binding Site [chemical binding]; other site
759913002419	Putative enzyme of poly-gamma-glutamate biosynthesis (capsule formation) [Cell envelope biogenesis, outer membrane]; Region: PgsA; COG2843
759913002420	CapA and related proteins, metallophosphatase domain; Region: MPP_CapA; cd07381
759913002421	putative active site [active]
759913002422	putative metal binding site [ion binding]; other site
759913002423	Transposase and inactivated derivatives, IS30 family [DNA replication, recombination, and repair]; Region: Tra8; COG2826
759913002424	Helix-turn-helix domain; Region: HTH_38; pfam13936
759913002425	Integrase core domain; Region: rve; pfam00665
759913002426	50S ribosomal protein L21; Validated; Region: rplU; PRK05573
759913002427	Predicted ribosomal protein [Translation, ribosomal structure and biogenesis]; Region: COG2868
759913002428	50S ribosomal protein L27; Validated; Region: rpmA; PRK05435
759913002429	Transcriptional regulator [Transcription]; Region: LysR; COG0583
759913002430	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
759913002431	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cd05466
759913002432	dimerization interface [polypeptide binding]; other site
759913002433	lipoprotein signal peptidase; Provisional; Region: PRK14797
759913002434	lipoprotein signal peptidase; Provisional; Region: PRK14787
759913002435	Pseudouridylate synthases, 23S RNA-specific [Translation, ribosomal structure and biogenesis]; Region: RluA; COG0564
759913002436	S4/Hsp/ tRNA synthetase RNA-binding domain; The domain surface is populated by conserved, charged residues that define a likely RNA-binding site;  Found in stress proteins, ribosomal proteins and tRNA synthetases; This may imply a hitherto unrecognized...; Region: S4; cd00165
759913002437	RNA binding surface [nucleotide binding]; other site
759913002438	Pseudouridine synthase, RsuA/RluD family; Region: PseudoU_synth_RluCD_like; cd02869
759913002439	active site
759913002440	Uncharacterized conserved protein [Function unknown]; Region: COG0398
759913002441	SNARE associated Golgi protein; Region: SNARE_assoc; pfam09335
759913002442	Pyrimidine operon attenuation protein/uracil phosphoribosyltransferase [Nucleotide transport and metabolism]; Region: PyrR; COG2065
759913002443	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
759913002444	active site
759913002445	uracil transporter; Provisional; Region: PRK10720
759913002446	aspartate carbamoyltransferase catalytic subunit; Provisional; Region: pyrB; PRK00856
759913002447	Aspartate/ornithine carbamoyltransferase, carbamoyl-P binding domain; Region: OTCace_N; pfam02729
759913002448	Aspartate/ornithine carbamoyltransferase, Asp/Orn binding domain; Region: OTCace; pfam00185
759913002449	carbamoyl phosphate synthase small subunit; Reviewed; Region: PRK12564
759913002450	Carbamoyl-phosphate synthase small chain, CPSase domain; Region: CPSase_sm_chain; smart01097
759913002451	Small chain of the glutamine-dependent form of carbamoyl phosphate synthase, CPSase II; Region: GATase1_CPSase; cd01744
759913002452	catalytic site [active]
759913002453	subunit interface [polypeptide binding]; other site
759913002454	carbamoyl phosphate synthase large subunit; Reviewed; Region: carB; PRK05294
759913002455	Carbamoyl-phosphate synthase L chain, N-terminal domain; Region: CPSase_L_chain; pfam00289
759913002456	Carbamoyl-phosphate synthase L chain, ATP binding domain; Region: CPSase_L_D2; pfam02786
759913002457	Carbamoyl-phosphate synthetase large chain, oligomerisation domain; Region: CPSase_L_D3; pfam02787
759913002458	Carbamoyl-phosphate synthase L chain, N-terminal domain; Region: CPSase_L_chain; pfam00289
759913002459	ATP-grasp domain; Region: ATP-grasp_4; cl17255
759913002460	Methylglyoxal synthase-like domain from type II glutamine-dependent carbamoyl phosphate synthetase (CSP). CSP, a CarA and CarB heterodimer, catalyzes the production of carbamoyl phosphate which is subsequently employed in the metabolic pathways...; Region: MGS_CPS_II; cd01424
759913002461	IMP binding site; other site
759913002462	dimer interface [polypeptide binding]; other site
759913002463	interdomain contacts; other site
759913002464	partial ornithine binding site; other site
759913002465	RND family efflux transporter, MFP subunit; Region: RND_mfp; TIGR01730
759913002466	HlyD family secretion protein; Region: HlyD_3; pfam13437
759913002467	ABC-type antimicrobial peptide transport system, ATPase component [Defense mechanisms]; Region: SalX; COG1136
759913002468	ATP-binding cassette domain of the transporters involved in export of lipoprotein and macrolide, and cell division protein; Region: ABC_MJ0796_LolCDE_FtsE; cd03255
759913002469	Walker A/P-loop; other site
759913002470	ATP binding site [chemical binding]; other site
759913002471	Q-loop/lid; other site
759913002472	ABC transporter signature motif; other site
759913002473	Walker B; other site
759913002474	D-loop; other site
759913002475	H-loop/switch region; other site
759913002476	MacB-like periplasmic core domain; Region: MacB_PCD; pfam12704
759913002477	ABC-type antimicrobial peptide transport system, permease component [Defense mechanisms]; Region: SalY; COG0577
759913002478	FtsX-like permease family; Region: FtsX; pfam02687
759913002479	SNARE associated Golgi protein; Region: SNARE_assoc; pfam09335
759913002480	Membrane domain of glycerophosphoryl diester phosphodiesterase; Region: GPDPase_memb; cl01974
759913002481	Glycerophosphoryl diester phosphodiesterase [Energy production and conversion]; Region: UgpQ; COG0584
759913002482	Glycerophosphodiester phosphodiesterase domain of uncharacterized bacterial glycerophosphodiester phosphodiesterases; Region: GDPD_memb_like; cd08579
759913002483	putative active site [active]
759913002484	catalytic site [active]
759913002485	putative metal binding site [ion binding]; other site
759913002486	30S ribosomal protein S16; Reviewed; Region: rpsP; PRK00040
759913002487	Predicted RNA-binding protein (contains KH domain) [General function prediction only]; Region: COG1837
759913002488	KH domain; Region: KH_4; pfam13083
759913002489	G-X-X-G motif; other site
759913002490	Carboxypeptidase regulatory-like domain; Region: CarboxypepD_reg; pfam13620
759913002491	Carboxypeptidase regulatory-like domain; Region: CarboxypepD_reg; pfam13620
759913002492	16S rRNA-processing protein RimM; Provisional; Region: rimM; PRK00122
759913002493	RimM N-terminal domain; Region: RimM; pfam01782
759913002494	PRC-barrel domain; Region: PRC; pfam05239
759913002495	tRNA (guanine-N(1)-)-methyltransferase; Reviewed; Region: trmD; PRK00026
759913002496	Thioredoxin reductase [Posttranslational modification, protein turnover, chaperones]; Region: TrxB; COG0492
759913002497	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
759913002498	Predicted membrane protein, putative toxin regulator [General function prediction only]; Region: PfoR; COG3641
759913002499	Phosphotransferase system, EIIC; Region: PTS_EIIC_2; pfam13303
759913002500	2-dehydropantoate 2-reductase; Reviewed; Region: PRK06522
759913002501	Ketopantoate reductase PanE/ApbA; Region: ApbA; pfam02558
759913002502	Ketopantoate reductase PanE/ApbA C terminal; Region: ApbA_C; pfam08546
759913002503	helix_turn_helix, Deoxyribose operon repressor; Region: HTH_DEOR; smart00420
759913002504	Transcriptional regulators of sugar metabolism [Transcription / Carbohydrate transport and metabolism]; Region: GlpR; COG1349
759913002505	DeoR C terminal sensor domain; Region: DeoRC; pfam00455
759913002506	Fructose-1-phosphate kinase and related fructose-6-phosphate kinase (PfkB) [Carbohydrate transport and metabolism]; Region: FruK; COG1105
759913002507	1-phosphofructokinase (FruK), minor 6-phosphofructokinase (pfkB) and related sugar kinases. FruK plays an important role in the predominant pathway for fructose utilisation.This group also contains tagatose-6-phophate kinase, an enzyme of the tagatose...; Region: FruK_PfkB_like; cd01164
759913002508	putative substrate binding site [chemical binding]; other site
759913002509	putative ATP binding site [chemical binding]; other site
759913002510	PTS system 2-O-a-mannosyl-D-glycerate specific transporter subunit IIABC; Provisional; Region: PRK09765
759913002511	PTS_IIA, PTS system, fructose/mannitol specific IIA subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This...; Region: PTS_IIA_fru; cd00211
759913002512	active site
759913002513	phosphorylation site [posttranslational modification]
759913002514	PTS_IIB_fructose: subunit IIB of enzyme II (EII) of the fructose-specific phosphoenolpyruvate:carbohydrate phosphotransferase system (PTS). In this system, EII (also referred to as FruAB) is a fructose-specific permease made up of two proteins (FruA and...; Region: PTS_IIB_fructose; cd05569
759913002515	active site
759913002516	P-loop; other site
759913002517	phosphorylation site [posttranslational modification]
759913002518	Phosphotransferase system, fructose-specific IIC component [Carbohydrate transport and metabolism]; Region: FruA; COG1299
759913002519	Muramidase (flagellum-specific) [Cell motility and secretion / Intracellular trafficking and secretion]; Region: FlgJ; COG1705
759913002520	Muramidase (flagellum-specific) [Cell motility and secretion / Intracellular trafficking and secretion]; Region: FlgJ; COG1705
759913002521	Protein of unknown function (DUF1149); Region: DUF1149; pfam06619
759913002522	EDD domain protein, DegV family; Region: DegV; TIGR00762
759913002523	Uncharacterized protein, DegV family COG1307; Region: DegV; pfam02645
759913002524	tRNA CCA-pyrophosphorylase; Provisional; Region: PRK13299
759913002525	Nucleotidyltransferase (NT) domain of ClassII CCA-adding enzymes; Region: NT_ClassII-CCAase; cd05398
759913002526	active site
759913002527	NTP binding site [chemical binding]; other site
759913002528	metal binding triad [ion binding]; metal-binding site
759913002529	Probable RNA and SrmB- binding site of polymerase A; Region: PolyA_pol_RNAbd; pfam12627
759913002530	tRNA nucleotidyltransferase domain 2 putative; Region: tRNA_NucTran2_2; pfam13735
759913002531	ATPase components of ABC transporters with duplicated ATPase domains [General function prediction only]; Region: Uup; COG0488
759913002532	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
759913002533	Walker A/P-loop; other site
759913002534	ATP binding site [chemical binding]; other site
759913002535	Q-loop/lid; other site
759913002536	ABC transporter signature motif; other site
759913002537	Walker B; other site
759913002538	D-loop; other site
759913002539	H-loop/switch region; other site
759913002540	ABC transporter; Region: ABC_tran_2; pfam12848
759913002541	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
759913002542	ABC-type multidrug transport system, ATPase and permease components [Defense mechanisms]; Region: MdlB; COG1132
759913002543	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
759913002544	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
759913002545	Walker A/P-loop; other site
759913002546	ATP binding site [chemical binding]; other site
759913002547	Q-loop/lid; other site
759913002548	ABC transporter signature motif; other site
759913002549	Walker B; other site
759913002550	D-loop; other site
759913002551	H-loop/switch region; other site
759913002552	ABC-type multidrug transport system, ATPase and permease components [Defense mechanisms]; Region: MdlB; COG1132
759913002553	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
759913002554	ATP-binding cassette domain of glucan transporter and related proteins, subfamily C; Region: ABCC_Glucan_exporter_like; cd03254
759913002555	Walker A/P-loop; other site
759913002556	ATP binding site [chemical binding]; other site
759913002557	Q-loop/lid; other site
759913002558	ABC transporter signature motif; other site
759913002559	Walker B; other site
759913002560	D-loop; other site
759913002561	H-loop/switch region; other site
759913002562	glutamate dehydrogenase; Provisional; Region: PRK09414
759913002563	Glu/Leu/Phe/Val dehydrogenase, dimerisation domain; Region: ELFV_dehydrog_N; pfam02812
759913002564	NAD(P) binding domain of glutamate dehydrogenase, subgroup 2; Region: NAD_bind_2_Glu_DH; cd05313
759913002565	NAD(P) binding site [chemical binding]; other site
759913002566	Polypeptide or peptide deformylase; a family of metalloenzymes that catalyzes the removal of the N-terminal formyl group in a growing polypeptide chain following translation initiation during protein synthesis in prokaryotes. These enzymes utilize Fe(II)...; Region: Pep_deformylase; cd00487
759913002567	active site
759913002568	catalytic residues [active]
759913002569	metal binding site [ion binding]; metal-binding site
759913002570	5'-nucleotidase/2',3'-cyclic phosphodiesterase and related esterases [Nucleotide transport and metabolism]; Region: UshA; COG0737
759913002571	Bacillus subtilis YhcR endonuclease and related proteins, N-terminal metallophosphatase domain; Region: MPP_YhcR_N; cd07412
759913002572	putative active site [active]
759913002573	putative metal binding site [ion binding]; other site
759913002574	5'-nucleotidase, C-terminal domain; Region: 5_nucleotid_C; pfam02872
759913002575	Transposase and inactivated derivatives, IS30 family [DNA replication, recombination, and repair]; Region: Tra8; COG2826
759913002576	Integrase core domain; Region: rve; pfam00665
759913002577	Transposase and inactivated derivatives, IS30 family [DNA replication, recombination, and repair]; Region: Tra8; COG2826
759913002578	Helix-turn-helix domain; Region: HTH_38; pfam13936
759913002579	ABC-type multidrug transport system, ATPase and permease components [Defense mechanisms]; Region: MdlB; COG1132
759913002580	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
759913002581	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
759913002582	Walker A/P-loop; other site
759913002583	ATP binding site [chemical binding]; other site
759913002584	Q-loop/lid; other site
759913002585	ABC transporter signature motif; other site
759913002586	Walker B; other site
759913002587	D-loop; other site
759913002588	H-loop/switch region; other site
759913002589	ABC-type multidrug transport system, ATPase and permease components [Defense mechanisms]; Region: MdlB; COG1132
759913002590	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
759913002591	ATP-binding cassette domain of glucan transporter and related proteins, subfamily C; Region: ABCC_Glucan_exporter_like; cd03254
759913002592	Walker A/P-loop; other site
759913002593	ATP binding site [chemical binding]; other site
759913002594	Q-loop/lid; other site
759913002595	ABC transporter signature motif; other site
759913002596	Walker B; other site
759913002597	D-loop; other site
759913002598	H-loop/switch region; other site
759913002599	mevalonate kinase; Region: mevalon_kin; TIGR00549
759913002600	GHMP kinases N terminal domain; Region: GHMP_kinases_N; pfam00288
759913002601	diphosphomevalonate decarboxylase; Region: mevDPdecarb; TIGR01240
759913002602	diphosphomevalonate decarboxylase; Region: PLN02407
759913002603	Mevalonate kinase [Lipid metabolism]; Region: ERG12; COG1577
759913002604	GHMP kinases N terminal domain; Region: GHMP_kinases_N; pfam00288
759913002605	GHMP kinases C terminal; Region: GHMP_kinases_C; pfam08544
759913002606	isopentenyl pyrophosphate isomerase; Provisional; Region: PRK05437
759913002607	Isopentenyl-diphosphate:dimethylallyl diphosphate isomerase type 2 (IDI-2) FMN-binding domain. Two types of IDIs have been characterized at present. The long known IDI-1 is only dependent on divalent metals for activity, whereas IDI-2 requires a metal; Region: IDI-2_FMN; cd02811
759913002608	homotetramer interface [polypeptide binding]; other site
759913002609	FMN binding site [chemical binding]; other site
759913002610	homodimer contacts [polypeptide binding]; other site
759913002611	putative active site [active]
759913002612	putative substrate binding site [chemical binding]; other site
759913002613	Mga helix-turn-helix domain; Region: Mga; pfam05043
759913002614	M protein trans-acting positive regulator (MGA) PRD domain; Region: PRD_Mga; pfam08270
759913002615	C-terminus of bacterial fibrinogen-binding adhesin; Region: SdrG_C_C; pfam10425
759913002616	Cell-wall surface anchor repeat; Region: C-term_anchor; pfam13461
759913002617	Cell-wall surface anchor repeat; Region: C-term_anchor; pfam13461
759913002618	Cell-wall surface anchor repeat; Region: C-term_anchor; pfam13461
759913002619	Cell-wall surface anchor repeat; Region: C-term_anchor; pfam13461
759913002620	Cell-wall surface anchor repeat; Region: C-term_anchor; pfam13461
759913002621	LPXTG-motif cell wall anchor domain; Region: LPXTG_anchor; TIGR01167
759913002622	Mga helix-turn-helix domain; Region: Mga; pfam05043
759913002623	M protein trans-acting positive regulator (MGA) PRD domain; Region: PRD_Mga; pfam08270
759913002624	Class II hydroxymethylglutaryl-coenzyme A (HMG-CoA) reductase (HMGR); Region: HMG-CoA_reductase_classII; cd00644
759913002625	homodimer interface [polypeptide binding]; other site
759913002626	catalytic residues [active]
759913002627	NAD binding site [chemical binding]; other site
759913002628	substrate binding pocket [chemical binding]; other site
759913002629	flexible flap; other site
759913002630	3-hydroxy-3-methylglutaryl CoA synthase, prokaryotic clade; Region: HMG-CoA-S_prok; TIGR01835
759913002631	"initiating" condensing enzymes are a subclass of decarboxylating condensing enzymes, including beta-ketoacyl [ACP] synthase, type III and polyketide synthases, type III, which include chalcone synthase and related enzymes. They are...; Region: init_cond_enzymes; cd00827
759913002632	dimer interface [polypeptide binding]; other site
759913002633	active site
759913002634	thymidylate synthase; Reviewed; Region: thyA; PRK01827
759913002635	Thymidylate synthase and pyrimidine hydroxymethylase: Thymidylate synthase (TS) and deoxycytidylate hydroxymethylase (dCMP-HMase) are homologs that catalyze analogous alkylation of C5 of pyrimidine nucleotides. Both enzymes are involved in the...; Region: TS_Pyrimidine_HMase; cd00351
759913002636	dimerization interface [polypeptide binding]; other site
759913002637	active site
759913002638	Dihydrofolate reductase (DHFR). Reduces 7,8-dihydrofolate to 5,6,7,8-tetrahydrofolate with NADPH as a cofactor. This is an essential step in the biosynthesis of deoxythymidine phosphate since 5,6,7,8-tetrahydrofolate is required to regenerate 5; Region: DHFR; cd00209
759913002639	Dihydrofolate reductase [Coenzyme metabolism]; Region: FolA; COG0262
759913002640	folate binding site [chemical binding]; other site
759913002641	NADP+ binding site [chemical binding]; other site
759913002642	ATP-dependent protease ATP-binding subunit ClpX; Provisional; Region: clpX; PRK05342
759913002643	ClpX C4-type zinc finger; Region: zf-C4_ClpX; pfam06689
759913002644	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
759913002645	Walker A motif; other site
759913002646	ATP binding site [chemical binding]; other site
759913002647	Walker B motif; other site
759913002648	C-terminal, D2-small domain, of ClpB protein; Region: ClpB_D2-small; smart01086
759913002649	YihA (EngB) GTPase family; Region: YihA_EngB; cd01876
759913002650	G1 box; other site
759913002651	GTP/Mg2+ binding site [chemical binding]; other site
759913002652	Switch I region; other site
759913002653	G2 box; other site
759913002654	G3 box; other site
759913002655	Switch II region; other site
759913002656	G4 box; other site
759913002657	G5 box; other site
759913002658	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
759913002659	ATPases associated with a variety of cellular activities; Region: AAA; smart00382
759913002660	Walker A motif; other site
759913002661	ATP binding site [chemical binding]; other site
759913002662	Walker B motif; other site
759913002663	arginine finger; other site
759913002664	UvrB/uvrC motif; Region: UVR; pfam02151
759913002665	MoxR-like ATPases [General function prediction only]; Region: COG0714
759913002666	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
759913002667	Walker A motif; other site
759913002668	ATP binding site [chemical binding]; other site
759913002669	Walker B motif; other site
759913002670	arginine finger; other site
759913002671	C-terminal, D2-small domain, of ClpB protein; Region: ClpB_D2-small; pfam10431
759913002672	Transposase DDE domain; Region: DDE_Tnp_1; pfam01609
759913002673	Transposase DDE domain; Region: DDE_Tnp_1_3; pfam13612
759913002674	Ribosomal protein L10 family, L10 subfamily; composed of bacterial 50S ribosomal protein and eukaryotic mitochondrial 39S ribosomal protein, L10. L10 occupies the L7/L12 stalk of the ribosome. The N-terminal domain (NTD) of L10 interacts with L11 protein...; Region: Ribosomal_L10; cd05797
759913002675	23S rRNA interface [nucleotide binding]; other site
759913002676	Interface with L7/L12 ribosomal proteins [polypeptide binding]; other site
759913002677	Ribosomal protein L7/L12. Ribosomal protein L7/L12 refers to the large ribosomal subunit proteins L7 and L12, which are identical except that L7 is acetylated at the N terminus. It is a component of the L7/L12 stalk, which is located at the surface of...; Region: Ribosomal_L7_L12; cd00387
759913002678	core dimer interface [polypeptide binding]; other site
759913002679	L10 interface [polypeptide binding]; other site
759913002680	L11 interface [polypeptide binding]; other site
759913002681	putative EF-Tu interaction site [polypeptide binding]; other site
759913002682	putative EF-G interaction site [polypeptide binding]; other site
759913002683	Beta-lactamase enzyme family; Region: Beta-lactamase2; cl17872
759913002684	D-alanyl-D-alanine carboxypeptidase [Cell envelope biogenesis, outer membrane]; Region: DacC; COG1686
759913002685	Penicillin-binding protein 5, C-terminal domain; Region: PBP5_C; smart00936
759913002686	Predicted xylanase/chitin deacetylase [Carbohydrate transport and metabolism]; Region: CDA1; COG0726
759913002687	Putative catalytic NodB homology domain of PgaB, IcaB, and similar proteins which consist of a deformed (beta/alpha)8 barrel fold with 5- or 6-strands; Region: CE4_NodB_like_5s_6s; cd10918
759913002688	putative active site [active]
759913002689	putative metal binding site [ion binding]; other site
759913002690	homoserine dehydrogenase; Provisional; Region: PRK06349
759913002691	Homoserine dehydrogenase, NAD binding domain; Region: NAD_binding_3; pfam03447
759913002692	Homoserine dehydrogenase; Region: Homoserine_dh; pfam00742
759913002693	homoserine kinase; Provisional; Region: PRK01212
759913002694	GHMP kinases N terminal domain; Region: GHMP_kinases_N; pfam00288
759913002695	folylpolyglutamate synthase/dihydrofolate synthase; Region: folC; TIGR01499
759913002696	Mur ligase middle domain; Region: Mur_ligase_M; pfam08245
759913002697	Mur ligase family, glutamate ligase domain; Region: Mur_ligase_C; pfam02875
759913002698	GTP cyclohydrolase I (GTP-CH-I) catalyzes the conversion of GTP into dihydroneopterin triphosphate.  The enzyme product is the precursor of tetrahydrofolate in eubacteria, fungi, and plants and of the folate analogs in methanogenic bacteria.  In...; Region: GTP_cyclohydro1; cd00642
759913002699	homodecamer interface [polypeptide binding]; other site
759913002700	GTP cyclohydrolase I; Provisional; Region: PLN03044
759913002701	active site
759913002702	putative catalytic site residues [active]
759913002703	zinc binding site [ion binding]; other site
759913002704	GTP-CH-I/GFRP interaction surface; other site
759913002705	DHPS subgroup of Pterin binding enzymes. DHPS (dihydropteroate synthase), a functional homodimer, catalyzes the condensation of p-aminobenzoic acid (pABA) in the de novo biosynthesis of folate, which is an essential cofactor in both nucleic acid and...; Region: DHPS; cd00739
759913002706	dihydropteroate synthase; Region: DHPS; TIGR01496
759913002707	substrate binding pocket [chemical binding]; other site
759913002708	dimer interface [polypeptide binding]; other site
759913002709	inhibitor binding site; inhibition site
759913002710	Dihydroneopterin aldolase (DHNA) and 7,8-dihydroneopterin triphosphate epimerase domain (DHNTPE); these enzymes have been designated folB and folX, respectively. Folate derivatives are essential cofactors in the biosynthesis of purines, pyrimidines, and...; Region: DHNA_DHNTPE; cd00534
759913002711	homooctamer interface [polypeptide binding]; other site
759913002712	active site
759913002713	7,8-dihydro-6-hydroxymethylpterin-pyrophosphokinase (HPPK). Folate derivatives are essential cofactors in the biosynthesis of purines, pyrimidines, and amino acids as well as formyl-tRNA. Mammalian cells are able to utilize pre-formed folates after...; Region: HPPK; cd00483
759913002714	catalytic center binding site [active]
759913002715	ATP binding site [chemical binding]; other site
759913002716	UDP-N-acetylenolpyruvoylglucosamine reductase; Provisional; Region: murB; PRK13905
759913002717	FAD binding domain; Region: FAD_binding_4; pfam01565
759913002718	UDP-N-acetylenolpyruvoylglucosamine reductase, C-terminal domain; Region: MurB_C; pfam02873
759913002719	ABC-type spermidine/putrescine transport systems, ATPase components [Amino acid transport and metabolism]; Region: PotA; COG3842
759913002720	ATP-binding cassette domain of the polyamine transporter; Region: ABC_PotA_N; cd03300
759913002721	Walker A/P-loop; other site
759913002722	ATP binding site [chemical binding]; other site
759913002723	Q-loop/lid; other site
759913002724	ABC transporter signature motif; other site
759913002725	Walker B; other site
759913002726	D-loop; other site
759913002727	H-loop/switch region; other site
759913002728	TOBE domain; Region: TOBE_2; pfam08402
759913002729	sulfate transport protein; Provisional; Region: cysT; CHL00187
759913002730	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
759913002731	dimer interface [polypeptide binding]; other site
759913002732	conserved gate region; other site
759913002733	putative PBP binding loops; other site
759913002734	ABC-ATPase subunit interface; other site
759913002735	ABC-type spermidine/putrescine transport system, permease component II [Amino acid transport and metabolism]; Region: PotC; COG1177
759913002736	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
759913002737	dimer interface [polypeptide binding]; other site
759913002738	conserved gate region; other site
759913002739	putative PBP binding loops; other site
759913002740	ABC-ATPase subunit interface; other site
759913002741	Spermidine/putrescine-binding periplasmic protein [Amino acid transport and metabolism]; Region: PotD; COG0687
759913002742	Bacterial extracellular solute-binding protein; Region: SBP_bac_6; pfam13343
759913002743	Response regulator of citrate/malate metabolism [Transcription / Signal transduction mechanisms]; Region: CitB; COG4565
759913002744	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
759913002745	active site
759913002746	phosphorylation site [posttranslational modification]
759913002747	intermolecular recognition site; other site
759913002748	dimerization interface [polypeptide binding]; other site
759913002749	Signal transduction histidine kinase regulating citrate/malate metabolism [Signal transduction mechanisms]; Region: CitA; COG3290
759913002750	Na+/citrate symporter [Energy production and conversion]; Region: CitS; COG3493
759913002751	Malic enzyme [Energy production and conversion]; Region: SfcA; COG0281
759913002752	Malic enzyme, N-terminal domain; Region: malic; pfam00390
759913002753	NAD(P) binding domain of malic enzyme (ME), subgroup 2; Region: NAD_bind_2_malic_enz; cd05311
759913002754	putative NAD(P) binding site [chemical binding]; other site
759913002755	ClC chloride channel EriC.  This domain is found in the EriC chloride transporters that mediate the extreme acid resistance response in eubacteria and archaea. This response allows bacteria to survive in the acidic environments by decarboxylation-linked...; Region: EriC; cd01031
759913002756	Chloride channel protein EriC [Inorganic ion transport and metabolism]; Region: EriC; COG0038
759913002757	Cl- selectivity filter; other site
759913002758	Cl- binding residues [ion binding]; other site
759913002759	pore gating glutamate residue; other site
759913002760	dimer interface [polypeptide binding]; other site
759913002761	H+/Cl- coupling transport residue; other site
759913002762	AraC-like ligand binding domain; Region: AraC_binding; pfam02311
759913002763	helix_turn_helix, arabinose operon control protein; Region: HTH_ARAC; smart00342
759913002764	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
759913002765	NnaC (CMP-NeuNAc synthetase) _like subfamily of SGNH_hydrolases, a diverse family of lipases and esterases. The tertiary fold of the enzyme is substantially different from that of the alpha/beta hydrolase family and unique among all known hydrolases; its...; Region: NnaC_like; cd01841
759913002766	active site
759913002767	catalytic triad [active]
759913002768	oxyanion hole [active]
759913002769	Predicted permease, member of the PurR regulon [General function prediction only]; Region: yhhT; COG0628
759913002770	Domain of unknown function DUF20; Region: UPF0118; pfam01594
759913002771	hypothetical protein; Reviewed; Region: PRK00024
759913002772	Mov34/MPN/PAD-1 family; Region: MPN_DUF2466; cd08071
759913002773	MPN+ (JAMM) motif; other site
759913002774	Zinc-binding site [ion binding]; other site
759913002775	Predicted glutamine amidotransferases [General function prediction only]; Region: COG2071
759913002776	Subgroup of proteins having the Type 1 glutamine amidotransferase (GATase1) domain; Region: GATase1_2; cd01745
759913002777	catalytic triad [active]
759913002778	AT-rich DNA-binding protein [General function prediction only]; Region: COG2344
759913002779	Putative DNA-binding protein N-terminus; Region: Put_DNA-bind_N; pfam06971
759913002780	CoA binding domain; Region: CoA_binding; pfam02629
759913002781	Putative amino acid metabolism; Region: DUF1831; pfam08866
759913002782	Cysteine sulfinate desulfinase/cysteine desulfurase and related enzymes [Amino acid transport and metabolism]; Region: NifS; COG1104
759913002783	cysteine desulfurase NifS; Region: FeS_nifS; TIGR03402
759913002784	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
759913002785	catalytic residue [active]
759913002786	ribose-phosphate pyrophosphokinase; Provisional; Region: PRK02458
759913002787	N-terminal domain of ribose phosphate pyrophosphokinase; Region: Pribosyltran_N; pfam13793
759913002788	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
759913002789	active site
759913002790	Uncharacterized subgroup 1 of the CYTH-like superfamily; Region: CYTH-like_Pase_1; cd07762
759913002791	putative active site [active]
759913002792	putative metal binding residues [ion binding]; other site
759913002793	signature motif; other site
759913002794	putative triphosphate binding site [ion binding]; other site
759913002795	Nucleotidyltransferase (NT) domain of RelA- and SpoT-like ppGpp synthetases and hydrolases; Region: NT_Rel-Spo_like; cd05399
759913002796	synthetase active site [active]
759913002797	NTP binding site [chemical binding]; other site
759913002798	metal binding site [ion binding]; metal-binding site
759913002799	inorganic polyphosphate/ATP-NAD kinase; Provisional; Region: ppnK; PRK04885
759913002800	ATP-NAD kinase; Region: NAD_kinase; pfam01513
759913002801	Pseudouridylate synthases, 23S RNA-specific [Translation, ribosomal structure and biogenesis]; Region: RluA; COG0564
759913002802	S4/Hsp/ tRNA synthetase RNA-binding domain; The domain surface is populated by conserved, charged residues that define a likely RNA-binding site;  Found in stress proteins, ribosomal proteins and tRNA synthetases; This may imply a hitherto unrecognized...; Region: S4; cl09940
759913002803	RNA binding surface [nucleotide binding]; other site
759913002804	Pseudouridine synthase, RsuA/RluD family; Region: PseudoU_synth_RluCD_like; cd02869
759913002805	active site
759913002806	phosphotransacetylase; Reviewed; Region: eutD; PRK09653
759913002807	malonic semialdehyde reductase; Provisional; Region: PRK10538
759913002808	classical (c) SDR, subgroup 5; Region: SDR_c5; cd05346
759913002809	putative NAD(P) binding site [chemical binding]; other site
759913002810	homotetramer interface [polypeptide binding]; other site
759913002811	homodimer interface [polypeptide binding]; other site
759913002812	active site
759913002813	ABC-type nitrate/sulfonate/bicarbonate transport system, ATPase component [Inorganic ion transport and metabolism]; Region: TauB; COG1116
759913002814	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
759913002815	Walker A/P-loop; other site
759913002816	ATP binding site [chemical binding]; other site
759913002817	Q-loop/lid; other site
759913002818	ABC transporter signature motif; other site
759913002819	Walker B; other site
759913002820	D-loop; other site
759913002821	H-loop/switch region; other site
759913002822	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
759913002823	dimer interface [polypeptide binding]; other site
759913002824	conserved gate region; other site
759913002825	ABC-ATPase subunit interface; other site
759913002826	Periplasmic glycine betaine/choline-binding (lipo)protein of an ABC-type transport system (osmoprotectant binding protein) [Cell envelope biogenesis, outer membrane]; Region: OpuBC; COG1732
759913002827	ABC-type proline/glycine betaine transport systems, periplasmic components [Amino acid transport and metabolism]; Region: ProX; cl17891
759913002828	guanosine 5'-monophosphate oxidoreductase; Provisional; Region: PRK05458
759913002829	IMPDH: The catalytic domain of the inosine monophosphate dehydrogenase. IMPDH catalyzes the NAD-dependent oxidation of inosine 5'-monophosphate (IMP) to xanthosine 5' monophosphate (XMP). It is a rate-limiting step in the de novo synthesis of...; Region: IMPDH; cd00381
759913002830	active site
759913002831	'putative riboswitch, probably purine metabolism -result from http://riboswitch.bioapps.biozentrum.uni-wuerzburg.de/'
759913002832	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
759913002833	active site
759913002834	xanthine permease; Region: pbuX; TIGR03173
759913002835	Membrane-associated lipoprotein involved in thiamine biosynthesis [Coenzyme metabolism]; Region: ApbE; COG1477
759913002836	ApbE family; Region: ApbE; pfam02424
759913002837	4-oxalocrotonate tautomerase; Provisional; Region: PRK02289
759913002838	active site 1 [active]
759913002839	dimer interface [polypeptide binding]; other site
759913002840	hexamer interface [polypeptide binding]; other site
759913002841	active site 2 [active]
759913002842	thymidine kinase; Provisional; Region: PRK04296
759913002843	peptide chain release factor 1; Validated; Region: prfA; PRK00591
759913002844	This domain is found in peptide chain release factors; Region: PCRF; smart00937
759913002845	RF-1 domain; Region: RF-1; pfam00472
759913002846	N5-glutamine S-adenosyl-L-methionine-dependent methyltransferase; Provisional; Region: PRK09328
759913002847	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
759913002848	S-adenosylmethionine binding site [chemical binding]; other site
759913002849	Putative translation factor (SUA5) [Translation, ribosomal structure and biogenesis]; Region: SUA5; COG0009
759913002850	Acetyltransferases [General function prediction only]; Region: RimI; COG0456
759913002851	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
759913002852	Coenzyme A binding pocket [chemical binding]; other site
759913002853	serine hydroxymethyltransferase; Reviewed; Region: glyA; PRK00011
759913002854	Serine-glycine hydroxymethyltransferase (SHMT). This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). SHMT carries out interconversion of serine and glycine; it catalyzes the transfer of hydroxymethyl...; Region: SHMT; cd00378
759913002855	dimer interface [polypeptide binding]; other site
759913002856	active site
759913002857	glycine-pyridoxal phosphate binding site [chemical binding]; other site
759913002858	folate binding site [chemical binding]; other site
759913002859	37-kD nucleoid-associated bacterial protein; Region: NA37; cl15473
759913002860	Soluble lytic murein transglycosylase and related regulatory proteins (some contain LysM/invasin domains) [Cell envelope biogenesis, outer membrane]; Region: MltE; COG0741
759913002861	Lytic Transglycosylase (LT)  and Goose Egg White Lysozyme (GEWL) domain. Members include the soluble and insoluble membrane-bound LTs in bacteria, the LTs in bacteriophage lambda, as well as, the eukaryotic "goose-type" lysozymes (GEWL).  LTs...; Region: LT_GEWL; cd00254
759913002862	N-acetyl-D-glucosamine binding site [chemical binding]; other site
759913002863	catalytic residue [active]
759913002864	ABC-type multidrug transport system, ATPase and permease components [Defense mechanisms]; Region: MdlB; COG1132
759913002865	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
759913002866	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
759913002867	Walker A/P-loop; other site
759913002868	ATP binding site [chemical binding]; other site
759913002869	Q-loop/lid; other site
759913002870	ABC transporter signature motif; other site
759913002871	Walker B; other site
759913002872	D-loop; other site
759913002873	H-loop/switch region; other site
759913002874	ABC-type multidrug transport system, ATPase and permease components [Defense mechanisms]; Region: MdlB; COG1132
759913002875	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
759913002876	ATP-binding cassette domain of glucan transporter and related proteins, subfamily C; Region: ABCC_Glucan_exporter_like; cd03254
759913002877	Walker A/P-loop; other site
759913002878	ATP binding site [chemical binding]; other site
759913002879	Q-loop/lid; other site
759913002880	ABC transporter signature motif; other site
759913002881	Walker B; other site
759913002882	D-loop; other site
759913002883	H-loop/switch region; other site
759913002884	coenzyme A disulfide reductase; Reviewed; Region: PRK09564
759913002885	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
759913002886	Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain; Region: Pyr_redox_dim; pfam02852
759913002887	RibD C-terminal domain; Region: RibD_C; cl17279
759913002888	Dihydrofolate reductase [Coenzyme metabolism]; Region: FolA; COG0262
759913002889	L-lactate dehydrogenase; Reviewed; Region: ldh; PRK00066
759913002890	L-2-hydroxyisocapronate dehydrogenases and some bacterial L-lactate dehydrogenases; Region: HicDH_like; cd05291
759913002891	tetramer (dimer of dimers) interface [polypeptide binding]; other site
759913002892	NAD binding site [chemical binding]; other site
759913002893	dimer interface [polypeptide binding]; other site
759913002894	substrate binding site [chemical binding]; other site
759913002895	DNA gyrase subunit A; Validated; Region: PRK05560
759913002896	DNA Topoisomerase, subtype IIA; domain A'; bacterial DNA topoisomerase IV (C subunit, ParC), bacterial DNA gyrases (A subunit, GyrA),mammalian DNA toposiomerases II. DNA topoisomerases are essential enzymes that regulate the conformational changes...; Region: TOP4c; cd00187
759913002897	CAP-like domain; other site
759913002898	active site
759913002899	primary dimer interface [polypeptide binding]; other site
759913002900	DNA gyrase C-terminal domain, beta-propeller; Region: DNA_gyraseA_C; pfam03989
759913002901	DNA gyrase C-terminal domain, beta-propeller; Region: DNA_gyraseA_C; pfam03989
759913002902	DNA gyrase C-terminal domain, beta-propeller; Region: DNA_gyraseA_C; pfam03989
759913002903	DNA gyrase C-terminal domain, beta-propeller; Region: DNA_gyraseA_C; pfam03989
759913002904	DNA gyrase C-terminal domain, beta-propeller; Region: DNA_gyraseA_C; pfam03989
759913002905	DNA gyrase C-terminal domain, beta-propeller; Region: DNA_gyraseA_C; pfam03989
759913002906	Sortase A (SrtA) or subfamily-1 sortases are cysteine transpeptidases found in gram-positive bacteria that anchor surface proteins to peptidoglycans of the bacterial cell wall envelope. They do so by catalyzing a transpeptidation reaction in which the...; Region: Sortase_A_1; cd06165
759913002907	active site
759913002908	catalytic site [active]
759913002909	This conserved domain belongs to a superfamily including the bleomycin resistance protein, glyoxalase I, and type I ring-cleaving dioxygenases; Region: Glo_EDI_BRP_like_1; cd08352
759913002910	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
759913002911	putative metal binding site [ion binding]; other site
759913002912	Helical backbone metal receptor (TroA-like domain). These proteins have been shown to function in the ABC transport of ferric siderophores and metal ions such as Mn2+, Fe3+, Cu2+ and/or Zn2+.  Their ligand binding site is formed in the interface between...; Region: TroA-like; cl00262
759913002913	Helical backbone metal receptor (TroA-like domain). These proteins have been shown to function in the ABC transport of ferric siderophores and metal ions such as Mn2+, Fe3+, Cu2+ and/or Zn2+.  Their ligand binding site is formed in the interface between...; Region: TroA-like; cl00262
759913002914	streptococcal histidine triad protein; Region: strep_his_triad; TIGR01363
759913002915	Predicted secreted protein [Function unknown]; Region: COG4086
759913002916	Protein of unknown function (DUF1002); Region: DUF1002; pfam06207
759913002917	Integrase core domain; Region: rve; pfam00665
759913002918	Integrase core domain; Region: rve_3; pfam13683
759913002919	putative transposase OrfB; Reviewed; Region: PHA02517
759913002920	HTH-like domain; Region: HTH_21; pfam13276
759913002921	Integrase core domain; Region: rve; pfam00665
759913002922	Transposase; Region: HTH_Tnp_1; pfam01527
759913002923	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG2963
759913002924	Membrane-fusion protein [Cell envelope biogenesis, outer membrane]; Region: AcrA; COG0845
759913002925	HlyD family secretion protein; Region: HlyD_3; pfam13437
759913002926	ABC-type antimicrobial peptide transport system, ATPase component [Defense mechanisms]; Region: SalX; COG1136
759913002927	ATP-binding cassette domain of the transporters involved in export of lipoprotein and macrolide, and cell division protein; Region: ABC_MJ0796_LolCDE_FtsE; cd03255
759913002928	Walker A/P-loop; other site
759913002929	ATP binding site [chemical binding]; other site
759913002930	Q-loop/lid; other site
759913002931	ABC transporter signature motif; other site
759913002932	Walker B; other site
759913002933	D-loop; other site
759913002934	H-loop/switch region; other site
759913002935	MacB-like periplasmic core domain; Region: MacB_PCD; pfam12704
759913002936	ABC-type antimicrobial peptide transport system, permease component [Defense mechanisms]; Region: SalY; COG0577
759913002937	FtsX-like permease family; Region: FtsX; pfam02687
759913002938	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
759913002939	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
759913002940	active site
759913002941	phosphorylation site [posttranslational modification]
759913002942	intermolecular recognition site; other site
759913002943	dimerization interface [polypeptide binding]; other site
759913002944	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
759913002945	DNA binding site [nucleotide binding]
759913002946	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
759913002947	HAMP domain; Region: HAMP; pfam00672
759913002948	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
759913002949	dimer interface [polypeptide binding]; other site
759913002950	phosphorylation site [posttranslational modification]
759913002951	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
759913002952	ATP binding site [chemical binding]; other site
759913002953	Mg2+ binding site [ion binding]; other site
759913002954	G-X-G motif; other site
759913002955	Surface antigen [General function prediction only]; Region: COG3942
759913002956	CHAP domain; Region: CHAP; pfam05257
759913002957	Peptidase S8 family domain in Streptococcal C5a peptidases; Region: Peptidases_S8_C5a_Peptidase; cd07475
759913002958	putative active site [active]
759913002959	catalytic triad [active]
759913002960	PA_C5a_like: Protease-associated domain containing proteins like Streptococcus pyogenes C5a peptidase. This group contains various PA domain-containing proteins similar to S. pyogenes C5a, including, i) Vpr, a minor extracellular serine protease from...; Region: PA_C5a_like; cd02133
759913002961	PA/protease domain interface [polypeptide binding]; other site
759913002962	putative integrin binding motif; other site
759913002963	Peptidase S8 family domain in Streptococcal C5a peptidases; Region: Peptidases_S8_C5a_Peptidase; cd07475
759913002964	Fn3-like domain (DUF1034); Region: DUF1034; pfam06280
759913002965	C-terminal domain of CHU protein family; Region: CHU_C; cl17875
759913002966	ABC-type metal ion transport system, periplasmic component/surface adhesin [Inorganic ion transport and metabolism]; Region: LraI; COG0803
759913002967	Metal binding protein AcdA.  These proteins have been shown to function in the ABC uptake of Zn2+ and Mn2+ and in competence for genetic transformation and adhesion. The AcdA proteins belong to the TroA superfamily of helical backbone metal receptor...; Region: AdcA; cd01017
759913002968	metal binding site [ion binding]; metal-binding site
759913002969	streptococcal histidine triad protein; Region: strep_his_triad; TIGR01363
759913002970	Streptococcal histidine triad protein; Region: Strep_his_triad; pfam04270
759913002971	Streptococcal histidine triad protein; Region: Strep_his_triad; pfam04270
759913002972	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3237
759913002973	ABC-type cobalt transport system, ATPase component [Inorganic ion transport and metabolism]; Region: CbiO; COG1122
759913002974	ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257
759913002975	Walker A/P-loop; other site
759913002976	ATP binding site [chemical binding]; other site
759913002977	Q-loop/lid; other site
759913002978	ABC transporter signature motif; other site
759913002979	Walker B; other site
759913002980	D-loop; other site
759913002981	H-loop/switch region; other site
759913002982	ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257
759913002983	nickel import ATP-binding protein NikD; Region: nickel_nikD; TIGR02770
759913002984	Walker A/P-loop; other site
759913002985	ATP binding site [chemical binding]; other site
759913002986	Q-loop/lid; other site
759913002987	ABC transporter signature motif; other site
759913002988	Walker B; other site
759913002989	D-loop; other site
759913002990	H-loop/switch region; other site
759913002991	ABC-type dipeptide/oligopeptide/nickel transport systems, permease components [Amino acid transport and metabolism / Inorganic ion transport and metabolism]; Region: DppC; COG1173
759913002992	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
759913002993	dimer interface [polypeptide binding]; other site
759913002994	conserved gate region; other site
759913002995	putative PBP binding loops; other site
759913002996	ABC-ATPase subunit interface; other site
759913002997	ABC-type dipeptide/oligopeptide/nickel transport systems, permease components [Amino acid transport and metabolism / Inorganic ion transport and metabolism]; Region: DppB; COG0601
759913002998	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
759913002999	dimer interface [polypeptide binding]; other site
759913003000	conserved gate region; other site
759913003001	putative PBP binding loops; other site
759913003002	ABC-ATPase subunit interface; other site
759913003003	ABC-type dipeptide transport system, periplasmic component [Amino acid transport and metabolism]; Region: DdpA; COG0747
759913003004	The substrate-binding component of an uncharacterized ABC-type nickel/dipeptide/oligopeptide-like import system contains the type 2 periplasmic binding fold; Region: PBP2_NikA_DppA_OppA_like_19; cd08518
759913003005	Helix-turn-helix domain; Region: HTH_38; pfam13936
759913003006	Transposase and inactivated derivatives, IS30 family [DNA replication, recombination, and repair]; Region: Tra8; COG2826
759913003007	FemAB family; Region: FemAB; pfam02388
759913003008	Acetyltransferase (GNAT) domain; Region: Acetyltransf_6; cl17497
759913003009	Kef-type K+ transport systems, membrane components [Inorganic ion transport and metabolism]; Region: KefB; COG0475
759913003010	Sodium/hydrogen exchanger family; Region: Na_H_Exchanger; pfam00999
759913003011	GMP synthase; Reviewed; Region: guaA; PRK00074
759913003012	Type 1 glutamine amidotransferase (GATase1) domain found in GMP synthetase; Region: GATase1_GMP_Synthase; cd01742
759913003013	AMP/PPi binding site [chemical binding]; other site
759913003014	candidate oxyanion hole; other site
759913003015	catalytic triad [active]
759913003016	potential glutamine specificity residues [chemical binding]; other site
759913003017	The C-terminal domain of GMP synthetase. It contains two subdomains; the ATP pyrophosphatase domain which closes to the N-termial and the dimerization domain at C-terminal end. The ATP-PPase is a twisted, five-stranded parallel beta-sheet sandwiched...; Region: GMP_synthase_C; cd01997
759913003018	ATP Binding subdomain [chemical binding]; other site
759913003019	Dimerization subdomain; other site
759913003020	Transcriptional regulators [Transcription]; Region: PhnF; COG2188
759913003021	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
759913003022	DNA-binding site [nucleotide binding]; DNA binding site
759913003023	UTRA domain; Region: UTRA; pfam07702
759913003024	Putative helix-turn-helix protein, YlxM / p13 like; Region: UPF0122; pfam04297
759913003025	Helix-turn-helix domain of Hin and related proteins, a family of DNA-binding domains unique to bacteria and represented by the Hin protein of Salmonella. The basic HTH domain is a simple fold comprised of three core helices that form a right-handed...; Region: HTH_Hin_like; cd00569
759913003026	signal recognition particle protein; Provisional; Region: PRK10867
759913003027	SRP54-type protein, helical bundle domain; Region: SRP54_N; smart00963
759913003028	The signal recognition particle (SRP) mediates the transport to or across the plasma membrane in bacteria and the endoplasmic reticulum in eukaryotes. SRP recognizes N-terminal sighnal sequences of newly synthesized polypeptides at the ribosome. The...; Region: SRP; cd03115
759913003029	P loop; other site
759913003030	GTP binding site [chemical binding]; other site
759913003031	Signal peptide binding domain; Region: SRP_SPB; pfam02978
759913003032	Ferredoxin reductase (FNR), an FAD and NAD(P) binding protein, was intially identified as a chloroplast reductase activity, catalyzing the electron transfer from reduced iron-sulfur protein ferredoxin to NADP+ as the final step in the electron transport...; Region: FNR_like; cl06868
759913003033	FAD binding pocket [chemical binding]; other site
759913003034	conserved FAD binding motif [chemical binding]; other site
759913003035	phosphate binding motif [ion binding]; other site
759913003036	beta-alpha-beta structure motif; other site
759913003037	NAD binding pocket [chemical binding]; other site
759913003038	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
759913003039	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
759913003040	non-specific DNA binding site [nucleotide binding]; other site
759913003041	salt bridge; other site
759913003042	sequence-specific DNA binding site [nucleotide binding]; other site
759913003043	Predicted transcriptional regulator [Transcription]; Region: COG2932
759913003044	Peptidase S24 LexA-like proteins are involved in the SOS response leading to the repair of single-stranded DNA within the bacterial cell. This family includes: the lambda repressor CI/C2 family and related bacterial prophage repressor proteins; LexA (EC...; Region: S24_LexA-like; cd06529
759913003045	Catalytic site [active]
759913003046	Oxidoreductase family, NAD-binding Rossmann fold; Region: GFO_IDH_MocA; pfam01408
759913003047	Oxidoreductase family, C-terminal alpha/beta domain; Region: GFO_IDH_MocA_C; pfam02894
759913003048	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
759913003049	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
759913003050	active site
759913003051	phosphorylation site [posttranslational modification]
759913003052	intermolecular recognition site; other site
759913003053	dimerization interface [polypeptide binding]; other site
759913003054	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
759913003055	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
759913003056	dimerization interface [polypeptide binding]; other site
759913003057	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
759913003058	dimer interface [polypeptide binding]; other site
759913003059	phosphorylation site [posttranslational modification]
759913003060	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
759913003061	ATP binding site [chemical binding]; other site
759913003062	Mg2+ binding site [ion binding]; other site
759913003063	G-X-G motif; other site
759913003064	Mannose-6-phosphate isomerase [Carbohydrate transport and metabolism]; Region: {ManC}; COG0662
759913003065	FemAB family; Region: FemAB; pfam02388
759913003066	Acetyltransferase (GNAT) domain; Region: Acetyltransf_6; cl17497
759913003067	site-specific tyrosine recombinase XerS; Reviewed; Region: xerS; PRK05084
759913003068	DNA breaking-rejoining enzymes, C-terminal catalytic domain. The DNA breaking-rejoining enzyme superfamily includes type IB topoisomerases and tyrosine recombinases that share the same fold in their catalytic domain containing six conserved active site...; Region: DNA_BRE_C; cl00213
759913003069	active site
759913003070	DNA binding site [nucleotide binding]
759913003071	Int/Topo IB signature motif; other site
759913003072	Listerrria innocua Lin0431  is similar to the N-Utilization Substance G (NusG) N terminal (NGN) insert (DII); Region: Lin0431_like; cd09911
759913003073	trimer interface [polypeptide binding]; other site
759913003074	1,4-dihydroxy-2-naphthoate octaprenyltransferase [Coenzyme metabolism]; Region: MenA; cl17224
759913003075	UbiA prenyltransferase family; Region: UbiA; pfam01040
759913003076	ApbE family; Region: ApbE; pfam02424
759913003077	Heptaprenyl diphosphate synthase component I; Region: Hpre_diP_synt_I; pfam07456
759913003078	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
759913003079	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
759913003080	ATP binding site [chemical binding]; other site
759913003081	Mg2+ binding site [ion binding]; other site
759913003082	G-X-G motif; other site
759913003083	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
759913003084	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
759913003085	active site
759913003086	phosphorylation site [posttranslational modification]
759913003087	intermolecular recognition site; other site
759913003088	dimerization interface [polypeptide binding]; other site
759913003089	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
759913003090	DNA binding site [nucleotide binding]
759913003091	FtsX-like permease family; Region: FtsX; pfam02687
759913003092	ABC-type antimicrobial peptide transport system, permease component [Defense mechanisms]; Region: SalY; COG0577
759913003093	ABC-type antimicrobial peptide transport system, ATPase component [Defense mechanisms]; Region: SalX; COG1136
759913003094	ATP-binding cassette domain of the transporters involved in export of lipoprotein and macrolide, and cell division protein; Region: ABC_MJ0796_LolCDE_FtsE; cd03255
759913003095	Walker A/P-loop; other site
759913003096	ATP binding site [chemical binding]; other site
759913003097	Q-loop/lid; other site
759913003098	ABC transporter signature motif; other site
759913003099	Walker B; other site
759913003100	D-loop; other site
759913003101	H-loop/switch region; other site
759913003102	C-terminal processing peptidase family S41; Region: Peptidase_S41; cd06567
759913003103	Active site serine [active]
759913003104	PASTA domain of bacterial serine/threonine kinase pknB-like proteins. PknB is a member of a group of related transmembrane sensor kinases present in many gram positive bacteria, which has been shown to regulate cell shape in Mycobacterium tubercolosis; Region: PASTA_pknB; cd06577
759913003105	Citrate lyase synthetase [Energy production and conversion]; Region: CitC; COG3053
759913003106	Citrate lyase ligase; Region: Citrate_lyase_ligase; cd02169
759913003107	putative active site [active]
759913003108	(T/H)XGH motif; other site
759913003109	oxaloacetate decarboxylase; Provisional; Region: PRK12331
759913003110	Pyruvate carboxylase and Transcarboxylase 5S, carboxyltransferase domain; Region: DRE_TIM_PC_TC_5S; cd07937
759913003111	active site
759913003112	catalytic residues [active]
759913003113	metal binding site [ion binding]; metal-binding site
759913003114	homodimer binding site [polypeptide binding]; other site
759913003115	Transposase; Region: DEDD_Tnp_IS110; pfam01548
759913003116	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3547
759913003117	Transposase IS116/IS110/IS902 family; Region: Transposase_20; pfam02371
759913003118	2'-(5''-triphosphoribosyl)-3'- dephospho-CoA:apo-citrate lyase; Reviewed; Region: citX; PRK01392
759913003119	Citrate lyase, alpha subunit [Energy production and conversion]; Region: CitF; COG3051
759913003120	Acetyl-CoA hydrolase/transferase C-terminal domain; Region: AcetylCoA_hyd_C; pfam13336
759913003121	HpcH/HpaI aldolase/citrate lyase family; Region: HpcH_HpaI; cl17231
759913003122	Citrate lyase, gamma subunit [Energy production and conversion]; Region: CitD; COG3052
759913003123	Na+-transporting oxaloacetate decarboxylase beta subunit; Region: OAD_beta; pfam03977
759913003124	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit; Validated; Region: PRK06549
759913003125	The biotinyl-domain or biotin carboxyl carrier protein (BCCP) domain is present in all biotin-dependent enzymes, such as acetyl-CoA carboxylase, pyruvate carboxylase, propionyl-CoA carboxylase, methylcrotonyl-CoA carboxylase, geranyl-CoA carboxylase; Region: biotinyl_domain; cd06850
759913003126	carboxyltransferase (CT) interaction site; other site
759913003127	biotinylation site [posttranslational modification]; other site
759913003128	H+/citrate symporter [Energy production and conversion]; Region: CitM; COG2851
759913003129	Citrate transporter; Region: CitMHS; pfam03600
759913003130	Transcriptional regulators [Transcription]; Region: GntR; COG1802
759913003131	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
759913003132	DNA-binding site [nucleotide binding]; DNA binding site
759913003133	FCD domain; Region: FCD; pfam07729
759913003134	triphosphoribosyl-dephospho-CoA synthase CitG; Region: citrate_citG; TIGR03125
759913003135	membrane protein AbrB duplication; Region: Gneg_AbrB_dup; TIGR03082
759913003136	Putative ammonia monooxygenase [General function prediction only]; Region: AbrB; COG3180
759913003137	membrane protein AbrB duplication; Region: Gneg_AbrB_dup; TIGR03082
759913003138	Na+-transporting methylmalonyl-CoA/oxaloacetate decarboxylase, beta subunit [Energy production and conversion]; Region: OadB; COG1883
759913003139	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit; Validated; Region: PRK06549
759913003140	The biotinyl-domain or biotin carboxyl carrier protein (BCCP) domain is present in all biotin-dependent enzymes, such as acetyl-CoA carboxylase, pyruvate carboxylase, propionyl-CoA carboxylase, methylcrotonyl-CoA carboxylase, geranyl-CoA carboxylase; Region: biotinyl_domain; cd06850
759913003141	carboxyltransferase (CT) interaction site; other site
759913003142	biotinylation site [posttranslational modification]; other site
759913003143	oxaloacetate decarboxylase; Provisional; Region: PRK12581
759913003144	Pyruvate carboxylase and Transcarboxylase 5S, carboxyltransferase domain; Region: DRE_TIM_PC_TC_5S; cd07937
759913003145	active site
759913003146	catalytic residues [active]
759913003147	metal binding site [ion binding]; metal-binding site
759913003148	homodimer binding site [polypeptide binding]; other site
759913003149	tRNA (uracil-5-)-methyltransferase Gid; Reviewed; Region: PRK05335
759913003150	Glucose inhibited division protein A; Region: GIDA; pfam01134
759913003151	Protein of unknown function (DUF3307); Region: DUF3307; pfam11750
759913003152	Formate/glycerate dehydrogenases, D-specific 2-hydroxy acid dehydrogenases and related dehydrogenases; Region: FDH_GDH_like; cl17240
759913003153	NAD binding site [chemical binding]; other site
759913003154	Formate/glycerate dehydrogenases, D-specific 2-hydroxy acid dehydrogenases and related dehydrogenases; Region: FDH_GDH_like; cl17240
759913003155	Predicted membrane protein, putative toxin regulator [General function prediction only]; Region: PfoR; COG3641
759913003156	Phosphotransferase system, EIIC; Region: PTS_EIIC_2; pfam13303
759913003157	Transcriptional regulator [Transcription]; Region: LysR; COG0583
759913003158	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
759913003159	Transcriptional regulator [Transcription]; Region: LysR; COG0583
759913003160	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cd05466
759913003161	dimerization interface [polypeptide binding]; other site
759913003162	DNA topoisomerase I; Validated; Region: PRK05582
759913003163	TOPRIM_TopoIA_TopoI: The topoisomerase-primase (TORPIM) domain found in members of the type IA family of DNA topoisomerases (Topo IA) similar to Escherichia coli DNA topoisomerase I.   Type IA DNA topoisomerases remove (relax) negative supercoils in the...; Region: TOPRIM_TopoIA_TopoI; cd03363
759913003164	active site
759913003165	interdomain interaction site; other site
759913003166	putative metal-binding site [ion binding]; other site
759913003167	nucleotide binding site [chemical binding]; other site
759913003168	DNA Topoisomerase, subtype IA; DNA-binding, ATP-binding and catalytic domain of bacterial DNA topoisomerases I and III, and eukaryotic DNA topoisomerase III and eubacterial and archael reverse gyrases. Topoisomerases clevage single or double stranded DNA...; Region: TOP1Ac; cd00186
759913003169	domain I; other site
759913003170	DNA binding groove [nucleotide binding]
759913003171	phosphate binding site [ion binding]; other site
759913003172	domain II; other site
759913003173	domain III; other site
759913003174	nucleotide binding site [chemical binding]; other site
759913003175	catalytic site [active]
759913003176	domain IV; other site
759913003177	Topoisomerase DNA binding C4 zinc finger; Region: zf-C4_Topoisom; pfam01396
759913003178	Topoisomerase DNA binding C4 zinc finger; Region: zf-C4_Topoisom; pfam01396
759913003179	DNA recombination-mediator protein A; Region: DNA_processg_A; pfam02481
759913003180	DNA protecting protein DprA; Region: dprA; TIGR00732
759913003181	bacterial Ribonuclease HII-like; Region: RNase_HII_bacteria_HII_like; cd07182
759913003182	RNA/DNA hybrid binding site [nucleotide binding]; other site
759913003183	active site
759913003184	GTPase YlqF; Reviewed; Region: rbgA; PRK09563
759913003185	Circularly permuted YlqF GTPase; Region: YlqF; cd01856
759913003186	GTP/Mg2+ binding site [chemical binding]; other site
759913003187	G4 box; other site
759913003188	G5 box; other site
759913003189	G1 box; other site
759913003190	Switch I region; other site
759913003191	G2 box; other site
759913003192	G3 box; other site
759913003193	Switch II region; other site
759913003194	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
759913003195	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
759913003196	non-specific DNA binding site [nucleotide binding]; other site
759913003197	salt bridge; other site
759913003198	sequence-specific DNA binding site [nucleotide binding]; other site
759913003199	transcriptional activator, Rgg/GadR/MutR family, C-terminal domain; Region: RGG_Cterm; TIGR01716
759913003200	Domain of unknown function (DUF1836); Region: DUF1836; pfam08876
759913003201	Predicted membrane protein, hemolysin III homolog [General function prediction only]; Region: COG1272
759913003202	channel protein, hemolysin III family; Region: hlyIII; TIGR01065
759913003203	Sphingosine kinase and enzymes related to eukaryotic diacylglycerol kinase [Lipid metabolism / General function prediction only]; Region: LCB5; COG1597
759913003204	Diacylglycerol kinase catalytic domain; Region: DAGK_cat; pfam00781
759913003205	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3237
759913003206	ATPase components of ABC transporters with duplicated ATPase domains [General function prediction only]; Region: Uup; COG0488
759913003207	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
759913003208	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
759913003209	ABC transporter; Region: ABC_tran_2; pfam12848
759913003210	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
759913003211	Staphylokinase/Streptokinase family; Region: Staphylokinase; pfam02821
759913003212	Predicted membrane protein [Function unknown]; Region: COG4720
759913003213	Pyridoxal kinase plays a key role in the synthesis of the active coenzyme pyridoxal-5'-phosphate  (PLP), by catalyzing the phosphorylation of the precursor vitamin B6  in the presence of Zn2+ and ATP. Mammals are unable to synthesize PLP de novo and...; Region: pyridoxal_pyridoxamine_kinase; cd01173
759913003214	dimer interface [polypeptide binding]; other site
759913003215	pyridoxal binding site [chemical binding]; other site
759913003216	ATP binding site [chemical binding]; other site
759913003217	Transcriptional regulators containing a DNA-binding HTH domain and an aminotransferase domain (MocR family) and their eukaryotic orthologs [Transcription / Amino acid transport and metabolism]; Region: ARO8; COG1167
759913003218	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
759913003219	DNA-binding site [nucleotide binding]; DNA binding site
759913003220	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
759913003221	pyridoxal 5'-phosphate binding site [chemical binding]; other site
759913003222	homodimer interface [polypeptide binding]; other site
759913003223	catalytic residue [active]
759913003224	ATP cone domain; Region: ATP-cone; pfam03477
759913003225	aspartate-semialdehyde dehydrogenase; Provisional; Region: PRK14874
759913003226	Semialdehyde dehydrogenase, NAD binding domain; Region: Semialdhyde_dh; smart00859
759913003227	Phosphatidylserine/phosphatidylglycerophosphate/car diolipin synthases and related enzymes [Lipid metabolism]; Region: Cls; COG1502
759913003228	Putative catalytic domain, repeat 1, of Streptococcus mutans uncharacterized protein SMU_988 and similar proteins; Region: PLDc_SMU_988_like_1; cd09154
759913003229	putative active site [active]
759913003230	catalytic site [active]
759913003231	Putative catalytic domain, repeat 2, of Streptococcus mutans uncharacterized protein SMU_988 and similar proteins; Region: PLDc_SMU_988_like_2; cd09160
759913003232	putative active site [active]
759913003233	catalytic site [active]
759913003234	LPXTG-motif cell wall anchor domain; Region: LPXTG_anchor; TIGR01167
759913003235	Integrase core domain; Region: rve_3; pfam13683
759913003236	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG2963
759913003237	Transposase; Region: HTH_Tnp_1; pfam01527
759913003238	putative transposase OrfB; Reviewed; Region: PHA02517
759913003239	HTH-like domain; Region: HTH_21; pfam13276
759913003240	Integrase core domain; Region: rve; pfam00665
759913003241	Transposase; Region: HTH_Tnp_1; pfam01527
759913003242	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG2963
759913003243	formate--tetrahydrofolate ligase; Provisional; Region: PRK13505
759913003244	Formyltetrahydrofolate synthetase (FTHFS) catalyzes the ATP-dependent activation of formate ion via its addition to the N10 position of tetrahydrofolate. FTHFS is a highly expressed key enzyme in both the Wood-Ljungdahl pathway of autotrophic CO2...; Region: FTHFS; cd00477
759913003245	Potassium binding sites [ion binding]; other site
759913003246	Cesium cation binding sites [ion binding]; other site
759913003247	Lipoate-protein ligase A [Coenzyme metabolism]; Region: LplA; COG0095
759913003248	Bacterial lipoate protein ligase C-terminus; Region: Lip_prot_lig_C; pfam10437
759913003249	NAD-dependent protein deacetylases, SIR2 family [Transcription]; Region: SIR2; COG0846
759913003250	SIR2 superfamily of proteins includes silent information regulator 2 (Sir2) enzymes which catalyze NAD+-dependent protein/histone deacetylation, where the acetyl group from the lysine epsilon-amino group is transferred to the ADP-ribose moiety of NAD+; Region: SIR2; cl00195
759913003251	Macro domain, Unknown family 1. The macro domain is a high-affinity ADP-ribose binding module found in a variety of proteins as a stand-alone domain or in combination with other domains like in histone macroH2A and some PARPs (poly ADP-ribose polymerases)...; Region: Macro_1; cd02906
759913003252	putative ADP-ribose binding site [chemical binding]; other site
759913003253	Glycine cleavage H-protein. Glycine cleavage H-proteins are part of the glycine cleavage system (GCS) found in bacteria, archea and the mitochondria of eukaryotes. GCS is a multienzyme complex consisting of 4 different components (P-, H-, T- and...; Region: GCS_H; cd06848
759913003254	lipoyl attachment site [posttranslational modification]; other site
759913003255	NADH:flavin oxidoreductases, Old Yellow Enzyme family [Energy production and conversion]; Region: NemA; COG1902
759913003256	Old yellow enzyme (OYE)-related FMN binding domain, group 4.  Each monomer of OYE contains FMN as a non-covalently bound cofactor, uses NADPH as a reducing agent with oxygens, quinones, and alpha,beta-unsaturated aldehydes and ketones, and can act as...; Region: OYE_like_4_FMN; cd04735
759913003257	putative active site [active]
759913003258	putative FMN binding site [chemical binding]; other site
759913003259	putative substrate binding site [chemical binding]; other site
759913003260	putative catalytic residue [active]
759913003261	Lipoate-protein ligase A [Coenzyme metabolism]; Region: LplA; COG0095
759913003262	phosphopantothenate--cysteine ligase; Validated; Region: PRK06732
759913003263	phosphopantothenoylcysteine decarboxylase; Validated; Region: PRK07313
759913003264	Flavoprotein; Region: Flavoprotein; pfam02441
759913003265	Predicted membrane protein [Function unknown]; Region: COG4684
759913003266	This CD includes PGM2 (phosphoglucomutase 2) and PGM2L1 (phosphoglucomutase 2-like 1). The mammalian PGM2 is thought to be a phosphopentomutase that catalyzes the conversion of the nucleoside breakdown products, ribose-1-phosphate and...; Region: PGM2; cd05799
759913003267	Phosphomannomutase [Carbohydrate transport and metabolism]; Region: {ManB}; COG1109
759913003268	active site
759913003269	substrate binding site [chemical binding]; other site
759913003270	metal binding site [ion binding]; metal-binding site
759913003271	Branched-chain amino acid transport system / permease component; Region: BPD_transp_2; pfam02653
759913003272	Transmembrane subunit (TM) of Treponema pallidum (Tp) RbsC-1, RbsC-2 and related proteins. This is a functionally uncharacterized subgroup of TMs which belong to a larger group of TMs of Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette; Region: TM_PBP1_transp_TpRbsC_like; cd06580
759913003273	TM-ABC transporter signature motif; other site
759913003274	Branched-chain amino acid transport system / permease component; Region: BPD_transp_2; pfam02653
759913003275	Transmembrane subunit (TM) of Treponema pallidum (Tp) RbsC-1, RbsC-2 and related proteins. This is a functionally uncharacterized subgroup of TMs which belong to a larger group of TMs of Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette; Region: TM_PBP1_transp_TpRbsC_like; cd06580
759913003276	TM-ABC transporter signature motif; other site
759913003277	ABC-type uncharacterized transport systems, ATPase components [General function prediction only]; Region: COG3845
759913003278	First domain of the ATP-binding cassette component of monosaccharide transport system; Region: ABC_Carb_Monos_I; cd03216
759913003279	Walker A/P-loop; other site
759913003280	ATP binding site [chemical binding]; other site
759913003281	Q-loop/lid; other site
759913003282	ABC transporter signature motif; other site
759913003283	Walker B; other site
759913003284	D-loop; other site
759913003285	H-loop/switch region; other site
759913003286	Second domain of the ATP-binding cassette component of monosaccharide transport system; Region: ABC_Carb_Monos_II; cd03215
759913003287	Uncharacterized ABC-type transport system, periplasmic component/surface lipoprotein [General function prediction only]; Region: Med; COG1744
759913003288	Periplasmic binding domain of basic membrane lipoprotein, PnrA, in Treponema pallidum and its homologs from other bacteria and Archaea; Region: PBP1_BmpA_PnrA_like; cd06354
759913003289	ligand binding site [chemical binding]; other site
759913003290	Cytidine deaminase zinc-binding domain. These enzymes are Zn dependent. The zinc ion in the active site plays a central role in the proposed catalytic mechanism, activating a water molecule to form a hydroxide ion that performs a nucleophilic attack on...; Region: cytidine_deaminase; cd01283
759913003291	active site
759913003292	catalytic motif [active]
759913003293	Zn binding site [ion binding]; other site
759913003294	2-deoxyribose-5-phosphate aldolase (DERA) of the DeoC family; Region: DeoC; cd00959
759913003295	intersubunit interface [polypeptide binding]; other site
759913003296	active site
759913003297	catalytic residue [active]
759913003298	pyrimidine-nucleoside phosphorylase; Reviewed; Region: PRK06078
759913003299	Glycosyl transferase family, helical bundle domain; Region: Glycos_trans_3N; pfam02885
759913003300	Glycosyl transferase family, a/b domain; Region: Glycos_transf_3; pfam00591
759913003301	Pyrimidine nucleoside phosphorylase C-terminal domain; Region: PYNP_C; pfam07831
759913003302	Methyltransferase domain; Region: Methyltransf_31; pfam13847
759913003303	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
759913003304	S-adenosylmethionine binding site [chemical binding]; other site
759913003305	pantothenate kinase; Provisional; Region: PRK05439
759913003306	Pantothenate kinase (PanK) catalyzes the phosphorylation of pantothenic acid to form 4'-phosphopantothenic, which is the first of five steps in coenzyme A (CoA) biosynthetic pathway. The reaction carried out by this enzyme is a key regulatory point...; Region: PanK; cd02025
759913003307	ATP-binding site [chemical binding]; other site
759913003308	CoA-binding site [chemical binding]; other site
759913003309	Mg2+-binding site [ion binding]; other site
759913003310	30S ribosomal protein S20; Reviewed; Region: rpsT; PRK00239
759913003311	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
759913003312	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
759913003313	dimer interface [polypeptide binding]; other site
759913003314	phosphorylation site [posttranslational modification]
759913003315	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
759913003316	ATP binding site [chemical binding]; other site
759913003317	Mg2+ binding site [ion binding]; other site
759913003318	G-X-G motif; other site
759913003319	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
759913003320	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
759913003321	active site
759913003322	phosphorylation site [posttranslational modification]
759913003323	intermolecular recognition site; other site
759913003324	dimerization interface [polypeptide binding]; other site
759913003325	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
759913003326	DNA binding site [nucleotide binding]
759913003327	Aminopeptidase N [Amino acid transport and metabolism]; Region: PepN; COG0308
759913003328	Peptidase M1 Aminopeptidase N family incudes tricorn interacting factor F3, Endoplasmic reticulum aminopeptidase 1 (ERAP1), Aminopeptidase Q (APQ); Region: M1_APN_2; cd09601
759913003329	Zn binding site [ion binding]; other site
759913003330	phosphate transport system regulatory protein PhoU; Region: phoU_full; TIGR02135
759913003331	PhoU domain; Region: PhoU; pfam01895
759913003332	PhoU domain; Region: PhoU; pfam01895
759913003333	phosphate transporter ATP-binding protein; Provisional; Region: PRK14239
759913003334	ATP-binding cassette domain of the phosphate transport system; Region: ABC_PstB_phosphate_transporter; cd03260
759913003335	Walker A/P-loop; other site
759913003336	ATP binding site [chemical binding]; other site
759913003337	Q-loop/lid; other site
759913003338	ABC transporter signature motif; other site
759913003339	Walker B; other site
759913003340	D-loop; other site
759913003341	H-loop/switch region; other site
759913003342	phosphate transporter ATP-binding protein; Provisional; Region: PRK14237
759913003343	ATP-binding cassette domain of the phosphate transport system; Region: ABC_PstB_phosphate_transporter; cd03260
759913003344	Walker A/P-loop; other site
759913003345	ATP binding site [chemical binding]; other site
759913003346	Q-loop/lid; other site
759913003347	ABC transporter signature motif; other site
759913003348	Walker B; other site
759913003349	D-loop; other site
759913003350	H-loop/switch region; other site
759913003351	ABC-type phosphate transport system, permease component [Inorganic ion transport and metabolism]; Region: PstA; COG0581
759913003352	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
759913003353	dimer interface [polypeptide binding]; other site
759913003354	conserved gate region; other site
759913003355	putative PBP binding loops; other site
759913003356	ABC-ATPase subunit interface; other site
759913003357	ABC-type phosphate transport system, permease component [Inorganic ion transport and metabolism]; Region: PstC; COG0573
759913003358	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
759913003359	dimer interface [polypeptide binding]; other site
759913003360	conserved gate region; other site
759913003361	putative PBP binding loops; other site
759913003362	ABC-ATPase subunit interface; other site
759913003363	PBP superfamily domain; Region: PBP_like_2; cl17296
759913003364	rRNA (cytosine-C(5)-)-methyltransferase RsmF; Reviewed; Region: yebU; PRK11933
759913003365	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
759913003366	S-adenosylmethionine binding site [chemical binding]; other site
759913003367	pre-rRNA processing and ribosome biogenesis; Region: Nol1_Nop2_Fmu_2; pfam13636
759913003368	Archaeal fructose-1,6-bisphosphatase and related enzymes of inositol monophosphatase family [Carbohydrate transport and metabolism]; Region: SuhB; COG0483
759913003369	Inositol-monophosphatase-like domains. This family of phosphatases is dependent on bivalent metal ions such as Mg++, and many members are inhibited by Li+ (which is thought to displace a bivalent ion in the active site). Substrates include fructose-1; Region: IMPase_like; cd01637
759913003370	active site
759913003371	hypothetical protein; Provisional; Region: PRK04387
759913003372	Arsenate Reductase (ArsC) family, Spx subfamily; Spx is a unique RNA polymerase (RNAP)-binding protein present in bacilli and some mollicutes. It inhibits transcription by binding to the C-terminal domain of the alpha subunit of RNAP, disrupting complex...; Region: ArsC_Spx; cd03032
759913003373	ArsC family; Region: ArsC; pfam03960
759913003374	putative catalytic residues [active]
759913003375	thiol/disulfide switch; other site
759913003376	bifunctional riboflavin kinase/FMN adenylyltransferase; Reviewed; Region: PRK05627
759913003377	FAD synthetase, N-terminal domain of the bifunctional enzyme; Region: FAD_synthetase_N; cd02064
759913003378	active site
759913003379	Riboflavin kinase; Region: Flavokinase; pfam01687
759913003380	Pseudouridine synthase, Escherichia coli TruB like; Region: PseudoU_synth_EcTruB; cd02573
759913003381	RNA binding site [nucleotide binding]; other site
759913003382	Pseudouridine synthases catalyze the isomerization of specific uridines in an RNA molecule to pseudouridines (5-ribosyluracil, psi); Region: PseudoU_synth; cl00130
759913003383	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4487
759913003384	Uncharacterized protein conserved in bacteria (DUF2130); Region: DUF2130; pfam09903
759913003385	Predicted membrane protein [Function unknown]; Region: COG4129
759913003386	Bacterial protein of unknown function (DUF939); Region: DUF939; pfam06081
759913003387	DUF939 C-terminal domain; Region: DUF939_C; pfam11728
759913003388	Restriction endonuclease S subunits [Defense mechanisms]; Region: HsdS; COG0732
759913003389	MacB-like periplasmic core domain; Region: MacB_PCD; pfam12704
759913003390	FtsX-like permease family; Region: FtsX; pfam02687
759913003391	MacB-like periplasmic core domain; Region: MacB_PCD; pfam12704
759913003392	ABC-type antimicrobial peptide transport system, permease component [Defense mechanisms]; Region: SalY; COG0577
759913003393	ABC-type antimicrobial peptide transport system, ATPase component [Defense mechanisms]; Region: SalX; COG1136
759913003394	ATP-binding cassette domain of the transporters involved in export of lipoprotein and macrolide, and cell division protein; Region: ABC_MJ0796_LolCDE_FtsE; cd03255
759913003395	Walker A/P-loop; other site
759913003396	ATP binding site [chemical binding]; other site
759913003397	Q-loop/lid; other site
759913003398	ABC transporter signature motif; other site
759913003399	Walker B; other site
759913003400	D-loop; other site
759913003401	H-loop/switch region; other site
759913003402	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
759913003403	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
759913003404	Transcriptional regulators [Transcription]; Region: PhnF; COG2188
759913003405	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
759913003406	DNA-binding site [nucleotide binding]; DNA binding site
759913003407	TrkA-C domain; Region: TrkA_C; pfam02080
759913003408	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG1302
759913003409	CsbD-like; Region: CsbD; pfam05532
759913003410	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG1302
759913003411	Small integral membrane protein [Function unknown]; Region: COG5547
759913003412	Predicted membrane protein [Function unknown]; Region: COG2261
759913003413	Transposase and inactivated derivatives, IS30 family [DNA replication, recombination, and repair]; Region: Tra8; COG2826
759913003414	Helix-turn-helix domain; Region: HTH_38; pfam13936
759913003415	Integrase core domain; Region: rve; pfam00665
759913003416	ATP-dependent DNA helicase PcrA; Region: pcrA; TIGR01073
759913003417	Part of AAA domain; Region: AAA_19; pfam13245
759913003418	Family description; Region: UvrD_C_2; pfam13538
759913003419	Na+/alanine symporter [Amino acid transport and metabolism]; Region: AlsT; COG1115
759913003420	amino acid carrier protein; Region: agcS; TIGR00835
759913003421	Predicted Co/Zn/Cd cation transporters [Inorganic ion transport and metabolism]; Region: MMT1; COG0053
759913003422	cation diffusion facilitator family transporter; Region: CDF; TIGR01297
759913003423	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3666
759913003424	Transposase DDE domain; Region: DDE_Tnp_1; pfam01609
759913003425	Bacterial extracellular solute-binding proteins, family 3; Region: SBP_bac_3; pfam00497
759913003426	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
759913003427	substrate binding pocket [chemical binding]; other site
759913003428	membrane-bound complex binding site; other site
759913003429	hinge residues; other site
759913003430	ABC-type antimicrobial peptide transport system, ATPase component [Defense mechanisms]; Region: SalX; COG1136
759913003431	ATP-binding cassette domain of the binding protein-dependent transport systems; Region: ABC_Class3; cd03229
759913003432	Walker A/P-loop; other site
759913003433	ATP binding site [chemical binding]; other site
759913003434	Q-loop/lid; other site
759913003435	ABC transporter signature motif; other site
759913003436	Walker B; other site
759913003437	D-loop; other site
759913003438	H-loop/switch region; other site
759913003439	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
759913003440	dimer interface [polypeptide binding]; other site
759913003441	conserved gate region; other site
759913003442	ABC-ATPase subunit interface; other site
759913003443	Uncharacterized Zn-ribbon-containing protein involved in phosphonate metabolism [Inorganic ion transport and metabolism]; Region: PhnA; COG2824
759913003444	PhnA Zinc-Ribbon; Region: PhnA_Zn_Ribbon; pfam08274
759913003445	PhnA protein; Region: PhnA; pfam03831
759913003446	glucosamine--fructose-6-phosphate aminotransferase; Reviewed; Region: PRK00331
759913003447	Glutamine amidotransferases class-II (Gn-AT)_GFAT-type. This domain is found at the N-terminus of glucosamine-6P synthase (GlmS, or GFAT in humans).  The glutaminase domain catalyzes amide nitrogen transfer from glutamine to the appropriate substrate. In...; Region: GFAT; cd00714
759913003448	glutaminase active site [active]
759913003449	SIS (Sugar ISomerase) domain repeat 1 found in Glucosamine 6-phosphate synthase (GlmS) and Glucosamine-6-phosphate deaminase (GlmD). The SIS domain is found in many phosphosugar isomerases and phosphosugar binding proteins. GlmS contains a N-terminal...; Region: SIS_GlmS_GlmD_1; cd05008
759913003450	dimer interface [polypeptide binding]; other site
759913003451	active site
759913003452	SIS (Sugar ISomerase) domain repeat 2 found in Glucosamine 6-phosphate synthase (GlmS) and Glucosamine-6-phosphate deaminase (GlmD). The SIS domain is found in many phosphosugar isomerases and phosphosugar binding proteins. GlmS contains a N-terminal...; Region: SIS_GlmS_GlmD_2; cd05009
759913003453	dimer interface [polypeptide binding]; other site
759913003454	active site
759913003455	signal peptidase I, bacterial type; Region: sigpep_I_bact; TIGR02227
759913003456	The S24, S26 LexA/signal peptidase superfamily contains LexA-related and type I signal peptidase families. The S24 LexA protein domains include: the lambda repressor CI/C2 family and related bacterial prophage repressor proteins; LexA (EC 3.4.21.88), the...; Region: Peptidase_S24_S26; cl10465
759913003457	The S24, S26 LexA/signal peptidase superfamily contains LexA-related and type I signal peptidase families. The S24 LexA protein domains include: the lambda repressor CI/C2 family and related bacterial prophage repressor proteins; LexA (EC 3.4.21.88), the...; Region: Peptidase_S24_S26; cl10465
759913003458	pyruvate kinase; Provisional; Region: PRK05826
759913003459	Pyruvate kinase (PK):  Large allosteric enzyme that regulates glycolysis through binding of the substrate, phosphoenolpyruvate, and one or more allosteric effectors. Like other allosteric enzymes, PK has a high substrate affinity R state and a low...; Region: Pyruvate_Kinase; cl17342
759913003460	domain interfaces; other site
759913003461	active site
759913003462	Phosphofructokinase, a key regulatory enzyme in glycolysis, catalyzes the phosphorylation of fructose-6-phosphate to fructose-1,6-biphosphate. The members belong to a subfamily of the PFKA family (cd00363) and include bacterial ATP-dependent...; Region: Bacterial_PFK; cd00763
759913003463	6-phosphofructokinase; Region: PFKA_ATP; TIGR02482
759913003464	active site
759913003465	ADP/pyrophosphate binding site [chemical binding]; other site
759913003466	dimerization interface [polypeptide binding]; other site
759913003467	allosteric effector site; other site
759913003468	fructose-1,6-bisphosphate binding site; other site
759913003469	DNA polymerase III DnaE; Reviewed; Region: dnaE; PRK07279
759913003470	Polymerase and Histidinol Phosphatase domain of alpha-subunit of bacterial polymerase III; Region: PHP_PolIIIA; cd07431
759913003471	active site
759913003472	PHP Thumb interface [polypeptide binding]; other site
759913003473	DnaE_OBF: A subfamily of OB folds corresponding to the C-terminal OB-fold nucleic acid binding domain of Thermus aquaticus and Escherichia coli type C replicative DNA polymerase III alpha subunit (DnaE). The DNA polymerase holoenzyme of E. coli contains...; Region: DnaE_OBF; cd04485
759913003474	generic binding surface II; other site
759913003475	generic binding surface I; other site
759913003476	Predicted transcriptional regulators [Transcription]; Region: COG1725
759913003477	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
759913003478	DNA-binding site [nucleotide binding]; DNA binding site
759913003479	ABC-type Na+ transport system, ATPase component [Energy production and conversion / Inorganic ion transport and metabolism]; Region: NatA; COG4555
759913003480	ATP-binding cassette domain of the drug resistance transporter and related proteins, subfamily A; Region: ABC_DR_subfamily_A; cd03230
759913003481	Walker A/P-loop; other site
759913003482	ATP binding site [chemical binding]; other site
759913003483	Q-loop/lid; other site
759913003484	ABC transporter signature motif; other site
759913003485	Walker B; other site
759913003486	D-loop; other site
759913003487	H-loop/switch region; other site
759913003488	Uncharacterized conserved protein [Function unknown]; Region: COG0398
759913003489	SNARE associated Golgi protein; Region: SNARE_assoc; pfam09335
759913003490	Domain of Unknown Function with PDB structure (DUF3862); Region: DUF3862; pfam12978
759913003491	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3666
759913003492	Transposase DDE domain; Region: DDE_Tnp_1; pfam01609
759913003493	Transposase DDE domain; Region: DDE_Tnp_1_6; pfam13751
759913003494	30S ribosomal protein S1; Reviewed; Region: rpsA; PRK06676
759913003495	S1_RPS1_repeat_ec1_hs1: Ribosomal protein S1 (RPS1) domain. RPS1 is a component of the small ribosomal subunit thought to be involved in the recognition and binding of mRNA's during translation initiation. The bacterial RPS1 domain architecture...; Region: S1_RPS1_repeat_ec1_hs1; cd05687
759913003496	RNA binding site [nucleotide binding]; other site
759913003497	S1_RPS1_repeat_ec2_hs2: Ribosomal protein S1 (RPS1) domain. RPS1 is a component of the small ribosomal subunit thought to be involved in the recognition and binding of mRNA's during translation initiation. The bacterial RPS1 domain architecture...; Region: S1_RPS1_repeat_ec2_hs2; cd04465
759913003498	RNA binding site [nucleotide binding]; other site
759913003499	S1_like: Ribosomal protein S1-like RNA-binding domain. Found in a wide variety of RNA-associated proteins. Originally identified in S1 ribosomal protein. This superfamily also contains the Cold Shock Domain (CSD), which is a homolog of the S1 domain; Region: S1_like; cl09927
759913003500	RNA binding site [nucleotide binding]; other site
759913003501	S1_RPS1_repeat_hs4: Ribosomal protein S1 (RPS1) domain. RPS1 is a component of the small ribosomal subunit thought to be involved in the recognition and binding of mRNA's during translation initiation. The bacterial RPS1 domain architecture consists...; Region: S1_RPS1_repeat_hs4; cd05692
759913003502	RNA binding site [nucleotide binding]; other site
759913003503	Protein of unknown function (DUF2969); Region: DUF2969; pfam11184
759913003504	branched-chain amino acid aminotransferase; Provisional; Region: PRK13357
759913003505	BCAT_beta_family: Branched-chain aminotransferase catalyses the transamination of the branched-chain amino acids  leusine, isoleucine and valine to their respective alpha-keto acids, alpha-ketoisocaproate, alpha-keto-beta-methylvalerate and...; Region: BCAT_beta_family; cd01557
759913003506	homodimer interface [polypeptide binding]; other site
759913003507	substrate-cofactor binding pocket; other site
759913003508	catalytic residue [active]
759913003509	Transposase and inactivated derivatives, IS30 family [DNA replication, recombination, and repair]; Region: Tra8; COG2826
759913003510	Helix-turn-helix domain; Region: HTH_38; pfam13936
759913003511	Integrase core domain; Region: rve; pfam00665
759913003512	DNA topoisomerase IV, A subunit, Gram-positive; Region: parC_Gpos; TIGR01061
759913003513	DNA Topoisomerase, subtype IIA; domain A'; bacterial DNA topoisomerase IV (C subunit, ParC), bacterial DNA gyrases (A subunit, GyrA),mammalian DNA toposiomerases II. DNA topoisomerases are essential enzymes that regulate the conformational changes...; Region: TOP4c; cd00187
759913003514	CAP-like domain; other site
759913003515	active site
759913003516	primary dimer interface [polypeptide binding]; other site
759913003517	DNA gyrase C-terminal domain, beta-propeller; Region: DNA_gyraseA_C; pfam03989
759913003518	DNA topoisomerase IV, B subunit, Gram-positive; Region: parE_Gpos; TIGR01058
759913003519	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
759913003520	Mg2+ binding site [ion binding]; other site
759913003521	G-X-G motif; other site
759913003522	TopoIIA_Trans_DNA_gyrase: Transducer domain, having a ribosomal S5 domain 2-like fold, of the type found in proteins of the type IIA family of DNA topoisomerases similar to the B subunits of E. coli DNA gyrase and E. coli Topoisomerase IV which are; Region: TopoII_Trans_DNA_gyrase; cd00822
759913003523	anchoring element; other site
759913003524	dimer interface [polypeptide binding]; other site
759913003525	ATP binding site [chemical binding]; other site
759913003526	TOPRIM_TopoIIA_GyrB: topoisomerase-primase (TOPRIM) nucleotidyl transferase/hydrolase domain of the type found in proteins of the type IIA family of DNA topoisomerases similar to the Escherichia coli GyrB subunit. TopoIIA enzymes cut both strands of the...; Region: TOPRIM_TopoIIA_GyrB; cd03366
759913003527	active site
759913003528	putative metal-binding site [ion binding]; other site
759913003529	DNA gyrase B subunit, carboxyl terminus; Region: DNA_gyraseB_C; pfam00986
759913003530	putative glycerol-3-phosphate acyltransferase PlsY; Provisional; Region: PRK00220
759913003531	dihydroorotase; Validated; Region: pyrC; PRK09357
759913003532	Superfamily of metallo-dependent hydrolases (also called amidohydrolase superfamily) is a large group of proteins that show conservation in their 3-dimensional fold (TIM barrel) and in details of their active site. The vast majority of the members have a...; Region: metallo-dependent_hydrolases; cl00281
759913003533	Dihydroorotase (DHOase), subgroup IIa; DHOases catalyze the reversible interconversion of carbamoyl aspartate to dihydroorotate, a key reaction in pyrimidine biosynthesis. This subgroup also contains proteins that lack the active site, like unc-33, a C; Region: DHOase_IIa; cd01317
759913003534	active site
759913003535	Family 1 of Uracil-DNA glycosylase (UDG) enzymes; Region: UDG_F1; cd10027
759913003536	ligand binding site [chemical binding]; other site
759913003537	active site
759913003538	UGI interface [polypeptide binding]; other site
759913003539	catalytic site [active]
759913003540	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
759913003541	dimer interface [polypeptide binding]; other site
759913003542	conserved gate region; other site
759913003543	putative PBP binding loops; other site
759913003544	ABC-ATPase subunit interface; other site
759913003545	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
759913003546	Bacterial extracellular solute-binding proteins, family 3; Region: SBP_bac_3; pfam00497
759913003547	substrate binding pocket [chemical binding]; other site
759913003548	membrane-bound complex binding site; other site
759913003549	hinge residues; other site
759913003550	amidase; Provisional; Region: PRK06529
759913003551	Amidase; Region: Amidase; cl11426
759913003552	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: Tra5; COG2801
759913003553	Integrase core domain; Region: rve; pfam00665
759913003554	Integrase core domain; Region: rve_2; pfam13333
759913003555	Acetyltransferases [General function prediction only]; Region: RimI; COG0456
759913003556	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
759913003557	Coenzyme A binding pocket [chemical binding]; other site
759913003558	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
759913003559	active site
759913003560	Orotidine 5'-phosphate decarboxylase (ODCase) is a dimeric enzyme that decarboxylates orotidine 5'-monophosphate (OMP) to form uridine 5'-phosphate (UMP), an essential step in the pyrimidine biosynthetic pathway. In mammals, UMP synthase...; Region: OMP_decarboxylase_like; cd04725
759913003561	active site
759913003562	dimer interface [polypeptide binding]; other site
759913003563	Transcriptional regulator [Transcription]; Region: LysR; COG0583
759913003564	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
759913003565	CRISPR/Cas system-associated protein Csm6; Region: Csm6_III-A; cl09873
759913003566	purine nucleoside phosphorylase; Reviewed; Region: deoD; PRK05819
759913003567	purine nucleoside phosphorylase; Provisional; Region: PRK08202
759913003568	Arsenate Reductase (ArsC) family, ArsC subfamily; arsenic reductases similar to that encoded by arsC on the R733 plasmid of Escherichia coli. E. coli ArsC catalyzes the reduction of arsenate [As(V)] to arsenite [As(III)], the first step in the...; Region: ArsC_ArsC; cd03034
759913003569	ArsC family; Region: ArsC; pfam03960
759913003570	catalytic residues [active]
759913003571	phosphopentomutase; Provisional; Region: PRK05362
759913003572	Metalloenzyme superfamily; Region: Metalloenzyme; pfam01676
759913003573	RPI_A: Ribose 5-phosphate isomerase type A (RPI_A) subfamily; RPI catalyzes the reversible conversion of ribose-5-phosphate to ribulose 5-phosphate, the first step of the non-oxidative branch of the pentose phosphate pathway. This reaction leads to the...; Region: RPI_A; cd01398
759913003574	tetramer (dimer of dimers) interface [polypeptide binding]; other site
759913003575	active site
759913003576	dimer interface [polypeptide binding]; other site
759913003577	tRNA modification GTPase TrmE; Reviewed; Region: trmE; PRK05291
759913003578	GTP-binding protein TrmE N-terminus; Region: TrmE_N; pfam10396
759913003579	trmE is a tRNA modification GTPase; Region: trmE; cd04164
759913003580	G1 box; other site
759913003581	GTP/Mg2+ binding site [chemical binding]; other site
759913003582	Switch I region; other site
759913003583	G2 box; other site
759913003584	Switch II region; other site
759913003585	G3 box; other site
759913003586	G4 box; other site
759913003587	G5 box; other site
759913003588	Catalytic cysteine-containing C-terminus of GTPase, MnmE; Region: GTPase_Cys_C; pfam12631
759913003589	dipeptidase PepV; Reviewed; Region: PRK07318
759913003590	M20 Peptidase Xaa-His dipeptidase (PepV) degrades hydrophobic dipeptides; Region: M20_PepV; cd03888
759913003591	active site
759913003592	metal binding site [ion binding]; metal-binding site
759913003593	Nitroreductase-like family 1. A subfamily of the nitroreductase family containing uncharacterized proteins that are similar to nitroreductase. Nitroreductase catalyzes the reduction of nitroaromatic compounds such as nitrotoluenes, nitrofurans and...; Region: Nitroreductase_1; cd02137
759913003594	dimer interface [polypeptide binding]; other site
759913003595	FMN binding site [chemical binding]; other site
759913003596	Pyrimidine (PYR) binding domain of thiamine pyrophosphate (TPP)-dependent enzymes; Region: TPP_enzyme_PYR; cl11410
759913003597	Pyrimidine (PYR) binding domain of thiamine pyrophosphate (TPP)-dependent enzymes; Region: TPP_enzyme_PYR; cl11410
759913003598	Thiamine pyrophosphate enzyme, central domain; Region: TPP_enzyme_M; pfam00205
759913003599	Thiamine pyrophosphate (TPP) enzyme family, TPP-binding module; found in many key metabolic enzymes which use TPP (also known as thiamine diphosphate) as a cofactor. These enzymes include, among others, the E1 components of the pyruvate, the acetoin and...; Region: TPP_enzymes; cl01629
759913003600	Thiamine pyrophosphate (TPP) enzyme family, TPP-binding module; found in many key metabolic enzymes which use TPP (also known as thiamine diphosphate) as a cofactor. These enzymes include, among others, the E1 components of the pyruvate, the acetoin and...; Region: TPP_enzymes; cl01629
759913003601	excinuclease ABC subunit C; Validated; Region: uvrC; PRK00558
759913003602	Catalytic GIY-YIG domain of nucleotide excision repair endonucleases UvrC, Cho, and similar proteins; Region: GIY-YIG_UvrC_Cho; cd10434
759913003603	GIY-YIG motif/motif A; other site
759913003604	active site
759913003605	catalytic site [active]
759913003606	putative DNA binding site [nucleotide binding]; other site
759913003607	metal binding site [ion binding]; metal-binding site
759913003608	UvrB/uvrC motif; Region: UVR; pfam02151
759913003609	UvrC Helix-hairpin-helix N-terminal; Region: UvrC_HhH_N; pfam08459
759913003610	Predicted hydrolases of the HAD superfamily [General function prediction only]; Region: Cof; COG0561
759913003611	NAD-dependent aldehyde dehydrogenases [Energy production and conversion]; Region: PutA; COG1012
759913003612	Mycobacterium tuberculosis succinate-semialdehyde dehydrogenase 1-like; Region: ALDH_SSADH1_GabD1; cd07100
759913003613	NAD(P) binding site [chemical binding]; other site
759913003614	catalytic residues [active]
759913003615	HAD superfamily (subfamily IA) hydrolase, TIGR02254; Region: YjjG/YfnB
759913003616	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
759913003617	motif I; other site
759913003618	motif II; other site
759913003619	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
759913003620	dimerization interface [polypeptide binding]; other site
759913003621	putative DNA binding site [nucleotide binding]; other site
759913003622	putative Zn2+ binding site [ion binding]; other site
759913003623	Predicted permeases [General function prediction only]; Region: COG0701
759913003624	Thioredoxin domain; Region: Thioredoxin_3; pfam13192
759913003625	maltose O-acetyltransferase; Provisional; Region: PRK10092
759913003626	Maltose O-acetyltransferase (MAT) and Galactoside O-acetyltransferase (GAT): MAT and GAT catalyze the CoA-dependent acetylation of the 6-hydroxyl group of their respective sugar substrates. MAT acetylates maltose and glucose exclusively at the C6...; Region: LbH_MAT_GAT; cd03357
759913003627	active site
759913003628	substrate binding site [chemical binding]; other site
759913003629	trimer interface [polypeptide binding]; other site
759913003630	CoA binding site [chemical binding]; other site
759913003631	Predicted phosphatase/phosphohexomutase [General function prediction only]; Region: COG0637
759913003632	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
759913003633	motif II; other site
759913003634	Flagellin N-methylase; Region: FliB; pfam03692
759913003635	ABC-type Fe3+ transport system, periplasmic component [Inorganic ion transport and metabolism]; Region: AfuA; COG1840
759913003636	Bacterial extracellular solute-binding protein; Region: SBP_bac_8; pfam13416
759913003637	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
759913003638	Response regulator receiver domain; Region: Response_reg; pfam00072
759913003639	active site
759913003640	phosphorylation site [posttranslational modification]
759913003641	intermolecular recognition site; other site
759913003642	dimerization interface [polypeptide binding]; other site
759913003643	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
759913003644	helix_turn_helix, arabinose operon control protein; Region: HTH_ARAC; smart00342
759913003645	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
759913003646	Predicted signal transduction protein with a C-terminal ATPase domain [Signal transduction mechanisms]; Region: COG2972
759913003647	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cl01054
759913003648	dimerization interface [polypeptide binding]; other site
759913003649	Histidine kinase; Region: His_kinase; pfam06580
759913003650	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
759913003651	ATP binding site [chemical binding]; other site
759913003652	Mg2+ binding site [ion binding]; other site
759913003653	G-X-G motif; other site
759913003654	Phosphotransferase system, mannose/fructose/N-acetylgalactosamine-specific component IID [Carbohydrate transport and metabolism]; Region: ManZ; COG3716
759913003655	Phosphotransferase system, mannose/fructose/N-acetylgalactosamine-specific component IIC [Carbohydrate transport and metabolism]; Region: ManY; COG3715
759913003656	Phosphotransferase system, mannose/fructose/N-acetylgalactosamine-specific component IIB [Carbohydrate transport and metabolism]; Region: COG3444
759913003657	active site
759913003658	phosphorylation site [posttranslational modification]
759913003659	PTS_IIA, PTS system, mannose/sorbose specific IIA subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This family...; Region: PTS_IIA_man; cd00006
759913003660	active pocket/dimerization site; other site
759913003661	active site
759913003662	phosphorylation site [posttranslational modification]
759913003663	Predicted membrane protein [Function unknown]; Region: COG2855
759913003664	Lipase.  Lipases are esterases that can hydrolyze long-chain acyl-triglycerides into di- and monoglycerides, glycerol, and free fatty acids at a water/lipid interface. A typical feature of lipases is "interfacial activation", the process of...; Region: Lipase; cd00741
759913003665	nucleophilic elbow; other site
759913003666	catalytic triad; other site
759913003667	Enterocin A Immunity; Region: EntA_Immun; pfam08951
759913003668	Class II bacteriocin; Region: Bacteriocin_II; pfam01721
759913003669	Metal dependent phosphohydrolases with conserved 'HD' motif; Region: HDc; cl17215
759913003670	Metal dependent phosphohydrolases with conserved 'HD' motif; Region: HDc; cd00077
759913003671	Zn2+ binding site [ion binding]; other site
759913003672	Mg2+ binding site [ion binding]; other site
759913003673	methionine sulfoxide reductase B; Provisional; Region: PRK00222
759913003674	SelR domain; Region: SelR; pfam01641
759913003675	GTP-binding protein LepA; Provisional; Region: PRK05433
759913003676	LepA also known as Elongation Factor 4 (EF4); Region: LepA; cd01890
759913003677	G1 box; other site
759913003678	putative GEF interaction site [polypeptide binding]; other site
759913003679	GTP/Mg2+ binding site [chemical binding]; other site
759913003680	Switch I region; other site
759913003681	G2 box; other site
759913003682	G3 box; other site
759913003683	Switch II region; other site
759913003684	G4 box; other site
759913003685	G5 box; other site
759913003686	lepA_II: This subfamily represents the domain II of LepA, a GTP-binding protein localized in the cytoplasmic membrane. The N-terminal domain of LepA shares regions of homology to translation factors. In terms of interaction with the ribosome, EF-G, EF-Tu...; Region: lepA_II; cd03699
759913003687	lepA_C: This family represents the C-terminal region of LepA, a GTP-binding protein localized in the cytoplasmic membrane.   LepA is ubiquitous in Bacteria and Eukaryota (e.g. Saccharomyces cerevisiae GUF1p), but is missing from Archaea. LepA exhibits...; Region: lepA_C; cd03709
759913003688	GTP-binding protein LepA C-terminus; Region: LepA_C; pfam06421
759913003689	Nucleoside diphosphate kinase Group I (NDPk_I)-like: NDP kinase domains are present in a large family of structurally and functionally conserved proteins from bacteria to humans that generally catalyze the transfer of gamma-phosphates of a nucleoside...; Region: NDPk_I; cd04413
759913003690	active site
759913003691	multimer interface [polypeptide binding]; other site
759913003692	putative transposase OrfB; Reviewed; Region: PHA02517
759913003693	HTH-like domain; Region: HTH_21; pfam13276
759913003694	Integrase core domain; Region: rve; pfam00665
759913003695	Integrase core domain; Region: rve_3; pfam13683
759913003696	Transposase; Region: HTH_Tnp_1; pfam01527
759913003697	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG2963
759913003698	CRISPR 1 region; >spacer1 ACATCTTGGATGAGGATAACGTCCCAAAGG >spacer2 AAGTTGAAAAATGGAGACCACTCGTTGAAA >spacer3 CAGCTAGTGGCTATGCGGAGTTACTTATCC >spacer4 ACAATAGTCCGACCTTGCGCATATCTTTGC >spacer5 AGTGACCCCGTCGTTAACCGTGTTGTTGTA >spacer6 TTGGTATTCGTGGGGTGCTTGAATGAGCAA >spacer7 TAGATTTTTTATACTCGCTCTCTGAGTATG >spacer8 CAAGAGCGAGGGCATTTGTCTTATCTAATT >spacer9 TTTACACGTTTTAGAAATTGCCTATCGTAC >spacer10 ACACCAACGGTCGTTTTCCCAGCGGCAGTT >spacer11 AAATTCCAGTCATATAATTGCTATGCTCGT >spacer12 GATGTAATCATGCGTGATACACGTTCATCT >spacer13 GATGTAATCATGCGTGATACACGTTCATCT >spacer14 AGATAGGTAAAACCCGCTGCCAAAAAGACT >spacer15 ATAGTTTTACGTGTTTTTAAGTTTTGAGTT >spacer16 TCAATACAAGCATCTGCGGACGATTGCCTA >spacer17 ACGAGAACGGGGATAAGCACGAGATTCCTC >spacer18 ACCTCTGCTGTATCAATAGCATCACGACTT >spacer19 AAAAGTTTATCCAAAAATTCTTGTGAAATTT
759913003699	CRISPR/Cas system-associated protein Csn2; Region: Csn2; cd09758
759913003700	CRISPR type II-A/NMEMI-associated protein Csn2; Region: cas_Csn2; TIGR01866
759913003701	tetramer interface [polypeptide binding]; other site
759913003702	putative DNA binding site [nucleotide binding]; other site
759913003703	Ca binding site [ion binding]; other site
759913003704	Ca binding site [ion binding]; other site
759913003705	CRISPR/Cas system-associated protein Cas2; Region: Cas2_I_II_III; cd09638
759913003706	CRISPR/Cas system-associated protein Cas1; Region: Cas1_II; cd09720
759913003707	Predicted CRISPR-associated nuclease, contains McrA/HNH-nuclease and RuvC-like nuclease domain [Defense mechanisms]; Region: COG3513
759913003708	HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cl00083
759913003709	CRISPR/Cas system-associated protein Cas9; Region: Csn1; cd09643
759913003710	Predicted membrane protein [Function unknown]; Region: COG4478
759913003711	HAD-superfamily subfamily IIA hydrolase, TIGR01457; Region: HAD-SF-IIA-hyp2
759913003712	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
759913003713	active site
759913003714	motif I; other site
759913003715	motif II; other site
759913003716	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
759913003717	Acyl-ACP thioesterase [Lipid metabolism]; Region: FatA; COG3884
759913003718	4-hydroxybenzoyl-CoA thioesterase (4HBT). Catalyzes the final step in the 4-chlorobenzoate degradation pathway in which 4-chlorobenzoate is converted to 4-hydroxybenzoate in certain soil-dwelling bacteria. 4HBT forms a homotetramer with four active sites; Region: 4HBT; cd00586
759913003719	active site
759913003720	The hotdog fold was initially identified in the E. coli FabA (beta-hydroxydecanoyl-acyl carrier protein (ACP)-dehydratase) structure and subsequently in 4HBT (4-hydroxybenzoyl-CoA thioesterase) from Pseudomonas. A number of other seemingly unrelated...; Region: hot_dog; cl00509
759913003721	active site 2 [active]
759913003722	active site 1 [active]
759913003723	coproporphyrinogen III oxidase; Provisional; Region: PRK08599
759913003724	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
759913003725	FeS/SAM binding site; other site
759913003726	HemN C-terminal domain; Region: HemN_C; pfam06969
759913003727	phosphoglucosamine mutase; Provisional; Region: glmM; PRK14316
759913003728	GlmM is a bacterial phosphoglucosamine mutase (PNGM) that belongs to the alpha-D-phosphohexomutase superfamily. It is required for the interconversion of glucosamine-6-phosphate and glucosamine-1-phosphate in the biosynthetic pathway of...; Region: GlmM; cd05802
759913003729	active site
759913003730	substrate binding site [chemical binding]; other site
759913003731	metal binding site [ion binding]; metal-binding site
759913003732	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4856
759913003733	YbbR-like protein; Region: YbbR; pfam07949
759913003734	Uncharacterized conserved protein [Function unknown]; Region: COG1624
759913003735	DisA bacterial checkpoint controller nucleotide-binding; Region: DisA_N; pfam02457
759913003736	UDP-N-acetylmuramyl tripeptide synthase [Cell envelope biogenesis, outer membrane]; Region: MurE; COG0769
759913003737	Mur ligase middle domain; Region: Mur_ligase_M; pfam08245
759913003738	Domain of unknown function (DUF1727); Region: DUF1727; pfam08353
759913003739	Type 1 glutamine amidotransferase (GATase1) domain found in Cobyric Acid Synthase (CobQ); Region: GATase1_CobQ; cd01750
759913003740	catalytic triad [active]
759913003741	Lipoate-protein ligase A [Coenzyme metabolism]; Region: LplA; COG0095
759913003742	lipoyltransferase and lipoate-protein ligase; Region: lipoyltrans; TIGR00545
759913003743	Bacterial lipoate protein ligase C-terminus; Region: Lip_prot_lig_C; pfam10437
759913003744	Predicted membrane protein [Function unknown]; Region: COG4709
759913003745	Domain of unknown function (DUF4097); Region: DUF4097; pfam13349
759913003746	Domain of unknown function (DUF4098); Region: DUF4098; pfam13345
759913003747	Domain of unknown function (DUF4098); Region: DUF4098; pfam13345
759913003748	Predicted transcriptional regulators [Transcription]; Region: COG1695
759913003749	Transcriptional regulator PadR-like family; Region: PadR; pfam03551
759913003750	Lipoyl domain of the dihydrolipoyl acyltransferase component (E2) of 2-oxo acid dehydrogenases. 2-oxo acid dehydrogenase multienzyme complexes, like pyruvate dehydrogenase (PDH), 2-oxoglutarate dehydrogenase (OGDH) and branched-chain 2-oxo acid...; Region: lipoyl_domain; cd06849
759913003751	E3 interaction surface; other site
759913003752	lipoyl attachment site [posttranslational modification]; other site
759913003753	dihydrolipoamide dehydrogenase; Region: lipoamide_DH; TIGR01350
759913003754	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
759913003755	Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain; Region: Pyr_redox_dim; pfam02852
759913003756	branched-chain alpha-keto acid dehydrogenase subunit E2; Reviewed; Region: PRK11856
759913003757	Lipoyl domain of the dihydrolipoyl acyltransferase component (E2) of 2-oxo acid dehydrogenases. 2-oxo acid dehydrogenase multienzyme complexes, like pyruvate dehydrogenase (PDH), 2-oxoglutarate dehydrogenase (OGDH) and branched-chain 2-oxo acid...; Region: lipoyl_domain; cd06849
759913003758	E3 interaction surface; other site
759913003759	lipoyl attachment site [posttranslational modification]; other site
759913003760	e3 binding domain; Region: E3_binding; pfam02817
759913003761	e3 binding domain; Region: E3_binding; pfam02817
759913003762	2-oxoacid dehydrogenases acyltransferase (catalytic domain); Region: 2-oxoacid_dh; pfam00198
759913003763	Pyruvate/2-oxoglutarate dehydrogenase complex, dehydrogenase (E1) component, eukaryotic type, beta subunit [Energy production and conversion]; Region: AcoB; COG0022
759913003764	Pyrimidine (PYR) binding domain of the beta subunits of the E1 components of human pyruvate dehydrogenase complex (E1- PDHc) and related proteins; Region: TPP_PYR_E1-PDHc-beta_like; cd07036
759913003765	alpha subunit interface [polypeptide binding]; other site
759913003766	TPP binding site [chemical binding]; other site
759913003767	heterodimer interface [polypeptide binding]; other site
759913003768	Transketolase, C-terminal domain; Region: Transketolase_C; pfam02780
759913003769	Pyruvate/2-oxoglutarate dehydrogenase complex, dehydrogenase (E1) component, eukaryotic type, alpha subunit [Energy production and conversion]; Region: AcoA; COG1071
759913003770	Thiamine pyrophosphate (TPP) family, E1 of PDC_ADC_BCADC subfamily, TPP-binding module; composed of proteins similar to the E1 components of the human pyruvate dehydrogenase complex (PDC), the acetoin dehydrogenase complex (ADC) and the branched chain...; Region: TPP_E1_PDC_ADC_BCADC; cd02000
759913003771	tetramer interface [polypeptide binding]; other site
759913003772	TPP-binding site [chemical binding]; other site
759913003773	heterodimer interface [polypeptide binding]; other site
759913003774	phosphorylation loop region [posttranslational modification]
759913003775	ATPase components of ABC transporters with duplicated ATPase domains [General function prediction only]; Region: Uup; COG0488
759913003776	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
759913003777	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
759913003778	ABC transporter; Region: ABC_tran_2; pfam12848
759913003779	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
759913003780	Predicted esterase [General function prediction only]; Region: COG0627
759913003781	S-formylglutathione hydrolase; Region: PLN02442
759913003782	mRNA degradation ribonucleases J1/J2 (metallo-beta-lactamase superfamily) [Translation, ribosomal structure and biogenesis; Replication, recombination and repair]; Region: COG0595
759913003783	Metallo-beta-lactamase superfamily; Region: Lactamase_B; pfam00753
759913003784	RNA-metabolising metallo-beta-lactamase; Region: RMMBL; pfam07521
759913003785	ABC-type uncharacterized transport system, ATPase component [General function prediction only]; Region: PhnK; COG1101
759913003786	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
759913003787	Walker A/P-loop; other site
759913003788	ATP binding site [chemical binding]; other site
759913003789	Q-loop/lid; other site
759913003790	ABC transporter signature motif; other site
759913003791	Walker B; other site
759913003792	D-loop; other site
759913003793	H-loop/switch region; other site
759913003794	Branched-chain amino acid transport system / permease component; Region: BPD_transp_2; pfam02653
759913003795	Transmembrane subunit (TM) of Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which are involved in the uptake of branched-chain amino acids (AAs), as well as TMs of transporters involved in the uptake of...; Region: TM_PBP1_branched-chain-AA_like; cd06574
759913003796	TM-ABC transporter signature motif; other site
759913003797	Type I periplasmic ligand-binding domain of uncharacterized ABC-type transport systems that are predicted to be involved in the uptake of amino acids, peptides, or inorganic ions; Region: PBP1_ABC_uncharacterized_transporter; cd06325
759913003798	zinc binding site [ion binding]; other site
759913003799	putative ligand binding site [chemical binding]; other site
759913003800	Uncharacterized protein family (UPF0236); Region: UPF0236; pfam06782
759913003801	acid phosphatase/phosphotransferase; Provisional; Region: aphA; PRK11009
759913003802	Transposase; Region: HTH_Tnp_1; pfam01527
759913003803	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG2963
759913003804	HTH-like domain; Region: HTH_21; pfam13276
759913003805	Transposase; Region: HTH_Tnp_1; pfam01527
759913003806	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG2963
759913003807	HTH-like domain; Region: HTH_21; pfam13276
759913003808	Predicted RNA-binding protein homologous to eukaryotic snRNP [Transcription]; Region: COG1293
759913003809	Domain of unknown function (DUF814); Region: DUF814; pfam05670
759913003810	type IV pilus biogenesis/stability protein PilW; Region: type_IV_pilW; TIGR02521
759913003811	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cd00189
759913003812	binding surface
759913003813	TPR motif; other site
759913003814	Anaphase-promoting complex, cyclosome, subunit 3; Region: Apc3; pfam12895
759913003815	Predicted permease, member of the PurR regulon [General function prediction only]; Region: yhhT; COG0628
759913003816	Domain of unknown function DUF20; Region: UPF0118; pfam01594
759913003817	MutT homolog-1 (MTH1) is a member of the Nudix hydrolase superfamily. MTH1, the mammalian counterpart of MutT, hydrolyzes oxidized purine nucleoside triphosphates, such as 8-oxo-dGTP and 2-hydroxy-ATP, to monophosphates, thereby preventing the...; Region: MTH1; cd03427
759913003818	putative active site [active]
759913003819	nucleotide binding site [chemical binding]; other site
759913003820	nudix motif; other site
759913003821	putative metal binding site [ion binding]; other site
759913003822	Myosin and Kinesin motor domain. These ATPases belong to the P-loop NTPase family and provide the driving force in myosin and kinesin mediated processes; Region: Motor_domain; cl00286
759913003823	dTDP-D-glucose 4,6-dehydratase [Cell envelope biogenesis, outer membrane]; Region: RfbB; COG1088
759913003824	dTDP-D-glucose 4,6-dehydratase, extended (e) SDRs; Region: dTDP_GD_SDR_e; cd05246
759913003825	NAD binding site [chemical binding]; other site
759913003826	substrate binding site [chemical binding]; other site
759913003827	homodimer interface [polypeptide binding]; other site
759913003828	active site
759913003829	dTDP-4-dehydrorhamnose 3,5-epimerase and related enzymes [Cell envelope biogenesis, outer membrane]; Region: RfbC; COG1898
759913003830	G1P_TT_short is the short form of glucose-1-phosphate thymidylyltransferase; Region: G1P_TT_short; cd02538
759913003831	glucose-1-phosphate thymidylyltransferase, short form; Region: rmlA; TIGR01207
759913003832	substrate binding site; other site
759913003833	tetramer interface; other site
759913003834	Glycine/D-amino acid oxidases (deaminating) [Amino acid transport and metabolism]; Region: DadA; COG0665
759913003835	NAD-dependent, lactate dehydrogenase-like, 2-hydroxycarboxylate dehydrogenase family; Region: LDH_MDH_like; cl17195
759913003836	Predicted divalent heavy-metal cations transporter [Inorganic ion transport and metabolism]; Region: COG0428
759913003837	Uncharacterized conserved protein [Function unknown]; Region: COG0327
759913003838	NIF3 (NGG1p interacting factor 3); Region: NIF3; pfam01784
759913003839	Predicted SAM-dependent methyltransferase [General function prediction only]; Region: COG2384
759913003840	Family of unknown function (DUF633); Region: DUF633; pfam04816
759913003841	Predicted EndoIII-related endonuclease [DNA replication, recombination, and repair]; Region: Nth; COG0177
759913003842	endonuclease III; includes endonuclease III (DNA-(apurinic or apyrimidinic site) lyase), alkylbase DNA glycosidases (Alka-family) and other DNA glycosidases; Region: ENDO3c; cd00056
759913003843	minor groove reading motif; other site
759913003844	helix-hairpin-helix signature motif; other site
759913003845	substrate binding pocket [chemical binding]; other site
759913003846	active site
759913003847	Iron-sulfur binding domain of endonuclease III; Region: EndIII_4Fe-2S; pfam10576
759913003848	Putative primosome component and related proteins [DNA replication, recombination, and repair]; Region: DnaD; COG3935
759913003849	Replication initiation and membrane attachment; Region: DnaB_2; pfam07261
759913003850	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
759913003851	active site
759913003852	single-stranded-DNA-specific exonuclease RecJ; Region: recJ; TIGR00644
759913003853	DHH family; Region: DHH; pfam01368
759913003854	Single-strand DNA-specific exonuclease, C terminal domain; Region: ssDNA-exonuc_C; cl11538
759913003855	Short-chain dehydrogenases of various substrate specificities [General function prediction only]; Region: DltE; COG0300
759913003856	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
759913003857	NAD(P) binding site [chemical binding]; other site
759913003858	active site
759913003859	ribonuclease Z; Region: RNase_Z; TIGR02651
759913003860	Galactose-1-phosphate uridyl transferase, N-terminal domain; Region: GalP_UDP_transf; pfam01087
759913003861	GTP-binding protein HflX; Region: GTP_HflX; TIGR03156
759913003862	GTP-binding GTPase N-terminal; Region: GTP-bdg_N; pfam13167
759913003863	HflX GTPase family; Region: HflX; cd01878
759913003864	G1 box; other site
759913003865	GTP/Mg2+ binding site [chemical binding]; other site
759913003866	Switch I region; other site
759913003867	G2 box; other site
759913003868	G3 box; other site
759913003869	Switch II region; other site
759913003870	G4 box; other site
759913003871	G5 box; other site
759913003872	tRNA delta(2)-isopentenylpyrophosphate transferase; Reviewed; Region: miaA; PRK00091
759913003873	tRNA delta(2)-isopentenylpyrophosphate transferase [Translation, ribosomal structure and biogenesis]; Region: MiaA; COG0324
759913003874	C4-dicarboxylate transporters of the Tellurite-resistance/Dicarboxylate Transporter (TDT) family; Region: TDT_C4-dicarb_trans; cd09325
759913003875	Tellurite resistance protein and related permeases [Inorganic ion transport and metabolism]; Region: TehA; COG1275
759913003876	gating phenylalanine in ion channel; other site
759913003877	GST_N family, Class Beta subfamily; GSTs are cytosolic dimeric proteins involved in cellular detoxification by catalyzing the conjugation of glutathione (GSH) with a wide range of endogenous and xenobiotic alkylating agents, including carcinogens; Region: GST_N_Beta; cd03057
759913003878	C-terminal domain interface [polypeptide binding]; other site
759913003879	GSH binding site (G-site) [chemical binding]; other site
759913003880	dimer interface [polypeptide binding]; other site
759913003881	C-terminal, alpha helical domain of Class Beta Glutathione S-transferases; Region: GST_C_Beta; cd03188
759913003882	dimer interface [polypeptide binding]; other site
759913003883	N-terminal domain interface [polypeptide binding]; other site
759913003884	substrate binding pocket (H-site) [chemical binding]; other site
759913003885	Nucleoside/nucleotide kinase (NK) is a protein superfamily consisting of multiple families of enzymes that share structural similarity and are functionally related to the catalysis of the reversible phosphate group transfer from nucleoside triphosphates...; Region: NK; cl17190
759913003886	Nucleoside/nucleotide kinase (NK) is a protein superfamily consisting of multiple families of enzymes that share structural similarity and are functionally related to the catalysis of the reversible phosphate group transfer from nucleoside triphosphates...; Region: NK; cl17190
759913003887	active site
759913003888	putative rhodanese-related sulfurtransferase; Provisional; Region: PRK00142
759913003889	Member of the Rhodanese Homology Domain superfamily. This CD includes Escherichia coli YceA, Bacillus subtilis YbfQ, and similar uncharacterized proteins; Region: RHOD_YceA; cd01518
759913003890	active site residue [active]
759913003891	Protein of unknown function (DUF3650); Region: DUF3650; pfam12368
759913003892	Stringent starvation protein B; Region: SspB; cl01120
759913003893	Predicted flavoprotein [General function prediction only]; Region: COG0431
759913003894	NADPH-dependent FMN reductase; Region: FMN_red; pfam03358
759913003895	Glycosyltransferases catalyze the transfer of sugar moieties from activated donor molecules to specific acceptor molecules, forming glycosidic bonds. The acceptor molecule can be a lipid, a protein, a heterocyclic compound, or another carbohydrate...; Region: Glycosyltransferase_GTB_type; cl10013
759913003896	glycogen/starch/alpha-glucan phosphorylases; Region: P_ylase; TIGR02093
759913003897	4-alpha-glucanotransferase; Provisional; Region: PRK14508
759913003898	Transcriptional regulators [Transcription]; Region: PurR; COG1609
759913003899	Helix-turn-helix (HTH) DNA binding domain of the LacI family of transcriptional regulators; Region: HTH_LacI; cd01392
759913003900	DNA binding site [nucleotide binding]
759913003901	domain linker motif; other site
759913003902	Ligand-binding domain of uncharacterized transcription regulator ycjW which is a member of the LacI-GalR family repressors; Region: PBP1_ycjW_transcription_regulator_like; cd06294
759913003903	putative dimerization interface [polypeptide binding]; other site
759913003904	putative ligand binding site [chemical binding]; other site
759913003905	Transposase and inactivated derivatives, IS30 family [DNA replication, recombination, and repair]; Region: Tra8; COG2826
759913003906	Helix-turn-helix domain; Region: HTH_38; pfam13936
759913003907	Integrase core domain; Region: rve; pfam00665
759913003908	Maltose-binding periplasmic proteins/domains [Carbohydrate transport and metabolism]; Region: MalE; COG2182
759913003909	Bacterial extracellular solute-binding protein; Region: SBP_bac_1; pfam01547
759913003910	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
759913003911	dimer interface [polypeptide binding]; other site
759913003912	conserved gate region; other site
759913003913	ABC-ATPase subunit interface; other site
759913003914	ABC-type sugar transport system, permease component [Carbohydrate transport and metabolism]; Region: UgpE; COG0395
759913003915	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
759913003916	dimer interface [polypeptide binding]; other site
759913003917	conserved gate region; other site
759913003918	putative PBP binding loops; other site
759913003919	ABC-ATPase subunit interface; other site
759913003920	Transcriptional regulators [Transcription]; Region: PurR; COG1609
759913003921	Helix-turn-helix (HTH) DNA binding domain of the LacI family of transcriptional regulators; Region: HTH_LacI; cd01392
759913003922	DNA binding site [nucleotide binding]
759913003923	domain linker motif; other site
759913003924	Predicted integral membrane protein [Function unknown]; Region: COG5521
759913003925	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cl00427
759913003926	ABC-type sugar transport system, permease component [Carbohydrate transport and metabolism]; Region: UgpE; COG0395
759913003927	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
759913003928	dimer interface [polypeptide binding]; other site
759913003929	conserved gate region; other site
759913003930	putative PBP binding loops; other site
759913003931	ABC-ATPase subunit interface; other site
759913003932	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
759913003933	dimer interface [polypeptide binding]; other site
759913003934	conserved gate region; other site
759913003935	ABC-ATPase subunit interface; other site
759913003936	N-terminal Early set domain associated with the catalytic domain of cyclomaltodextrinase and pullulan-degrading enzymes; Region: E_set_CDase_PDE_N; cd02857
759913003937	maltodextrin glucosidase; Provisional; Region: PRK10785
759913003938	homodimer interface [polypeptide binding]; other site
759913003939	Alpha amylase catalytic domain found in cyclomaltodextrinases and related proteins; Region: AmyAc_CMD; cd11338
759913003940	active site
759913003941	homodimer interface [polypeptide binding]; other site
759913003942	catalytic site [active]
759913003943	Maltose-binding periplasmic proteins/domains [Carbohydrate transport and metabolism]; Region: MalE; COG2182
759913003944	Bacterial extracellular solute-binding protein; Region: SBP_bac_1; pfam01547
759913003945	Protein involved in D-alanine esterification of lipoteichoic acid and wall teichoic acid (D-alanine transfer protein) [Cell envelope biogenesis, outer membrane]; Region: DltD; COG3966
759913003946	DltD N-terminal region; Region: DltD_N; pfam04915
759913003947	DltD central region; Region: DltD_M; pfam04918
759913003948	DltD C-terminal region; Region: DltD_C; pfam04914
759913003949	D-alanine--poly(phosphoribitol) ligase subunit 2; Validated; Region: PRK05087
759913003950	D-alanyl-lipoteichoic acid biosynthesis protein DltB; Region: LTA_dltB; TIGR04091
759913003951	D-alanine--poly(phosphoribitol) ligase subunit 1; Provisional; Region: PRK04813
759913003952	D-alanine:D-alanyl carrier protein ligase (DltA); Region: DltA; cd05945
759913003953	acyl-activating enzyme (AAE) consensus motif; other site
759913003954	AMP binding site [chemical binding]; other site
759913003955	D-Ala-teichoic acid biosynthesis protein; Region: DUF3687; pfam12459
759913003956	excinuclease ABC subunit B; Provisional; Region: PRK05298
759913003957	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
759913003958	ATP binding site [chemical binding]; other site
759913003959	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
759913003960	nucleotide binding region [chemical binding]; other site
759913003961	ATP-binding site [chemical binding]; other site
759913003962	Ultra-violet resistance protein B; Region: UvrB; pfam12344
759913003963	Bacterial extracellular solute-binding proteins, family 3; Region: SBP_bac_3; pfam00497
759913003964	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
759913003965	substrate binding pocket [chemical binding]; other site
759913003966	membrane-bound complex binding site; other site
759913003967	hinge residues; other site
759913003968	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
759913003969	Bacterial extracellular solute-binding proteins, family 3; Region: SBP_bac_3; pfam00497
759913003970	substrate binding pocket [chemical binding]; other site
759913003971	membrane-bound complex binding site; other site
759913003972	hinge residues; other site
759913003973	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
759913003974	dimer interface [polypeptide binding]; other site
759913003975	conserved gate region; other site
759913003976	putative PBP binding loops; other site
759913003977	ABC-ATPase subunit interface; other site
759913003978	ABC-type polar amino acid transport system, ATPase component [Amino acid transport and metabolism]; Region: GlnQ; COG1126
759913003979	ATP-binding cassette domain of the histidine and glutamine transporters; Region: ABC_HisP_GlnQ; cd03262
759913003980	Walker A/P-loop; other site
759913003981	ATP binding site [chemical binding]; other site
759913003982	Q-loop/lid; other site
759913003983	ABC transporter signature motif; other site
759913003984	Walker B; other site
759913003985	D-loop; other site
759913003986	H-loop/switch region; other site
759913003987	Nicotinamide mononucleotide transporter; Region: NMN_transporter; cl01256
759913003988	GTPase CgtA; Reviewed; Region: obgE; PRK12297
759913003989	GTP1/OBG; Region: GTP1_OBG; pfam01018
759913003990	Obg GTPase; Region: Obg; cd01898
759913003991	G1 box; other site
759913003992	GTP/Mg2+ binding site [chemical binding]; other site
759913003993	Switch I region; other site
759913003994	G2 box; other site
759913003995	G3 box; other site
759913003996	Switch II region; other site
759913003997	G4 box; other site
759913003998	G5 box; other site
759913003999	Domain of unknown function (DUF1967); Region: DUF1967; pfam09269
759913004000	Protein of unknown function (DUF4044); Region: DUF4044; pfam13253
759913004001	Thermophilic metalloprotease (M29); Region: Peptidase_M29; pfam02073
759913004002	Leucyl aminopeptidase (aminopeptidase T) [Amino acid transport and metabolism]; Region: AmpS; COG2309
759913004003	Transposase DDE domain; Region: DDE_Tnp_1_3; pfam13612
759913004004	Transposase DDE domain; Region: DDE_Tnp_1; pfam01609
759913004005	Transposase DDE domain; Region: DDE_Tnp_1_3; pfam13612
759913004006	uncharacterized bacterial subfamily of the Escherichia coli CorA-Salmonella typhimurium ZntB family; Region: EcCorA_ZntB-like_u1; cd12826
759913004007	CorA-like Mg2+ transporter protein; Region: CorA; pfam01544
759913004008	Cl binding site [ion binding]; other site
759913004009	oligomer interface [polypeptide binding]; other site
759913004010	16S rRNA uridine-516 pseudouridylate synthase and related pseudouridylate synthases [Translation, ribosomal structure and biogenesis]; Region: RsuA; COG1187
759913004011	S4/Hsp/ tRNA synthetase RNA-binding domain; The domain surface is populated by conserved, charged residues that define a likely RNA-binding site;  Found in stress proteins, ribosomal proteins and tRNA synthetases; This may imply a hitherto unrecognized...; Region: S4; cd00165
759913004012	RNA binding surface [nucleotide binding]; other site
759913004013	Pseudouridine synthase, Escherichia coli RsuA like; Region: PseudoU_synth_RsuA; cd02553
759913004014	active site
759913004015	uracil binding [chemical binding]; other site
759913004016	Predicted thioesterase [General function prediction only]; Region: COG5496
759913004017	benzoate transport; Region: 2A0115; TIGR00895
759913004018	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
759913004019	putative substrate translocation pore; other site
759913004020	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4868
759913004021	hypothetical protein; Provisional; Region: PRK13663
759913004022	ABC-type uncharacterized transport system, permease component [General function prediction only]; Region: COG0390
759913004023	ABC-type uncharacterized transport system, ATPase component [General function prediction only]; Region: COG4619
759913004024	ATP-binding cassette domain of the phosphate transport system; Region: ABC_PstB_phosphate_transporter; cd03260
759913004025	Walker A/P-loop; other site
759913004026	ATP binding site [chemical binding]; other site
759913004027	Q-loop/lid; other site
759913004028	ABC transporter signature motif; other site
759913004029	Walker B; other site
759913004030	D-loop; other site
759913004031	H-loop/switch region; other site
759913004032	PaaI_thioesterase is a tetrameric acyl-CoA thioesterase with a hot dog fold and one of several proteins responsible for phenylacetic acid (PA) degradation in bacteria.  Although orthologs of PaaI exist in archaea and eukaryotes, their function has not...; Region: PaaI_thioesterase; cd03443
759913004033	CoenzymeA binding site [chemical binding]; other site
759913004034	subunit interaction site [polypeptide binding]; other site
759913004035	PHB binding site; other site
759913004036	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase; Provisional; Region: PRK07164
759913004037	Phosphorylase superfamily; Region: PNP_UDP_1; pfam01048
759913004038	NLPA lipoprotein; Region: Lipoprotein_9; pfam03180
759913004039	phage-related chromosomal island (PRCI) 1
759913004040	Transposase; Region: HTH_Tnp_1; pfam01527
759913004041	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG2963
759913004042	putative transposase OrfB; Reviewed; Region: PHA02517
759913004043	HTH-like domain; Region: HTH_21; pfam13276
759913004044	Integrase core domain; Region: rve; pfam00665
759913004045	Cytosine-C5 specific DNA methylases; Methyl transfer reactions play an important role in many aspects of biology. Cytosine-specific DNA methylases are found both in prokaryotes and eukaryotes. DNA methylation, or the covalent addition of a methyl group...; Region: Cyt_C5_DNA_methylase; cd00315
759913004046	Transposase; Region: HTH_Tnp_1; pfam01527
759913004047	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG2963
759913004048	HTH-like domain; Region: HTH_21; pfam13276
759913004049	Integrase core domain; Region: rve; pfam00665
759913004050	Integrase core domain; Region: rve_3; pfam13683
759913004051	Cytosine-C5 specific DNA methylases; Methyl transfer reactions play an important role in many aspects of biology. Cytosine-specific DNA methylases are found both in prokaryotes and eukaryotes. DNA methylation, or the covalent addition of a methyl group...; Region: Cyt_C5_DNA_methylase; cd00315
759913004052	cofactor binding site; other site
759913004053	DNA binding site [nucleotide binding]
759913004054	substrate interaction site [chemical binding]; other site
759913004055	Replication initiator protein A (RepA) N-terminus; Region: RepA_N; pfam06970
759913004056	Site-specific recombinases, DNA invertase Pin homologs [DNA replication, recombination, and repair]; Region: PinR; COG1961
759913004057	Serine Recombinase family, catalytic domain; a DNA binding domain may be present either N- or C-terminal to the catalytic domain. These enzymes perform site-specific recombination of DNA molecules by a concerted, four-strand cleavage and rejoining...; Region: Ser_Recombinase; cd00338
759913004058	catalytic residues [active]
759913004059	catalytic nucleophile [active]
759913004060	Recombinase; Region: Recombinase; pfam07508
759913004061	Recombinase zinc beta ribbon domain; Region: Zn_ribbon_recom; pfam13408
759913004062	RNA polymerase sigma factor, sigma-70 family; Region: sigma70-ECF; TIGR02937
759913004063	Transposase DDE domain; Region: DDE_Tnp_1; pfam01609
759913004064	Transposase DDE domain; Region: DDE_Tnp_1_3; pfam13612
759913004065	Na+-driven multidrug efflux pump [Defense mechanisms]; Region: NorM; COG0534
759913004066	Subfamily of the multidrug and toxic compound extrusion (MATE)-like proteins similar to Streptococcus aureus MepA; Region: MATE_MepA_like; cd13143
759913004067	ATPase components of various ABC-type transport systems, contain duplicated ATPase [General function prediction only]; Region: COG1123
759913004068	First domain of the ATP-binding cassette component of cobalt transport system; Region: ABC_cobalt_CbiO_domain1; cd03225
759913004069	Walker A/P-loop; other site
759913004070	ATP binding site [chemical binding]; other site
759913004071	Q-loop/lid; other site
759913004072	ABC transporter signature motif; other site
759913004073	Walker B; other site
759913004074	D-loop; other site
759913004075	H-loop/switch region; other site
759913004076	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
759913004077	Walker A/P-loop; other site
759913004078	ATP binding site [chemical binding]; other site
759913004079	Q-loop/lid; other site
759913004080	ABC transporter signature motif; other site
759913004081	Walker B; other site
759913004082	D-loop; other site
759913004083	H-loop/switch region; other site
759913004084	ABC-type cobalt transport system, permease component CbiQ and related transporters [Inorganic ion transport and metabolism]; Region: CbiQ; COG0619
759913004085	Hypothetical bacterial integral membrane protein (Trep_Strep); Region: Trep_Strep; pfam09605
759913004086	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
759913004087	ABC-type multidrug transport system, ATPase and permease components [Defense mechanisms]; Region: MdlB; COG1132
759913004088	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
759913004089	Walker A/P-loop; other site
759913004090	ATP binding site [chemical binding]; other site
759913004091	Q-loop/lid; other site
759913004092	ABC transporter signature motif; other site
759913004093	Walker B; other site
759913004094	D-loop; other site
759913004095	H-loop/switch region; other site
759913004096	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
759913004097	ABC-type multidrug transport system, ATPase and permease components [Defense mechanisms]; Region: MdlB; COG1132
759913004098	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
759913004099	Walker A/P-loop; other site
759913004100	ATP binding site [chemical binding]; other site
759913004101	Q-loop/lid; other site
759913004102	ABC transporter signature motif; other site
759913004103	Walker B; other site
759913004104	D-loop; other site
759913004105	H-loop/switch region; other site
759913004106	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
759913004107	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
759913004108	Relaxase/Mobilisation nuclease domain; Region: Relaxase; pfam03432
759913004109	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
759913004110	ATP binding site [chemical binding]; other site
759913004111	putative Mg++ binding site [ion binding]; other site
759913004112	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
759913004113	nucleotide binding region [chemical binding]; other site
759913004114	ATP-binding site [chemical binding]; other site
759913004115	Domain of unknown function (DUF1837); Region: DUF1837; pfam08878
759913004116	Protein of unknown function (DUF2958); Region: DUF2958; pfam11171
759913004117	Methyltransferase domain; Region: Methyltransf_26; pfam13659
759913004118	DNA methylase [Transcription / DNA replication, recombination, and repair]; Region: COG4646
759913004119	DEAD-like helicases superfamily; Region: DEXDc; smart00487
759913004120	DNA methylase [Transcription / DNA replication, recombination, and repair]; Region: COG4646
759913004121	helicase superfamily c-terminal domain; Region: HELICc; smart00490
759913004122	nucleotide binding region [chemical binding]; other site
759913004123	ATP-binding site [chemical binding]; other site
759913004124	Predicted transcriptional regulator containing an HTH domain and an uncharacterized domain shared with the mammalian protein Schlafen [Transcription]; Region: COG2865
759913004125	Divergent AAA domain; Region: AAA_4; pfam04326
759913004126	ATP-dependent DNA helicase recG C-terminal; Region: HATPase_c_4; pfam13749
759913004127	Winged helix-turn-helix DNA-binding; Region: HTH_24; pfam13412
759913004128	putative DNA binding site [nucleotide binding]; other site
759913004129	putative Zn2+ binding site [ion binding]; other site
759913004130	DNA topoisomerase III; Provisional; Region: PRK07726
759913004131	TOPRIM_TopoIA_TopoIII: The topoisomerase-primase (TORPIM) domain found in members of the type IA family of DNA topoisomerases (Topo IA) similar to topoisomerase III. Type IA DNA topoisomerases remove (relax) negative supercoils in the DNA by: cleaving...; Region: TOPRIM_TopoIA_TopoIII; cd03362
759913004132	active site
759913004133	putative interdomain interaction site [polypeptide binding]; other site
759913004134	putative metal-binding site [ion binding]; other site
759913004135	putative nucleotide binding site [chemical binding]; other site
759913004136	DNA Topoisomerase, subtype IA; DNA-binding, ATP-binding and catalytic domain of bacterial DNA topoisomerases I and III, and eukaryotic DNA topoisomerase III and eubacterial and archael reverse gyrases. Topoisomerases clevage single or double stranded DNA...; Region: TOP1Ac; cd00186
759913004137	domain I; other site
759913004138	DNA binding groove [nucleotide binding]
759913004139	phosphate binding site [ion binding]; other site
759913004140	domain II; other site
759913004141	domain III; other site
759913004142	nucleotide binding site [chemical binding]; other site
759913004143	catalytic site [active]
759913004144	domain IV; other site
759913004145	Transposase; Region: HTH_Tnp_1; pfam01527
759913004146	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG2963
759913004147	HTH-like domain; Region: HTH_21; pfam13276
759913004148	Integrase core domain; Region: rve; pfam00665
759913004149	Integrase core domain; Region: rve_3; pfam13683
759913004150	AAA-like domain; Region: AAA_10; pfam12846
759913004151	Domain of unknown function DUF87; Region: DUF87; pfam01935
759913004152	PrgI family protein; Region: PrgI; pfam12666
759913004153	Maff2 family; Region: Maff2; pfam12750
759913004154	Type IV secretory system Conjugative DNA transfer; Region: T4SS-DNA_transf; pfam02534
759913004155	TraM recognition site of TraD and TraG; Region: TraG-D_C; pfam12696
759913004156	Protein of unknown function (DUF3801); Region: DUF3801; pfam12687
759913004157	Uncharacterized conserved protein [Function unknown]; Region: COG1479
759913004158	Protein of unknown function DUF262; Region: DUF262; pfam03235
759913004159	Protein of unknown function (DUF1524); Region: DUF1524; pfam07510
759913004160	Site-specific recombinases, DNA invertase Pin homologs [DNA replication, recombination, and repair]; Region: PinR; COG1961
759913004161	Serine Recombinase family, catalytic domain; a DNA binding domain may be present either N- or C-terminal to the catalytic domain. These enzymes perform site-specific recombination of DNA molecules by a concerted, four-strand cleavage and rejoining...; Region: Ser_Recombinase; cd00338
759913004162	catalytic residues [active]
759913004163	catalytic nucleophile [active]
759913004164	Recombinase; Region: Recombinase; pfam07508
759913004165	Recombinase zinc beta ribbon domain; Region: Zn_ribbon_recom; pfam13408
759913004166	Site-specific recombinases, DNA invertase Pin homologs [DNA replication, recombination, and repair]; Region: PinR; COG1961
759913004167	Serine Recombinase family, catalytic domain; a DNA binding domain may be present either N- or C-terminal to the catalytic domain. These enzymes perform site-specific recombination of DNA molecules by a concerted, four-strand cleavage and rejoining...; Region: Ser_Recombinase; cd00338
759913004168	catalytic residues [active]
759913004169	catalytic nucleophile [active]
759913004170	Recombinase; Region: Recombinase; pfam07508
759913004171	Recombinase zinc beta ribbon domain; Region: Zn_ribbon_recom; pfam13408
759913004172	N-acetylmuramoyl-L-alanine amidase or MurNAc-LAA (also known as peptidoglycan aminohydrolase, NAMLA amidase, NAMLAA, Amidase 3, and peptidoglycan amidase; EC 3.5.1.28) is an autolysin that hydrolyzes the amide bond between N-acetylmuramoyl and L-amino...; Region: MurNAc-LAA; cd02696
759913004173	active site
759913004174	metal binding site [ion binding]; metal-binding site
759913004175	Lysine Motif is a small domain involved in binding peptidoglycan; Region: LysM; cd00118
759913004176	CHAP domain; Region: CHAP; cl17642
759913004177	Holin family; Region: Phage_holin_4; pfam05105
759913004178	Prophage endopeptidase tail; Region: Prophage_tail; cl12123
759913004179	gp58-like protein; Region: Gp58; pfam07902
759913004180	Phage-related protein [Function unknown]; Region: COG4722
759913004181	membrane protein P6; Region: PHA01399
759913004182	Phage-related minor tail protein [Function unknown]; Region: COG5280
759913004183	chromosome segregation protein SMC, common bacterial type; Region: SMC_prok_B; TIGR02168
759913004184	phage major tail protein, phi13 family; Region: maj_tail_phi13; TIGR01603
759913004185	Phage head-tail joining protein; Region: Phage_H_T_join; pfam05521
759913004186	Head-Tail Connector Protein gp6 of Bacteriophage HK97 and similar proteins; Region: gp6; cd08054
759913004187	oligomerization interface [polypeptide binding]; other site
759913004188	phage major capsid protein, HK97 family; Region: major_cap_HK97; TIGR01554
759913004189	Phage capsid family; Region: Phage_capsid; pfam05065
759913004190	Caseinolytic protease (ClpP) is an ATP-dependent, highly conserved serine protease; Region: S14_ClpP_1; cd07016
759913004191	oligomer interface [polypeptide binding]; other site
759913004192	active site residues [active]
759913004193	Phage-related protein [Function unknown]; Region: COG4695
759913004194	Phage portal protein; Region: Phage_portal; pfam04860
759913004195	Catalytic domain of glycoside hydrolase (GH) families 38 and 57, lactam utilization protein LamB/YcsF family proteins, YdjC-family proteins, and similar proteins; Region: GH38-57_N_LamB_YdjC_SF; cl17191
759913004196	Plasmid stabilization system protein [General function prediction only]; Region: ParE; COG3668
759913004197	RelB antitoxin; Region: RelB; cl01171
759913004198	Phage terminase-like protein, large subunit [General function prediction only]; Region: COG4626
759913004199	Phage terminase, small subunit; Region: Terminase_4; pfam05119
759913004200	Site-specific DNA methylase [DNA replication, recombination, and repair]; Region: Dcm; COG0270
759913004201	Cytosine-C5 specific DNA methylases; Methyl transfer reactions play an important role in many aspects of biology. Cytosine-specific DNA methylases are found both in prokaryotes and eukaryotes. DNA methylation, or the covalent addition of a methyl group...; Region: Cyt_C5_DNA_methylase; cd00315
759913004202	cofactor binding site; other site
759913004203	DNA binding site [nucleotide binding]
759913004204	substrate interaction site [chemical binding]; other site
759913004205	Cytosine-C5 specific DNA methylases; Methyl transfer reactions play an important role in many aspects of biology. Cytosine-specific DNA methylases are found both in prokaryotes and eukaryotes. DNA methylation, or the covalent addition of a methyl group...; Region: Cyt_C5_DNA_methylase; cd00315
759913004206	Stage 0 sporulation protein J (antagonist of Soj) containing ParB-like nuclease domain [Transcription]; Region: Spo0J; COG1475
759913004207	ParB-like nuclease domain; Region: ParB; smart00470
759913004208	DNA modification methylase [DNA replication, recombination, and repair]; Region: COG0863
759913004209	DNA methylase; Region: N6_N4_Mtase; pfam01555
759913004210	methionine aminopeptidase; Provisional; Region: PLN03158
759913004211	HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cd00085
759913004212	active site
759913004213	S-adenosylmethionine synthetase; Provisional; Region: PRK12459
759913004214	S-adenosylmethionine synthetase, N-terminal domain; Region: S-AdoMet_synt_N; pfam00438
759913004215	S-adenosylmethionine synthetase, central domain; Region: S-AdoMet_synt_M; pfam02772
759913004216	S-adenosylmethionine synthetase, C-terminal domain; Region: S-AdoMet_synt_C; pfam02773
759913004217	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
759913004218	Superfamily II DNA/RNA helicases, SNF2 family [Transcription / DNA replication, recombination, and repair]; Region: HepA; COG0553
759913004219	ATP binding site [chemical binding]; other site
759913004220	putative Mg++ binding site [ion binding]; other site
759913004221	VRR-NUC domain; Region: VRR_NUC; pfam08774
759913004222	Primase C terminal 1 (PriCT-1); Region: PriCT_1; smart00942
759913004223	D5 N terminal like; Region: D5_N; pfam08706
759913004224	phage/plasmid primase, P4 family, C-terminal domain; Region: primase_Cterm; TIGR01613
759913004225	Protein of unknown function (DUF2800); Region: DUF2800; pfam10926
759913004226	Protein of unknown function (DUF2815); Region: DUF2815; pfam10991
759913004227	Polymerase I functions primarily to fill DNA gaps that arise during DNA repair, recombination and replication; Region: DNA_pol_A_pol_I_A; cd08642
759913004228	active site
759913004229	DNA binding site [nucleotide binding]
759913004230	catalytic site [active]
759913004231	LlaJI restriction endonuclease; Region: RE_LlaJI; pfam09563
759913004232	GTPase subunit of restriction endonuclease [Defense mechanisms]; Region: McrB; COG1401
759913004233	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cl17189
759913004234	Site-specific DNA methylase [DNA replication, recombination, and repair]; Region: Dcm; COG0270
759913004235	Cytosine-C5 specific DNA methylases; Methyl transfer reactions play an important role in many aspects of biology. Cytosine-specific DNA methylases are found both in prokaryotes and eukaryotes. DNA methylation, or the covalent addition of a methyl group...; Region: Cyt_C5_DNA_methylase; cd00315
759913004236	cofactor binding site; other site
759913004237	DNA binding site [nucleotide binding]
759913004238	substrate interaction site [chemical binding]; other site
759913004239	Cytosine-C5 specific DNA methylases; Methyl transfer reactions play an important role in many aspects of biology. Cytosine-specific DNA methylases are found both in prokaryotes and eukaryotes. DNA methylation, or the covalent addition of a methyl group...; Region: Cyt_C5_DNA_methylase; cd00315
759913004240	C-5 cytosine-specific DNA methylase; Region: DNA_methylase; pfam00145
759913004241	Cytosine-C5 specific DNA methylases; Methyl transfer reactions play an important role in many aspects of biology. Cytosine-specific DNA methylases are found both in prokaryotes and eukaryotes. DNA methylation, or the covalent addition of a methyl group...; Region: Cyt_C5_DNA_methylase; cd00315
759913004242	cofactor binding site; other site
759913004243	DNA binding site [nucleotide binding]
759913004244	substrate interaction site [chemical binding]; other site
759913004245	Cytosine-C5 specific DNA methylases; Methyl transfer reactions play an important role in many aspects of biology. Cytosine-specific DNA methylases are found both in prokaryotes and eukaryotes. DNA methylation, or the covalent addition of a methyl group...; Region: Cyt_C5_DNA_methylase; cd00315
759913004246	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
759913004247	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
759913004248	non-specific DNA binding site [nucleotide binding]; other site
759913004249	salt bridge; other site
759913004250	sequence-specific DNA binding site [nucleotide binding]; other site
759913004251	HTH-like domain; Region: HTH_21; pfam13276
759913004252	Integrase core domain; Region: rve; pfam00665
759913004253	Integrase core domain; Region: rve_3; pfam13683
759913004254	Transposase; Region: HTH_Tnp_1; pfam01527
759913004255	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG2963
759913004256	Predicted transcriptional regulator [Transcription]; Region: COG2932
759913004257	Peptidase S24 LexA-like proteins are involved in the SOS response leading to the repair of single-stranded DNA within the bacterial cell. This family includes: the lambda repressor CI/C2 family and related bacterial prophage repressor proteins; LexA (EC...; Region: S24_LexA-like; cd06529
759913004258	Catalytic site [active]
759913004259	DNA polymerase IV; Reviewed; Region: PRK03103
759913004260	umuC subunit of DNA Polymerase V; Region: PolY_Pol_V_umuC; cd01700
759913004261	active site
759913004262	DNA binding site [nucleotide binding]
759913004263	YolD-like protein; Region: YolD; pfam08863
759913004264	Protein of unknown function (DUF1643); Region: DUF1643; cl01787
759913004265	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cl17189
759913004266	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cl17189
759913004267	Predicted transcriptional regulator [Transcription]; Region: COG2378
759913004268	WYL domain; Region: WYL; pfam13280
759913004269	DnaB-like helicase C terminal domain; Region: DnaB_C; pfam03796
759913004270	DnaB helicase C terminal domain. The hexameric helicase DnaB unwinds the DNA duplex at the  chromosome replication fork. Although the mechanism by which DnaB both couples ATP hydrolysis to translocation along DNA and denatures the duplex is unknown, a...; Region: DnaB_C; cd00984
759913004271	Walker A motif; other site
759913004272	ATP binding site [chemical binding]; other site
759913004273	Walker B motif; other site
759913004274	DNA binding loops [nucleotide binding]
759913004275	SAM-dependent methyltransferases related to tRNA (uracil-5-)-methyltransferase [Translation, ribosomal structure and biogenesis]; Region: TrmA; COG2265
759913004276	TRAM domain; Region: TRAM; pfam01938
759913004277	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
759913004278	S-adenosylmethionine binding site [chemical binding]; other site
759913004279	Transcriptional regulator [Transcription]; Region: LytR; COG1316
759913004280	shikimate kinase; Reviewed; Region: aroK; PRK00131
759913004281	Shikimate kinase (SK) is the fifth enzyme in the shikimate pathway, a seven-step biosynthetic pathway which converts erythrose-4-phosphate to chorismic acid, found in bacteria, fungi and plants. Chorismic acid is a important intermediate in the synthesis...; Region: SK; cd00464
759913004282	ADP binding site [chemical binding]; other site
759913004283	magnesium binding site [ion binding]; other site
759913004284	putative shikimate binding site; other site
759913004285	3-phosphoshikimate 1-carboxyvinyltransferase; Provisional; Region: PRK02427
759913004286	EPSP synthase domain. 3-phosphoshikimate 1-carboxyvinyltransferase (5-enolpyruvylshikimate-3-phosphate synthase) (EC 2.5.1.19) catalyses the reaction between shikimate-3-phosphate (S3P) and phosphoenolpyruvate (PEP) to form...; Region: EPSP_synthase; cd01556
759913004287	hinge; other site
759913004288	active site
759913004289	Ribonuclease BN family enzyme [Replication, recombination, and repair]; Region: Rbn; COG1295
759913004290	Methionine Aminopeptidase 1. E.C. 3.4.11.18. Also known as methionyl aminopeptidase and Peptidase M. Catalyzes release of N-terminal amino acids, preferentially methionine, from peptides and arylamides; Region: MetAP1; cd01086
759913004291	active site
759913004292	Predicted transcriptional regulator containing CBS domains [Transcription]; Region: COG4109
759913004293	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
759913004294	DNA-binding site [nucleotide binding]; DNA binding site
759913004295	DRTGG domain; Region: DRTGG; pfam07085
759913004296	This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domains associated with a DRTGG domain upstream. The function of the DRTGG domain, named after its conserved residues, is unknown. CBS is a small domain originally...; Region: CBS_pair_DRTGG_assoc; cd04596
759913004297	The hotdog fold was initially identified in the E. coli FabA (beta-hydroxydecanoyl-acyl carrier protein (ACP)-dehydratase) structure and subsequently in 4HBT (4-hydroxybenzoyl-CoA thioesterase) from Pseudomonas. A number of other seemingly unrelated...; Region: hot_dog; cd03440
759913004298	active site 2 [active]
759913004299	active site 1 [active]
759913004300	Acetyltransferase (GNAT) domain; Region: Acetyltransf_3; pfam13302
759913004301	Acetyltransferase (GNAT) family; Region: Acetyltransf_1; pfam00583
759913004302	Gram-positive signal peptide, YSIRK family; Region: YSIRK_signal; TIGR01168
759913004303	GA module; Region: GA; cl08325
759913004304	GA module; Region: GA; pfam01468
759913004305	GA module; Region: GA; pfam01468
759913004306	B domain; Region: IgG_binding_B; pfam01378
759913004307	B domain; Region: IgG_binding_B; pfam01378
759913004308	Beta-glucosidase-related glycosidases [Carbohydrate transport and metabolism]; Region: BglX; COG1472
759913004309	Glycosyl hydrolase family 3 N terminal domain; Region: Glyco_hydro_3; cl07971
759913004310	Predicted phosphatases [General function prediction only]; Region: Gph; COG0546
759913004311	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
759913004312	motif II; other site
759913004313	D-mannonate oxidoreductase; Provisional; Region: PRK08277
759913004314	putative D-mannonate oxidoreductase, classical (c) SDR; Region: mannonate_red_SDR_c; cd08935
759913004315	putative NAD(P) binding site [chemical binding]; other site
759913004316	active site
759913004317	mannonate dehydratase; Provisional; Region: PRK03906
759913004318	mannonate dehydratase; Region: uxuA; TIGR00695
759913004319	Glucuronate isomerase; Region: UxaC; pfam02614
759913004320	Glucuronate isomerase [Carbohydrate transport and metabolism]; Region: UxaC; COG1904
759913004321	Glucuronate isomerase; Region: UxaC; cl00829
759913004322	2-keto-3-deoxy-6-phosphogluconate aldolase [Carbohydrate transport and metabolism]; Region: Eda; COG0800
759913004323	KDPG and KHG aldolase; Region: KDPG_aldolase; cd00452
759913004324	active site
759913004325	intersubunit interface [polypeptide binding]; other site
759913004326	catalytic residue [active]
759913004327	Transcriptional regulators [Transcription]; Region: FadR; COG2186
759913004328	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
759913004329	DNA-binding site [nucleotide binding]; DNA binding site
759913004330	FCD domain; Region: FCD; pfam07729
759913004331	beta-D-glucuronidase; Provisional; Region: PRK10150
759913004332	Glycosyl hydrolases family 2, sugar binding domain; Region: Glyco_hydro_2_N; pfam02837
759913004333	Glycosyl hydrolases family 2; Region: Glyco_hydro_2; pfam00703
759913004334	Glycosyl hydrolases family 2, TIM barrel domain; Region: Glyco_hydro_2_C; pfam02836
759913004335	2-keto-3-deoxygluconate kinase (KdgK) phosphorylates 2-keto-3-deoxygluconate (KDG) to form 2-keto-3-deoxy-6-phosphogluconate (KDGP). KDG is the common intermediate product, that allows organisms to channel D-glucuronate and/or D-galacturinate into the...; Region: KdgK; cd01166
759913004336	substrate binding site [chemical binding]; other site
759913004337	Sugar kinases, ribokinase family [Carbohydrate transport and metabolism]; Region: RbsK; COG0524
759913004338	ATP binding site [chemical binding]; other site
759913004339	ribokinase/pfkB superfamily: Kinases that accept a wide variety of substrates, including carbohydrates and aromatic small molecules, all are phosphorylated at a hydroxyl group. The superfamily includes ribokinase, fructokinase, ketohexokinase; Region: ribokinase_pfkB_like; cl00192
759913004340	MFS/sugar transport protein; Region: MFS_2; pfam13347
759913004341	melibiose:sodium symporter; Provisional; Region: PRK10429; cl15392
759913004342	UDP-N-acetylglucosamine 1-carboxyvinyltransferase; Region: murA; TIGR01072
759913004343	UDP-N-acetylglucosamine enolpyruvyl transferase catalyzes enolpyruvyl transfer as part of the first step in the biosynthesis of peptidoglycan, a component of the bacterial cell wall. The reaction is phosphoenolpyruvate + UDP-N-acetyl-D-glucosamine =...; Region: UdpNAET; cd01555
759913004344	hinge; other site
759913004345	active site
759913004346	S-adenosylmethionine synthetase; Validated; Region: PRK05250
759913004347	S-adenosylmethionine synthetase, N-terminal domain; Region: S-AdoMet_synt_N; pfam00438
759913004348	S-adenosylmethionine synthetase, central domain; Region: S-AdoMet_synt_M; pfam02772
759913004349	S-adenosylmethionine synthetase, C-terminal domain; Region: S-AdoMet_synt_C; pfam02773
759913004350	streptococcal histidine triad protein; Region: strep_his_triad; TIGR01363
759913004351	Streptococcal histidine triad protein; Region: Strep_his_triad; pfam04270
759913004352	Leucine Rich repeats (2 copies); Region: LRR_4; pfam12799
759913004353	Leucine-rich repeats (LRRs), ribonuclease inhibitor (RI)-like subfamily. LRRs are 20-29 residue sequence motifs present in many proteins that participate in protein-protein interactions and have different functions and cellular locations. LRRs correspond...; Region: LRR_RI; cl15309
759913004354	Leucine Rich repeats (2 copies); Region: LRR_4; pfam12799
759913004355	Leucine Rich repeats (2 copies); Region: LRR_4; pfam12799
759913004356	Leucine Rich repeats (2 copies); Region: LRR_4; pfam12799
759913004357	Leucine Rich repeats (2 copies); Region: LRR_4; pfam12799
759913004358	Leucine Rich repeats (2 copies); Region: LRR_4; pfam12799
759913004359	Biotin operon repressor [Transcription]; Region: BirA; COG1654
759913004360	bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor; Provisional; Region: PRK11886
759913004361	Biotin/lipoate A/B protein ligase family; Region: BPL_LplA_LipB; pfam03099
759913004362	Biotin protein ligase C terminal domain; Region: BPL_C; pfam02237
759913004363	Protein of unknown function (DUF3272); Region: DUF3272; pfam11676
759913004364	DNA polymerase III subunits gamma and tau; Validated; Region: PRK05563
759913004365	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
759913004366	Walker A motif; other site
759913004367	ATP binding site [chemical binding]; other site
759913004368	Walker B motif; other site
759913004369	arginine finger; other site
759913004370	DNA polymerase III subunits gamma and tau domain III; Region: DNA_pol3_gamma3; pfam12169
759913004371	GAF domain-containing protein [Signal transduction mechanisms]; Region: COG1956
759913004372	Membrane proteinase, regulator of anti-sigma factor [Posttranslational modification, protein turnover, chaperones]; Region: prsW; COG2339
759913004373	Protein of unknown function (DUF1294); Region: DUF1294; pfam06961
759913004374	Uridine kinase [Nucleotide transport and metabolism]; Region: Udk; COG0572
759913004375	Uridine monophosphate kinase (UMPK, EC 2.7.1.48), also known as uridine kinase or uridine-cytidine kinase (UCK), catalyzes the reversible phosphoryl transfer from ATP to uridine or cytidine to yield UMP or CMP. In the primidine nucleotide-salvage pathway; Region: UMPK; cd02023
759913004376	Sugar specificity; other site
759913004377	Pyrimidine base specificity; other site
759913004378	ATP-binding site [chemical binding]; other site
759913004379	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cl17251
759913004380	DEAD-like helicases superfamily; Region: DEXDc; smart00487
759913004381	ATP binding site [chemical binding]; other site
759913004382	putative Mg++ binding site [ion binding]; other site
759913004383	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
759913004384	nucleotide binding region [chemical binding]; other site
759913004385	ATP-binding site [chemical binding]; other site
759913004386	delta-lactam-biosynthetic de-N-acetylase; Region: spore_pdaA; TIGR02884
759913004387	Catalytic NodB homology domain of Streptococcus pneumoniae peptidoglycan deacetylase PgdA, Bacillus subtilis BsYjeA protein, and their bacterial homologs; Region: CE4_SpPgdA_BsYjeA_like; cd10947
759913004388	NodB motif; other site
759913004389	active site
759913004390	catalytic site [active]
759913004391	Zn binding site [ion binding]; other site
759913004392	NADP+-dependent non-phosphorylating glyceraldehyde 3-phosphate dehydrogenase and ALDH family 11; Region: ALDH_F11_NP-GAPDH; cd07082
759913004393	NADP-dependent glyceraldehyde-3-phosphate dehydrogenase; Provisional; Region: PLN00412
759913004394	tetrameric interface [polypeptide binding]; other site
759913004395	activator binding site; other site
759913004396	NADP binding site [chemical binding]; other site
759913004397	substrate binding site [chemical binding]; other site
759913004398	catalytic residues [active]
759913004399	Phosphoenolpyruvate-protein kinase (PTS system EI component in bacteria) [Carbohydrate transport and metabolism]; Region: PtsA; COG1080
759913004400	PEP-utilising enzyme, N-terminal; Region: PEP-utilisers_N; pfam05524
759913004401	PEP-utilising enzyme, mobile domain; Region: PEP-utilizers; pfam00391
759913004402	PEP-utilising enzyme, TIM barrel domain; Region: PEP-utilizers_C; pfam02896
759913004403	Histidine-containing phosphocarrier protein (HPr)-like proteins. HPr is a central component of the bacterial phosphoenolpyruvate sugar phosphotransferase system (PTS). The PTS catalyses the phosphorylation of sugar substrates during their translocation...; Region: PTS-HPr_like; cd00367
759913004404	dimerization domain swap beta strand [polypeptide binding]; other site
759913004405	regulatory protein interface [polypeptide binding]; other site
759913004406	active site
759913004407	regulatory phosphorylation site [posttranslational modification]; other site
759913004408	NrdH-redoxin (NrdH) family; NrdH is a small monomeric protein with a conserved redox active CXXC motif within a TRX fold, characterized by a glutaredoxin (GRX)-like sequence and TRX-like activity profile. In vitro, it displays protein disulfide reductase...; Region: NrdH; cd02976
759913004409	catalytic residues [active]
759913004410	ribonucleotide-diphosphate reductase subunit alpha; Validated; Region: PRK07306
759913004411	Ribonucleotide reductase N-terminal; Region: RNR_N; pfam08343
759913004412	Class I ribonucleotide reductase; Region: RNR_I; cd01679
759913004413	active site
759913004414	dimer interface [polypeptide binding]; other site
759913004415	catalytic residues [active]
759913004416	effector binding site; other site
759913004417	R2 peptide binding site; other site
759913004418	ribonucleotide-diphosphate reductase subunit beta; Provisional; Region: nrdF2; PRK13966
759913004419	Ribonucleotide Reductase, R2/beta subunit, ferritin-like diiron-binding domain; Region: RNRR2; cd01049
759913004420	dimer interface [polypeptide binding]; other site
759913004421	putative radical transfer pathway; other site
759913004422	diiron center [ion binding]; other site
759913004423	tyrosyl radical; other site
759913004424	Chloride channel protein EriC [Inorganic ion transport and metabolism]; Region: EriC; COG0038
759913004425	Putative ClC chloride channel.  Clc proteins are putative halogen ion (Cl-, Br- and I-) transporters found in eubacteria. They belong to the ClC superfamily of halogen ion channels, which share a unique double-barreled architecture and voltage-dependent...; Region: ClC_like; cd01033
759913004426	putative ion selectivity filter; other site
759913004427	putative pore gating glutamate residue; other site
759913004428	CAAX protease self-immunity; Region: Abi; pfam02517
759913004429	Protein of unknown function (DUF3169); Region: DUF3169; pfam11368
759913004430	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
759913004431	non-specific DNA binding site [nucleotide binding]; other site
759913004432	salt bridge; other site
759913004433	sequence-specific DNA binding site [nucleotide binding]; other site
759913004434	Protein of unknown function (DUF3267); Region: DUF3267; pfam11667
759913004435	alanyl-tRNA synthetase; Reviewed; Region: alaS; PRK00252
759913004436	Alanyl-tRNA synthetase (AlaRS) class II core catalytic domain. AlaRS is a homodimer. It is responsible for the attachment of alanine to the 3' OH group of ribose of the appropriate tRNA. This domain is primarily responsible for ATP-dependent...; Region: AlaRS_core; cd00673
759913004437	motif 1; other site
759913004438	active site
759913004439	motif 2; other site
759913004440	motif 3; other site
759913004441	Threonyl and Alanyl tRNA synthetase second additional domain; Region: tRNA_SAD; smart00863
759913004442	DHHA1 domain; Region: DHHA1; pfam02272
759913004443	foldase protein PrsA; Reviewed; Region: prsA; PRK01326
759913004444	GH3 auxin-responsive promoter; Region: GH3; pfam03321
759913004445	PPIC-type PPIASE domain; Region: Rotamase_2; cl08278
759913004446	Predicted O-methyltransferase [General function prediction only]; Region: COG4122
759913004447	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
759913004448	S-adenosylmethionine binding site [chemical binding]; other site
759913004449	oxalate/formate antiporter family transporter; Region: 2A0111; TIGR00890
759913004450	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
759913004451	putative substrate translocation pore; other site
759913004452	Predicted phosphatases [General function prediction only]; Region: Gph; COG0546
759913004453	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
759913004454	motif II; other site
759913004455	Acetyltransferase (GNAT) domain; Region: Acetyltransf_3; pfam13302
759913004456	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
759913004457	Coenzyme A binding pocket [chemical binding]; other site
759913004458	Predicted flavoprotein [General function prediction only]; Region: COG0431
759913004459	NADPH-dependent FMN reductase; Region: FMN_red; pfam03358
759913004460	Oligoendopeptidase F [Amino acid transport and metabolism]; Region: COG1164
759913004461	Peptidase family M3B Oligopeptidase F (PepF); Region: M3B_PepF_3; cd09608
759913004462	active site
759913004463	Zn binding site [ion binding]; other site
759913004464	Competence protein CoiA-like family; Region: CoiA; cl11541
759913004465	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
759913004466	Major Facilitator Superfamily; Region: MFS_1; pfam07690
759913004467	putative substrate translocation pore; other site
759913004468	16S rRNA uridine-516 pseudouridylate synthase and related pseudouridylate synthases [Translation, ribosomal structure and biogenesis]; Region: RsuA; COG1187
759913004469	S4/Hsp/ tRNA synthetase RNA-binding domain; The domain surface is populated by conserved, charged residues that define a likely RNA-binding site;  Found in stress proteins, ribosomal proteins and tRNA synthetases; This may imply a hitherto unrecognized...; Region: S4; cd00165
759913004470	RNA binding surface [nucleotide binding]; other site
759913004471	Pseudouridine synthase, Escherichia coli RsuA like; Region: PseudoU_synth_RsuA; cd02553
759913004472	active site
759913004473	uracil binding [chemical binding]; other site
759913004474	6-phosphogluconolactonase/Glucosamine-6-phosphate isomerase/deaminase [Carbohydrate transport and metabolism]; Region: NagB; COG0363
759913004475	GlcN6P_deaminase: Glucosamine-6-phosphate (GlcN6P) deaminase subfamily; GlcN6P deaminase catalyzes the reversible conversion of GlcN6P to D-fructose-6-phosphate (Fru6P) and ammonium. The reaction is an aldo-keto isomerization coupled with an amination or...; Region: GlcN6P_deaminase; cd01399
759913004476	active site
759913004477	trimer interface [polypeptide binding]; other site
759913004478	allosteric site; other site
759913004479	active site lid [active]
759913004480	hexamer (dimer of trimers) interface [polypeptide binding]; other site
759913004481	S-adenosylmethionine:tRNA ribosyltransferase-isomerase; Provisional; Region: queA; PRK00147
759913004482	S-adenosylmethionine:tRNA ribosyltransferase-isomerase; Region: queA; TIGR00113
759913004483	Protein of unknown function (DUF3114); Region: DUF3114; pfam11311
759913004484	Beta-lactamase enzyme family; Region: Beta-lactamase2; pfam13354
759913004485	Superoxide dismutase [Inorganic ion transport and metabolism]; Region: SodA; COG0605
759913004486	Iron/manganese superoxide dismutases, alpha-hairpin domain; Region: Sod_Fe_N; pfam00081
759913004487	Iron/manganese superoxide dismutases, C-terminal domain; Region: Sod_Fe_C; pfam02777
759913004488	DNA polymerase III subunit delta; Reviewed; Region: holA; PRK05574
759913004489	DNA polymerase III, delta subunit; Region: DNA_pol3_delta; pfam06144
759913004490	Predicted hydrolase (metallo-beta-lactamase superfamily) [General function prediction only]; Region: ComEC; COG2333
759913004491	Metallo-beta-lactamase superfamily; Region: Lactamase_B; smart00849
759913004492	phage-related chromosomal island (PRCI) 2
759913004493	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
759913004494	Walker A motif; other site
759913004495	ATP binding site [chemical binding]; other site
759913004496	Walker B motif; other site
759913004497	Site-specific recombinases, DNA invertase Pin homologs [DNA replication, recombination, and repair]; Region: PinR; COG1961
759913004498	Serine Recombinase family, catalytic domain; a DNA binding domain may be present either N- or C-terminal to the catalytic domain. These enzymes perform site-specific recombination of DNA molecules by a concerted, four-strand cleavage and rejoining...; Region: Ser_Recombinase; cd00338
759913004499	catalytic residues [active]
759913004500	catalytic nucleophile [active]
759913004501	Recombinase; Region: Recombinase; pfam07508
759913004502	Recombinase zinc beta ribbon domain; Region: Zn_ribbon_recom; pfam13408
759913004503	Site-specific recombinases, DNA invertase Pin homologs [DNA replication, recombination, and repair]; Region: PinR; COG1961
759913004504	Serine Recombinase family, catalytic domain; a DNA binding domain may be present either N- or C-terminal to the catalytic domain. These enzymes perform site-specific recombination of DNA molecules by a concerted, four-strand cleavage and rejoining...; Region: Ser_Recombinase; cd00338
759913004505	catalytic residues [active]
759913004506	catalytic nucleophile [active]
759913004507	Recombinase; Region: Recombinase; pfam07508
759913004508	Recombinase zinc beta ribbon domain; Region: Zn_ribbon_recom; pfam13408
759913004509	N-acetylmuramoyl-L-alanine amidase or MurNAc-LAA (also known as peptidoglycan aminohydrolase, NAMLA amidase, NAMLAA, Amidase 3, and peptidoglycan amidase; EC 3.5.1.28) is an autolysin that hydrolyzes the amide bond between N-acetylmuramoyl and L-amino...; Region: MurNAc-LAA; cd02696
759913004510	active site
759913004511	metal binding site [ion binding]; metal-binding site
759913004512	Lysine Motif is a small domain involved in binding peptidoglycan; Region: LysM; cd00118
759913004513	CHAP domain; Region: CHAP; cl17642
759913004514	Holin family; Region: Phage_holin_4; pfam05105
759913004515	Siphovirus protein of unknown function (DUF859); Region: DUF859; pfam05895
759913004516	Prophage endopeptidase tail; Region: Prophage_tail; cl12123
759913004517	Phage-related protein [Function unknown]; Region: COG4722
759913004518	Phage-related minor tail protein [Function unknown]; Region: COG5280
759913004519	Phage-related protein [Function unknown]; Region: COG5412
759913004520	phage major tail protein, phi13 family; Region: maj_tail_phi13; TIGR01603
759913004521	Phage head-tail joining protein; Region: Phage_H_T_join; pfam05521
759913004522	Head-Tail Connector Protein gp6 of Bacteriophage HK97 and similar proteins; Region: gp6; cd08054
759913004523	oligomerization interface [polypeptide binding]; other site
759913004524	phage major capsid protein, HK97 family; Region: major_cap_HK97; TIGR01554
759913004525	Phage capsid family; Region: Phage_capsid; pfam05065
759913004526	Clp protease; Region: CLP_protease; pfam00574
759913004527	Caseinolytic protease (ClpP) is an ATP-dependent, highly conserved serine protease; Region: S14_ClpP_1; cd07016
759913004528	oligomer interface [polypeptide binding]; other site
759913004529	active site residues [active]
759913004530	Phage-related protein [Function unknown]; Region: COG4695
759913004531	Phage portal protein; Region: Phage_portal; pfam04860
759913004532	Phage terminase-like protein, large subunit [General function prediction only]; Region: COG4626
759913004533	Phage terminase, small subunit; Region: Terminase_4; pfam05119
759913004534	Site-specific DNA methylase [DNA replication, recombination, and repair]; Region: Dcm; COG0270
759913004535	Cytosine-C5 specific DNA methylases; Methyl transfer reactions play an important role in many aspects of biology. Cytosine-specific DNA methylases are found both in prokaryotes and eukaryotes. DNA methylation, or the covalent addition of a methyl group...; Region: Cyt_C5_DNA_methylase; cd00315
759913004536	cofactor binding site; other site
759913004537	DNA binding site [nucleotide binding]
759913004538	substrate interaction site [chemical binding]; other site
759913004539	Cytosine-C5 specific DNA methylases; Methyl transfer reactions play an important role in many aspects of biology. Cytosine-specific DNA methylases are found both in prokaryotes and eukaryotes. DNA methylation, or the covalent addition of a methyl group...; Region: Cyt_C5_DNA_methylase; cd00315
759913004540	HNH endonuclease; Region: HNH_3; pfam13392
759913004541	AP2 domain; Region: AP2; pfam00847
759913004542	Stage 0 sporulation protein J (antagonist of Soj) containing ParB-like nuclease domain [Transcription]; Region: Spo0J; COG1475
759913004543	ParB-like nuclease domain; Region: ParB; smart00470
759913004544	DNA modification methylase [DNA replication, recombination, and repair]; Region: COG0863
759913004545	DNA methylase; Region: N6_N4_Mtase; pfam01555
759913004546	HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cd00085
759913004547	active site
759913004548	S-adenosylmethionine synthetase, C-terminal domain; Region: S-AdoMet_synt_C; pfam02773
759913004549	S-adenosylmethionine synthetase, central domain; Region: S-AdoMet_synt_M; pfam02772
759913004550	S-adenosylmethionine synthetase, C-terminal domain; Region: S-AdoMet_synt_C; pfam02773
759913004551	S-adenosylmethionine synthetase, N-terminal domain; Region: S-AdoMet_synt_N; pfam00438
759913004552	S-adenosylmethionine synthetase, central domain; Region: S-AdoMet_synt_M; pfam02772
759913004553	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
759913004554	Superfamily II DNA/RNA helicases, SNF2 family [Transcription / DNA replication, recombination, and repair]; Region: HepA; COG0553
759913004555	ATP binding site [chemical binding]; other site
759913004556	putative Mg++ binding site [ion binding]; other site
759913004557	VRR-NUC domain; Region: VRR_NUC; pfam08774
759913004558	Primase C terminal 1 (PriCT-1); Region: PriCT_1; smart00942
759913004559	D5 N terminal like; Region: D5_N; pfam08706
759913004560	phage/plasmid primase, P4 family, C-terminal domain; Region: primase_Cterm; TIGR01613
759913004561	Protein of unknown function (DUF2800); Region: DUF2800; pfam10926
759913004562	Protein of unknown function (DUF2815); Region: DUF2815; pfam10991
759913004563	Polymerase I functions primarily to fill DNA gaps that arise during DNA repair, recombination and replication; Region: DNA_pol_A_pol_I_A; cd08642
759913004564	active site
759913004565	DNA binding site [nucleotide binding]
759913004566	catalytic site [active]
759913004567	Domain of unknown function (DUF955); Region: DUF955; cl01076
759913004568	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
759913004569	LlaJI restriction endonuclease; Region: RE_LlaJI; pfam09563
759913004570	AAA domain (dynein-related subfamily); Region: AAA_5; pfam07728
759913004571	Adenine-specific DNA methylase [DNA replication, recombination, and repair]; Region: COG3392
759913004572	D12 class N6 adenine-specific DNA methyltransferase; Region: MethyltransfD12; cl17344
759913004573	D12 class N6 adenine-specific DNA methyltransferase; Region: MethyltransfD12; cl17344
759913004574	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
759913004575	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
759913004576	sequence-specific DNA binding site [nucleotide binding]; other site
759913004577	salt bridge; other site
759913004578	Peptidase S24 LexA-like proteins are involved in the SOS response leading to the repair of single-stranded DNA within the bacterial cell. This family includes: the lambda repressor CI/C2 family and related bacterial prophage repressor proteins; LexA (EC...; Region: S24_LexA-like; cd06529
759913004579	Predicted transcriptional regulator [Transcription]; Region: COG2932
759913004580	Catalytic site [active]
759913004581	DNA polymerase IV; Reviewed; Region: PRK03103
759913004582	umuC subunit of DNA Polymerase V; Region: PolY_Pol_V_umuC; cd01700
759913004583	active site
759913004584	DNA binding site [nucleotide binding]
759913004585	impB/mucB/samB family C-terminal; Region: IMS_C; pfam11799
759913004586	YolD-like protein; Region: YolD; pfam08863
759913004587	ATPase components of ABC transporters with duplicated ATPase domains [General function prediction only]; Region: Uup; COG0488
759913004588	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
759913004589	ABC transporter; Region: ABC_tran_2; pfam12848
759913004590	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
759913004591	H+ Antiporter protein; Region: 2A0121; TIGR00900
759913004592	Site-specific recombinases, DNA invertase Pin homologs [DNA replication, recombination, and repair]; Region: PinR; COG1961
759913004593	Serine Recombinase family, catalytic domain; a DNA binding domain may be present either N- or C-terminal to the catalytic domain. These enzymes perform site-specific recombination of DNA molecules by a concerted, four-strand cleavage and rejoining...; Region: Ser_Recombinase; cd00338
759913004594	catalytic residues [active]
759913004595	catalytic nucleophile [active]
759913004596	Recombinase; Region: Recombinase; pfam07508
759913004597	CpXC protein; Region: CpXC; pfam14353
759913004598	Predicted membrane metal-binding protein [General function prediction only]; Region: ComEC; COG0658
759913004599	Domain of unknown function (DUF4131); Region: DUF4131; pfam13567
759913004600	Competence protein; Region: Competence; pfam03772
759913004601	SLBB domain; Region: SLBB; pfam10531
759913004602	comEA protein; Region: comE; TIGR01259
759913004603	endonuclease III; includes endonuclease III (DNA-(apurinic or apyrimidinic site) lyase), alkylbase DNA glycosidases (Alka-family) and other DNA glycosidases; Region: ENDO3c; cl14786
759913004604	1-acyl-sn-glycerol-3-phosphate acyltransferase [Lipid metabolism]; Region: PlsC; COG0204
759913004605	Lysophospholipid Acyltransferases (LPLATs) of Glycerophospholipid Biosynthesis: AGPAT-like; Region: LPLAT_AGPAT-like; cd07989
759913004606	putative acyl-acceptor binding pocket; other site
759913004607	Predicted O-methyltransferase [General function prediction only]; Region: COG4123
759913004608	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
759913004609	S-adenosylmethionine binding site [chemical binding]; other site
759913004610	The GIY-YIG domain of uncharacterized protein family UPF0213 related to structure-specific endonuclease SLX1; Region: GIY-YIG_UPF0213; cd10456
759913004611	GIY-YIG motif/motif A; other site
759913004612	putative active site [active]
759913004613	putative metal binding site [ion binding]; other site
759913004614	K+ potassium transporter; Region: K_trans; cl15781
759913004615	helicase 45; Provisional; Region: PTZ00424
759913004616	DEAD-box helicases. A diverse family of proteins involved in ATP-dependent RNA unwinding, needed in a variety of cellular processes including splicing, ribosome biogenesis and RNA degradation. The name derives from the sequence of the Walker  B motif; Region: DEADc; cd00268
759913004617	ATP binding site [chemical binding]; other site
759913004618	Mg++ binding site [ion binding]; other site
759913004619	motif III; other site
759913004620	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
759913004621	nucleotide binding region [chemical binding]; other site
759913004622	ATP-binding site [chemical binding]; other site
759913004623	ABC-type metal ion transport system, periplasmic component/surface antigen [Inorganic ion transport and metabolism]; Region: NlpA; COG1464
759913004624	NLPA lipoprotein; Region: Lipoprotein_9; cl17547
759913004625	ABC-type metal ion transport system, permease component [Inorganic ion transport and metabolism]; Region: AbcD; COG2011
759913004626	dimer interface [polypeptide binding]; other site
759913004627	conserved gate region; other site
759913004628	putative PBP binding loops; other site
759913004629	ABC-ATPase subunit interface; other site
759913004630	ABC-type antimicrobial peptide transport system, ATPase component [Defense mechanisms]; Region: SalX; COG1136
759913004631	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
759913004632	Walker A/P-loop; other site
759913004633	ATP binding site [chemical binding]; other site
759913004634	Q-loop/lid; other site
759913004635	ABC transporter signature motif; other site
759913004636	Walker B; other site
759913004637	D-loop; other site
759913004638	H-loop/switch region; other site
759913004639	Pleckstrin homology (PH)-like domains in bacteria (PHb); Region: PH-like_bacteria; cd13225
759913004640	pentamer interface [polypeptide binding]; other site
759913004641	dodecaamer interface [polypeptide binding]; other site
759913004642	peptide chain release factor 3; Provisional; Region: prfC; PRK00741
759913004643	Release Factor 3 (RF3) protein involved in the terminal step of translocation in bacteria; Region: RF3; cd04169
759913004644	G1 box; other site
759913004645	putative GEF interaction site [polypeptide binding]; other site
759913004646	GTP/Mg2+ binding site [chemical binding]; other site
759913004647	Switch I region; other site
759913004648	G2 box; other site
759913004649	G3 box; other site
759913004650	Switch II region; other site
759913004651	G4 box; other site
759913004652	G5 box; other site
759913004653	RF3_II: this subfamily represents the domain II of bacterial Release Factor 3 (RF3). Termination of protein synthesis by the ribosome requires two release factor (RF) classes. The class II RF3 is a GTPase that removes class I RFs (RF1 or RF2) from the...; Region: RF3_II; cd03689
759913004654	conserved hypothetical integral membrane protein TIGR02206; Region: intg_mem_TP0381
759913004655	UDP-N-acetylmuramyl pentapeptide synthase [Cell envelope biogenesis, outer membrane]; Region: MurF; COG0770
759913004656	Mur ligase family, catalytic domain; Region: Mur_ligase; pfam01225
759913004657	Mur ligase middle domain; Region: Mur_ligase_M; pfam08245
759913004658	Mur ligase family, glutamate ligase domain; Region: Mur_ligase_C; pfam02875
759913004659	D-alanyl-alanine synthetase A; Reviewed; Region: ddl; PRK01966
759913004660	D-ala D-ala ligase N-terminus; Region: Dala_Dala_lig_N; pfam01820
759913004661	D-ala D-ala ligase C-terminus; Region: Dala_Dala_lig_C; pfam07478
759913004662	recombination protein RecR; Reviewed; Region: recR; PRK00076
759913004663	RecR protein; Region: RecR; pfam02132
759913004664	TOPRIM_recR: topoisomerase-primase (TOPRIM) nucleotidyl transferase/hydrolase domain of the type found in Escherichia coli RecR.  RecR participates in the RecFOR pathway of homologous recombinational repair in prokaryotes. This pathway provides a...; Region: TOPRIM_recR; cd01025
759913004665	putative active site [active]
759913004666	putative metal-binding site [ion binding]; other site
759913004667	tetramer interface [polypeptide binding]; other site
759913004668	Cell division protein FtsI/penicillin-binding protein 2 [Cell envelope biogenesis, outer membrane]; Region: FtsI; COG0768
759913004669	Penicillin-binding Protein dimerisation domain; Region: PBP_dimer; pfam03717
759913004670	Penicillin-binding Protein dimerisation domain; Region: PBP_dimer; pfam03717
759913004671	Penicillin binding protein transpeptidase domain; Region: Transpeptidase; pfam00905
759913004672	Formate/nitrite family of transporters [Inorganic ion transport and metabolism]; Region: FocA; COG2116
759913004673	Predicted small molecule binding protein (contains 3H domain) [General function prediction only]; Region: COG1827
759913004674	HTH domain; Region: HTH_11; pfam08279
759913004675	3H domain; Region: 3H; pfam02829
759913004676	Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067
759913004677	catalytic core [active]
759913004678	Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067
759913004679	dihydroorotate dehydrogenase (subfamily 1) family protein; Region: pyrD_sub1_fam; TIGR01037
759913004680	Dihydroorotate dehydrogenase (DHOD) class 1A FMN-binding domain. DHOD catalyzes the oxidation of (S)-dihydroorotate to orotate. This is the fourth step and the only redox reaction in the de novo biosynthesis of UMP, the precursor of all pyrimidine...; Region: DHOD_1A_like; cd04741
759913004681	active site
759913004682	FMN binding site [chemical binding]; other site
759913004683	substrate binding site [chemical binding]; other site
759913004684	catalytic residues [active]
759913004685	homodimer interface [polypeptide binding]; other site
759913004686	heavy metal-(Cd/Co/Hg/Pb/Zn)-translocating P-type ATPase; Region: ATPase-IB2_Cd; TIGR01512
759913004687	E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122
759913004688	Soluble P-type ATPase [General function prediction only]; Region: COG4087
759913004689	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
759913004690	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
759913004691	non-specific DNA binding site [nucleotide binding]; other site
759913004692	salt bridge; other site
759913004693	sequence-specific DNA binding site [nucleotide binding]; other site
759913004694	transcriptional activator, Rgg/GadR/MutR family, C-terminal domain; Region: RGG_Cterm; TIGR01716
759913004695	H+ Antiporter protein; Region: 2A0121; TIGR00900
759913004696	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
759913004697	Integration host factor (IHF) and HU are small heterodimeric members of the DNABII protein family that bind and bend DNA, functioning as architectural factors in many cellular processes including transcription, site-specific recombination, and...; Region: HU_IHF; cd00591
759913004698	IHF dimer interface [polypeptide binding]; other site
759913004699	IHF - DNA interface [nucleotide binding]; other site
759913004700	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4698
759913004701	Members of the SGNH-hydrolase superfamily, a diverse family of lipases and esterases. The tertiary fold of the enzyme is substantially different from that of the alpha/beta hydrolase family and unique among all known hydrolases; its active site closely...; Region: SGNH_hydrolase_YpmR_like; cd04506
759913004702	active site
759913004703	catalytic triad [active]
759913004704	oxyanion hole [active]
759913004705	EDD domain protein, DegV family; Region: DegV; TIGR00762
759913004706	Uncharacterized protein, DegV family COG1307; Region: DegV; pfam02645
759913004707	LPXTG-motif cell wall anchor domain; Region: LPXTG_anchor; TIGR01167
759913004708	ATPase involved in DNA repair [DNA replication, recombination, and repair]; Region: RecN; COG0497
759913004709	ATP-binding cassette domain of RecN; Region: ABC_RecN; cd03241
759913004710	Walker A/P-loop; other site
759913004711	ATP binding site [chemical binding]; other site
759913004712	Q-loop/lid; other site
759913004713	ATP-binding cassette domain of RecN; Region: ABC_RecN; cd03241
759913004714	ABC transporter signature motif; other site
759913004715	Walker B; other site
759913004716	D-loop; other site
759913004717	H-loop/switch region; other site
759913004718	Arginine repressor, DNA binding domain; Region: Arg_repressor; pfam01316
759913004719	Predicted rRNA methylase [Translation, ribosomal structure and biogenesis]; Region: COG1189
759913004720	S4/Hsp/ tRNA synthetase RNA-binding domain; The domain surface is populated by conserved, charged residues that define a likely RNA-binding site;  Found in stress proteins, ribosomal proteins and tRNA synthetases; This may imply a hitherto unrecognized...; Region: S4; cd00165
759913004721	RNA binding surface [nucleotide binding]; other site
759913004722	FtsJ-like methyltransferase; Region: FtsJ; pfam01728
759913004723	Geranylgeranyl pyrophosphate synthase [Coenzyme metabolism]; Region: IspA; COG0142
759913004724	Trans-Isoprenyl Diphosphate Synthases, head-to-tail; Region: Trans_IPPS_HT; cd00685
759913004725	substrate binding pocket [chemical binding]; other site
759913004726	chain length determination region; other site
759913004727	substrate-Mg2+ binding site; other site
759913004728	catalytic residues [active]
759913004729	aspartate-rich region 1; other site
759913004730	active site lid residues [active]
759913004731	aspartate-rich region 2; other site
759913004732	exodeoxyribonuclease VII small subunit; Provisional; Region: PRK00977
759913004733	Exonuclease VII, large subunit [DNA replication, recombination, and repair]; Region: XseA; COG1570
759913004734	ExoVII_LU_OBF: A subfamily of OB folds corresponding to the N-terminal OB-fold domain of Escherichia coli exodeoxyribonuclease VII (ExoVII) large subunit. E. coli ExoVII is composed of two non-identical subunits. E. coli ExoVII is a...; Region: ExoVII_LU_OBF; cd04489
759913004735	generic binding surface II; other site
759913004736	generic binding surface I; other site
759913004737	ribokinase/pfkB superfamily: Kinases that accept a wide variety of substrates, including carbohydrates and aromatic small molecules, all are phosphorylated at a hydroxyl group. The superfamily includes ribokinase, fructokinase, ketohexokinase; Region: ribokinase_pfkB_like; cl00192
759913004738	B.subtilis YXKO protein of unknown function and related proteins. Based on the conservation of the ATP binding site, the substrate binding site and the Mg2+binding site and structural homology this group is a member of the ribokinase-like superfamily; Region: YXKO-related; cd01171
759913004739	putative substrate binding site [chemical binding]; other site
759913004740	putative ATP binding site [chemical binding]; other site
759913004741	bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase/ 5,10-methylene-tetrahydrofolate cyclohydrolase; Provisional; Region: PRK14179
759913004742	Tetrahydrofolate dehydrogenase/cyclohydrolase, catalytic domain; Region: THF_DHG_CYH; pfam00763
759913004743	NADP binding domain of methylene-tetrahydrofolate dehydrogenase/cyclohydrolase; Region: NAD_bind_m-THF_DH_Cyclohyd; cd01080
759913004744	homodimer interface [polypeptide binding]; other site
759913004745	NADP binding site [chemical binding]; other site
759913004746	substrate binding site [chemical binding]; other site
759913004747	phosphoglucomutase-2-like protein; Provisional; Region: PTZ00150
759913004748	This CD includes PGM2 (phosphoglucomutase 2) and PGM2L1 (phosphoglucomutase 2-like 1). The mammalian PGM2 is thought to be a phosphopentomutase that catalyzes the conversion of the nucleoside breakdown products, ribose-1-phosphate and...; Region: PGM2; cd05799
759913004749	active site
759913004750	substrate binding site [chemical binding]; other site
759913004751	metal binding site [ion binding]; metal-binding site
759913004752	Deoxyribodipyrimidine photolyase [DNA replication, recombination, and repair]; Region: PhrB; COG0415
759913004753	DNA photolyase; Region: DNA_photolyase; pfam00875
759913004754	Fe2+ transport system protein B [Inorganic ion transport and metabolism]; Region: FeoB; COG0370
759913004755	Ferrous iron transport protein B (FeoB) family; Region: FeoB; cd01879
759913004756	G1 box; other site
759913004757	GTP/Mg2+ binding site [chemical binding]; other site
759913004758	Switch I region; other site
759913004759	G2 box; other site
759913004760	G3 box; other site
759913004761	Switch II region; other site
759913004762	G4 box; other site
759913004763	G5 box; other site
759913004764	Nucleoside recognition; Region: Gate; pfam07670
759913004765	Ferrous iron transport protein B C terminus; Region: FeoB_C; pfam07664
759913004766	Nucleoside recognition; Region: Gate; pfam07670
759913004767	FeoA domain; Region: FeoA; pfam04023
759913004768	Fe2+ transport system protein A [Inorganic ion transport and metabolism]; Region: FeoA; COG1918
759913004769	ABC-type polar amino acid transport system, ATPase component [Amino acid transport and metabolism]; Region: GlnQ; COG1126
759913004770	ATP-binding cassette domain of the histidine and glutamine transporters; Region: ABC_HisP_GlnQ; cd03262
759913004771	Walker A/P-loop; other site
759913004772	ATP binding site [chemical binding]; other site
759913004773	Q-loop/lid; other site
759913004774	ABC transporter signature motif; other site
759913004775	Walker B; other site
759913004776	D-loop; other site
759913004777	H-loop/switch region; other site
759913004778	ABC-type arginine transport system, permease component [Amino acid transport and metabolism]; Region: ArtQ; COG4215
759913004779	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
759913004780	dimer interface [polypeptide binding]; other site
759913004781	conserved gate region; other site
759913004782	putative PBP binding loops; other site
759913004783	ABC-ATPase subunit interface; other site
759913004784	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4703
759913004785	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
759913004786	ATPases associated with a variety of cellular activities; Region: AAA; smart00382
759913004787	Walker A motif; other site
759913004788	ATP binding site [chemical binding]; other site
759913004789	Walker B motif; other site
759913004790	arginine finger; other site
759913004791	UvrB/uvrC motif; Region: UVR; pfam02151
759913004792	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
759913004793	Walker A motif; other site
759913004794	ATP binding site [chemical binding]; other site
759913004795	Walker B motif; other site
759913004796	C-terminal, D2-small domain, of ClpB protein; Region: ClpB_D2-small; pfam10431
759913004797	Contains a crystal structure of the Nudix hydrolase from Enterococcus faecalis, which has an unknown function. In general, members of the Nudix hydrolase superfamily catalyze the hydrolysis of NUcleoside DIphosphates linked to other moieties, X. Enzymes...; Region: Nudix_Hydrolase_25; cd04684
759913004798	nudix motif; other site
759913004799	Domain of unknown function (DUF1827); Region: DUF1827; pfam08860
759913004800	isoleucyl-tRNA synthetase; Provisional; Region: ileS; PRK13804
759913004801	nucleotidyl transferase superfamily; Region: nt_trans; cl00015
759913004802	active site
759913004803	HIGH motif; other site
759913004804	nucleotide binding site [chemical binding]; other site
759913004805	catalytic core domain of isoleucyl-tRNA synthetases; Region: IleRS_core; cd00818
759913004806	active site
759913004807	KMSKS motif; other site
759913004808	Anticodon-binding domain of bacterial and eukaryotic mitochondrial isoleucyl tRNA synthetases; Region: Anticodon_Ia_Ile_BEm; cd07960
759913004809	tRNA binding surface [nucleotide binding]; other site
759913004810	anticodon binding site; other site
759913004811	DivIVA protein; Region: DivIVA; pfam05103
759913004812	DivIVA domain; Region: DivI1A_domain; TIGR03544
759913004813	Uncharacterized conserved protein, contains S4-like domain [Function unknown]; Region: COG2302
759913004814	S4/Hsp/ tRNA synthetase RNA-binding domain; The domain surface is populated by conserved, charged residues that define a likely RNA-binding site;  Found in stress proteins, ribosomal proteins and tRNA synthetases; This may imply a hitherto unrecognized...; Region: S4; cd00165
759913004815	RNA binding surface [nucleotide binding]; other site
759913004816	YGGT family; Region: YGGT; pfam02325
759913004817	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG1799
759913004818	Type III Pyridoxal 5-phosphate (PLP)-Dependent Enzymes, YBL036c-like proteins; Region: PLPDE_III_YBL036c_like; cd00635
759913004819	pyridoxal 5'-phosphate (PLP) binding site [chemical binding]; other site
759913004820	catalytic residue [active]
759913004821	cell division protein FtsZ; Validated; Region: PRK09330
759913004822	FtsZ is a GTPase that is similar to the eukaryotic tubulins and is essential for cell division in prokaryotes.  FtsZ is capable of polymerizing in a GTP-driven process into structures similar to those formed by tubulin. FtsZ forms a ring-shaped septum at...; Region: FtsZ_type1; cd02201
759913004823	nucleotide binding site [chemical binding]; other site
759913004824	SulA interaction site; other site
759913004825	Cell division ATPase FtsA [Cell division and chromosome partitioning]; Region: ftsA; COG0849
759913004826	Cell division protein FtsA; Region: FtsA; smart00842
759913004827	Cell division protein FtsA; Region: FtsA; pfam14450
759913004828	Domain of unknown function (DUF3484); Region: DUF3484; pfam11983
759913004829	Cell division septal protein [Cell envelope biogenesis, outer membrane]; Region: FtsQ; COG1589
759913004830	POTRA domain, FtsQ-type; Region: POTRA_1; pfam08478
759913004831	Cell division protein FtsQ; Region: FtsQ; pfam03799
759913004832	undecaprenyldiphospho-muramoylpentapeptide beta-N- acetylglucosaminyltransferase; Provisional; Region: murG; PRK00726
759913004833	MurG is an N-acetylglucosaminyltransferase, the last enzyme involved in the intracellular phase of peptidoglycan biosynthesis. It transfers N-acetyl-D-glucosamine (GlcNAc) from UDP-GlcNAc to the C4 hydroxyl of a lipid-linked N-acetylmuramoyl pentapeptide...; Region: GT1_MurG; cd03785
759913004834	homodimer interface [polypeptide binding]; other site
759913004835	active site
759913004836	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate synthetase; Provisional; Region: murD; PRK02472
759913004837	Alanine dehydrogenase/PNT, C-terminal domain; Region: AlaDh_PNT_C; smart01002
759913004838	Mur ligase middle domain; Region: Mur_ligase_M; pfam08245
759913004839	Mur ligase family, glutamate ligase domain; Region: Mur_ligase_C; pfam02875
759913004840	Transglutaminase-like superfamily; Region: Transglut_core; cl17362
759913004841	Protein of unknown function (DUF3165); Region: DUF3165; pfam11364
759913004842	Predicted membrane GTPase involved in stress response [Signal transduction mechanisms]; Region: TypA; COG1217
759913004843	Tyrosine phosphorylated protein A (TypA)/BipA family belongs to ribosome-binding GTPases; Region: TypA_BipA; cd01891
759913004844	G1 box; other site
759913004845	putative GEF interaction site [polypeptide binding]; other site
759913004846	GTP/Mg2+ binding site [chemical binding]; other site
759913004847	Switch I region; other site
759913004848	G2 box; other site
759913004849	G3 box; other site
759913004850	Switch II region; other site
759913004851	G4 box; other site
759913004852	G5 box; other site
759913004853	BipA_TypA_II: domain II of BipA (also called TypA) having homology to domain II of the elongation factors (EFs) EF-G and EF-Tu.  BipA is a highly conserved protein with global regulatory properties in Escherichia coli. BipA is phosphorylated on a...; Region: BipA_TypA_II; cd03691
759913004854	BipA_TypA_C: a C-terminal portion of BipA or TypA having homology to the C terminal domains of the elongation factors EF-G and EF-2. A member of the ribosome binding GTPase superfamily, BipA is widely distributed in bacteria and plants.  BipA is a highly...; Region: BipA_TypA_C; cd03710
759913004855	Rhodanese Homology Domain (RHOD); an alpha beta fold domain found duplicated in the rhodanese protein. The cysteine containing enzymatically active version of the domain is also found in the Cdc25 class of protein phosphatases and a variety of proteins...; Region: RHOD; cd00158
759913004856	active site residue [active]
759913004857	ROK family protein (putative glucokinase); Region: ROK_glcA_fam; TIGR00744
759913004858	Nucleotide-Binding Domain of the sugar kinase/HSP70/actin superfamily; Region: NBD_sugar-kinase_HSP70_actin; cd00012
759913004859	nucleotide binding site [chemical binding]; other site
759913004860	Bacterial protein of unknown function (DUF910); Region: DUF910; pfam06014
759913004861	DNA-binding ferritin-like protein (oxidative damage protectant) [Inorganic ion transport and metabolism]; Region: Dps; COG0783
759913004862	DPS protein, ferritin-like diiron-binding domain; Region: DPS; cd01043
759913004863	dimerization interface [polypeptide binding]; other site
759913004864	DPS ferroxidase diiron center [ion binding]; other site
759913004865	ion pore; other site
759913004866	Type II secretory pathway, prepilin signal peptidase PulO and related peptidases [Cell motility and secretion / Posttranslational modification, protein turnover, chaperones / Intracellular trafficking and secretion]; Region: PulO; COG1989
759913004867	ABC-type multidrug transport system, ATPase and permease components [Defense mechanisms]; Region: MdlB; COG1132
759913004868	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
759913004869	ATP-binding cassette domain of glucan transporter and related proteins, subfamily C; Region: ABCC_Glucan_exporter_like; cd03254
759913004870	Walker A/P-loop; other site
759913004871	ATP binding site [chemical binding]; other site
759913004872	Q-loop/lid; other site
759913004873	ABC transporter signature motif; other site
759913004874	Walker B; other site
759913004875	D-loop; other site
759913004876	H-loop/switch region; other site
759913004877	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
759913004878	putative multidrug transporter membrane\ATP-binding components; Provisional; Region: PRK10789
759913004879	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
759913004880	Walker A/P-loop; other site
759913004881	ATP binding site [chemical binding]; other site
759913004882	Q-loop/lid; other site
759913004883	ABC transporter signature motif; other site
759913004884	Walker B; other site
759913004885	D-loop; other site
759913004886	H-loop/switch region; other site
759913004887	VanZ like family; Region: VanZ; pfam04892
759913004888	ribosomal RNA large subunit methyltransferase N; Provisional; Region: PRK14455
759913004889	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
759913004890	FeS/SAM binding site; other site
759913004891	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4470
759913004892	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
759913004893	Predicted nucleoside-diphosphate-sugar epimerases [Cell envelope biogenesis, outer membrane / Carbohydrate transport and metabolism]; Region: COG0702
759913004894	NAD(P) binding site [chemical binding]; other site
759913004895	active site
759913004896	Transposase; Region: DEDD_Tnp_IS110; pfam01548
759913004897	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3547
759913004898	Transposase IS116/IS110/IS902 family; Region: Transposase_20; pfam02371
759913004899	D-ribose transporter subunit RbsB; Provisional; Region: PRK10653
759913004900	Periplasmic sugar-binding domain of the thermophilic Thermoanaerobacter tengcongensis ribose binding protein (ttRBP) and its mesophilic homologs; Region: PBP1_ribose_binding; cd06323
759913004901	ligand binding site [chemical binding]; other site
759913004902	dimerization interface [polypeptide binding]; other site
759913004903	Transmembrane subunit (TM) of Escherichia coli AraH and related proteins. E. coli AraH is the TM of a Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporter involved in the uptake of the monosaccharide arabinose. This group...; Region: TM_PBP1_transp_AraH_like; cd06579
759913004904	Branched-chain amino acid transport system / permease component; Region: BPD_transp_2; pfam02653
759913004905	TM-ABC transporter signature motif; other site
759913004906	ABC-type sugar transport system, ATPase component [Carbohydrate transport and metabolism]; Region: MglA; COG1129
759913004907	First domain of the ATP-binding cassette component of monosaccharide transport system; Region: ABC_Carb_Monos_I; cd03216
759913004908	Walker A/P-loop; other site
759913004909	ATP binding site [chemical binding]; other site
759913004910	Q-loop/lid; other site
759913004911	ABC transporter signature motif; other site
759913004912	Walker B; other site
759913004913	D-loop; other site
759913004914	H-loop/switch region; other site
759913004915	Second domain of the ATP-binding cassette component of monosaccharide transport system; Region: ABC_Carb_Monos_II; cd03215
759913004916	D-ribose pyranase; Provisional; Region: PRK11797
759913004917	Sugar kinases, ribokinase family [Carbohydrate transport and metabolism]; Region: RbsK; COG0524
759913004918	Ribokinase catalyses the phosphorylation of ribose to ribose-5-phosphate using ATP. This reaction is the first step in the ribose metabolism. It traps ribose within the cell after uptake and also prepares the sugar for use in the synthesis of nucleotides...; Region: ribokinase; cd01174
759913004919	substrate binding site [chemical binding]; other site
759913004920	dimer interface [polypeptide binding]; other site
759913004921	ATP binding site [chemical binding]; other site
759913004922	Transcriptional regulators [Transcription]; Region: PurR; COG1609
759913004923	Helix-turn-helix (HTH) DNA binding domain of the LacI family of transcriptional regulators; Region: HTH_LacI; cd01392
759913004924	DNA binding site [nucleotide binding]
759913004925	domain linker motif; other site
759913004926	Type 1 periplasmic binding fold superfamily; Region: Periplasmic_Binding_Protein_Type_1; cl10011
759913004927	Predicted secreted protein containing a PDZ domain [Signal transduction mechanisms]; Region: SdrC; COG3480
759913004928	PDZ domain, also called DHR (Dlg homologous region) or GLGF (after a conserved sequence motif). Many PDZ domains bind C-terminal polypeptides, though binding to internal (non-C-terminal) polypeptides and even to lipids has been demonstrated; Region: PDZ; cl00117
759913004929	protein binding site [polypeptide binding]; other site
759913004930	Lon protease (S16) C-terminal proteolytic domain; Region: Lon_C; pfam05362
759913004931	phosphopantetheine adenylyltransferase; Provisional; Region: coaD; PRK00168
759913004932	Phosphopantetheine adenylyltransferase; Region: PPAT; cd02163
759913004933	active site
759913004934	(T/H)XGH motif; other site
759913004935	N6-adenine-specific methylase [DNA replication, recombination, and repair]; Region: COG0742
759913004936	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
759913004937	S-adenosylmethionine binding site [chemical binding]; other site
759913004938	Asparagine synthetase (aspartate-ammonia ligase) (AsnA) catalyses the conversion of L-aspartate to L-asparagine in the presence of ATP and ammonia.  AsnA is a homodimeric enzyme which is structurally similiar to the catalytic core domain of class II...; Region: AsnA; cd00645
759913004939	dimer interface [polypeptide binding]; other site
759913004940	active site
759913004941	carbamate kinase; Reviewed; Region: PRK12686
759913004942	AAK_CK: Carbamate kinase (CK) catalyzes both the ATP-phosphorylation of carbamate and carbamoyl phosphate (CP) utilization with the production of ATP from ADP and CP. Both CK (this CD) and nonhomologous CP synthetase synthesize carbamoyl phosphate, an...; Region: AAK_CK; cd04235
759913004943	putative substrate binding site [chemical binding]; other site
759913004944	nucleotide binding site [chemical binding]; other site
759913004945	nucleotide binding site [chemical binding]; other site
759913004946	homodimer interface [polypeptide binding]; other site
759913004947	Transposase; Region: DEDD_Tnp_IS110; pfam01548
759913004948	Transposase IS116/IS110/IS902 family; Region: Transposase_20; pfam02371
759913004949	3,4-dihydroxy-2-butanone 4-phosphate synthase [Coenzyme metabolism]; Region: RibB; COG0108
759913004950	hypothetical protein; Provisional; Region: PRK07205
759913004951	M20 Peptidase Xaa-His dipeptidase (PepV) degrades hydrophobic dipeptides; Region: M20_PepV; cd03888
759913004952	active site
759913004953	metal binding site [ion binding]; metal-binding site
759913004954	Predicted membrane protein [Function unknown]; Region: COG1288
759913004955	C4-dicarboxylate anaerobic carrier; Region: DcuC; pfam03606
759913004956	ornithine carbamoyltransferase; Validated; Region: PRK02102
759913004957	Aspartate/ornithine carbamoyltransferase, carbamoyl-P binding domain; Region: OTCace_N; pfam02729
759913004958	Aspartate/ornithine carbamoyltransferase, Asp/Orn binding domain; Region: OTCace; pfam00185
759913004959	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
759913004960	Coenzyme A binding pocket [chemical binding]; other site
759913004961	arginine deiminase; Provisional; Region: PRK01388
759913004962	cAMP-binding proteins - catabolite gene activator and regulatory subunit of cAMP-dependent protein kinases [Signal transduction mechanisms]; Region: Crp; COG0664
759913004963	effector domain of the CAP family of transcription factors; members include CAP (or cAMP receptor protein (CRP)), which binds cAMP, FNR (fumarate and nitrate reduction), which uses an iron-sulfur cluster to sense oxygen) and CooA, a heme containing CO...; Region: CAP_ED; cd00038
759913004964	ligand binding site [chemical binding]; other site
759913004965	flexible hinge region; other site
759913004966	helix_turn_helix, cAMP Regulatory protein C-terminus; DNA binding domain of prokaryotic regulatory proteins belonging to the catabolite activator protein family; Region: HTH_CRP; cd00092
759913004967	putative switch regulator; other site
759913004968	non-specific DNA interactions [nucleotide binding]; other site
759913004969	DNA binding site [nucleotide binding]
759913004970	sequence specific DNA binding site [nucleotide binding]; other site
759913004971	putative cAMP binding site [chemical binding]; other site
759913004972	Arginine repressor [Transcription]; Region: ArgR; COG1438
759913004973	Arginine repressor, DNA binding domain; Region: Arg_repressor; pfam01316
759913004974	Arginine repressor, C-terminal domain; Region: Arg_repressor_C; pfam02863
759913004975	Solo B3/4 domain (OB-fold DNA/RNA-binding) of Phe-aaRS-beta [General function prediction only]; Region: COG3382
759913004976	B3/4 domain; Region: B3_4; pfam03483
759913004977	Uncharacterized protein conserved in bacteria [Function unknown]; Region: MmcQ; COG2315
759913004978	Predicted signal transduction protein with a C-terminal ATPase domain [Signal transduction mechanisms]; Region: COG2972
759913004979	Cache domain; Region: Cache_1; pfam02743
759913004980	HAMP domain; Region: HAMP; pfam00672
759913004981	Histidine kinase; Region: His_kinase; pfam06580
759913004982	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
759913004983	ATP binding site [chemical binding]; other site
759913004984	Mg2+ binding site [ion binding]; other site
759913004985	G-X-G motif; other site
759913004986	Response regulator receiver domain; Region: Response_reg; pfam00072
759913004987	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
759913004988	active site
759913004989	phosphorylation site [posttranslational modification]
759913004990	intermolecular recognition site; other site
759913004991	dimerization interface [polypeptide binding]; other site
759913004992	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
759913004993	helix_turn_helix, arabinose operon control protein; Region: HTH_ARAC; smart00342
759913004994	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
759913004995	Peptide methionine sulfoxide reductase [Posttranslational modification, protein turnover, chaperones]; Region: MsrA; COG0225
759913004996	Conserved domain frequently associated with peptide methionine sulfoxide reductase [Posttranslational modification, protein turnover, chaperones]; Region: COG0229
759913004997	SelR domain; Region: SelR; pfam01641
759913004998	TlpA-like family; composed of  TlpA, ResA, DsbE and similar proteins. TlpA, ResA and DsbE are bacterial protein disulfide reductases with important roles in cytochrome maturation. They are membrane-anchored proteins with a soluble TRX domain containing a...; Region: TlpA_like_family; cd02966
759913004999	Thioredoxin-like; Region: Thioredoxin_8; pfam13905
759913005000	catalytic residues [active]
759913005001	Cytochrome c biogenesis protein [Posttranslational modification, protein turnover, chaperones]; Region: CcdA; COG0785
759913005002	Cytochrome C biogenesis protein transmembrane region; Region: DsbD; pfam02683
759913005003	CorA-like Mg2+ transporter protein; Region: CorA; pfam01544
759913005004	uncharacterized bacterial subfamily of the Escherichia coli CorA-Salmonella typhimurium ZntB family; Region: EcCorA_ZntB-like_u2; cd12827
759913005005	Cl binding site [ion binding]; other site
759913005006	oligomer interface [polypeptide binding]; other site
759913005007	Predicted dehydrogenases and related proteins [General function prediction only]; Region: MviM; COG0673
759913005008	Oxidoreductase family, NAD-binding Rossmann fold; Region: GFO_IDH_MocA; pfam01408
759913005009	CRISPR 2 region; >CRISPR2_spacer1 GTGATTCTCACTAAAAATTGGGAAATGACAGAGTTA CRISPR2_spacer2 TGACAGTGATATTCAAGTTGATGCAATTGCGAT CRISPR2_spacer3 TAACCAAAATTACTTAAATTTTGATAAGAATAGC CRISPR2_spacer4 AGTAAATGTAACTGGTTGTGTACCTGTTAGGGTA CRISPR2_spacer5 AGTTCCGTCATGGCATCAAATCCCCTAGATTATC CRISPR2_spacer6 CATATAAAGAGTTGGGGTCTGTACTCGTCCAAGT CRISPR2_spacer7 TCATTGGAAGCACGAACCTTGCCTTTATGGATG CRISPR2_spacer8 TGTTCTAACACCTAATAAAAAGTTTGCTATAAAA CRISPR2_spacer9 AGCAAAAAACAATGCCAAAAAGATGAATGAGATT CRISPR2_spacer10 TCTTATAAAGGAGTTTAAAGAATCTAGTGACAAA CRISPR2_spacer11 TAAAAGAAAATATCGACACTTCTTCAGCAATGG CRISPR2_spacer12 TAATCTAAGAGCAATATCTGACCAAATAGTAGAA CRISPR2_spacer13 CGATTTAGACTAGCGGTGTCTGAGTCGCAAGGCT CRISPR2_spacer14 TCTAGTTCTAAGTCCTGTTCTGCCCTCAAAGTATT
759913005010	CRISPR/Cas system-associated protein Cas2; Region: Cas2_I_II_III; cd09725
759913005011	CRISPR/Cas system-associated protein Cas1; Region: Cas1_I-C; cd09721
759913005012	CRISPR-associated protein Cas4 (RecB family exonuclease) [Defense    mechanisms]; Region: COG1468
759913005013	CRISPR/Cas system-associated RAMP superfamily protein Cas7; Region: Cas7_I-C; cd09689
759913005014	CRISPR/Cas system-associated protein Cas8c; Region: Cas8c_I-C; cl12004
759913005015	CRISPR/Cas system-associated RAMP superfamily protein Cas5; Region: Cas5_I-C; cd09651
759913005016	CRISPR-associated protein (Cas_Cas5); Region: Cas_Cas5d; pfam09704
759913005017	CRISPR/Cas system-associated protein Cas3'' Region: Cas3''_I; cd09641
759913005018	CRISPR-associated helicase Cas3 [Defense mechanisms]; Region: COG1203
759913005019	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cl17251
759913005020	DDE_Tnp_1-associated; Region: DDE_Tnp_1_assoc; pfam13808
759913005021	Transposase DDE domain; Region: DDE_Tnp_1; pfam01609
759913005022	Transposase [DNA replication, recombination, and repair]; Region: COG5433
759913005023	valyl-tRNA synthetase; Reviewed; Region: valS; PRK05729
759913005024	nucleotidyl transferase superfamily; Region: nt_trans; cl00015
759913005025	active site
759913005026	HIGH motif; other site
759913005027	nucleotide binding site [chemical binding]; other site
759913005028	Leucyl-tRNA synthetase, Domain 2; Region: tRNA-synt_1_2; pfam13603
759913005029	catalytic core domain of valyl-tRNA synthetases; Region: ValRS_core; cd00817
759913005030	active site
759913005031	KMSKS motif; other site
759913005032	Anticodon-binding domain of valyl tRNA synthetases; Region: Anticodon_Ia_Val; cd07962
759913005033	tRNA binding surface [nucleotide binding]; other site
759913005034	anticodon binding site; other site
759913005035	Valyl tRNA synthetase tRNA binding arm; Region: Val_tRNA-synt_C; pfam10458
759913005036	AAA domain; Region: AAA_18; pfam13238
759913005037	AAA domain; Region: AAA_17; pfam13207
759913005038	Acetyltransferases, including N-acetylases of ribosomal proteins [Translation, ribosomal structure and biogenesis]; Region: RimL; COG1670
759913005039	Acetyltransferase (GNAT) family; Region: Acetyltransf_1; pfam00583
759913005040	This conserved domain belongs to a superfamily including the bleomycin resistance protein, glyoxalase I, and type I ring-cleaving dioxygenases; Region: Glo_EDI_BRP_like_6; cd07242
759913005041	putative dimer interface [polypeptide binding]; other site
759913005042	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
759913005043	ligand binding site [chemical binding]; other site
759913005044	Zn binding site [ion binding]; other site
759913005045	hypothetical protein; Provisional; Region: PRK07758
759913005046	Domain of unknown function (DUF1912); Region: DUF1912; pfam08930
759913005047	Transposase and inactivated derivatives, IS30 family [DNA replication, recombination, and repair]; Region: Tra8; COG2826
759913005048	Helix-turn-helix domain; Region: HTH_38; pfam13936
759913005049	Integrase core domain; Region: rve; pfam00665
759913005050	phage-related chromosomal island (PRCI) 3
759913005051	integrase; Provisional; Region: int; PHA02601
759913005052	phiLC3 phage and phage-related integrases, site-specific recombinases, DNA breaking-rejoining enzymes, C-terminal catalytic domain. This CD includes various bacterial (mainly gram positive) and phage integrases, including those similar to Lactococcus...; Region: INT_phiLC3_C; cd01189
759913005053	Int/Topo IB signature motif; other site
759913005054	Domain of unknown function (DUF771); Region: DUF771; pfam05595
759913005055	HTH-like domain; Region: HTH_21; pfam13276
759913005056	Integrase core domain; Region: rve; pfam00665
759913005057	Integrase core domain; Region: rve_3; pfam13683
759913005058	Transposase; Region: HTH_Tnp_1; pfam01527
759913005059	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG2963
759913005060	FtsK/SpoIIIE family; Region: FtsK_SpoIIIE; pfam01580
759913005061	AAA-like domain; Region: AAA_10; pfam12846
759913005062	TcpE family; Region: TcpE; pfam12648
759913005063	Conjugative transposon protein TcpC; Region: TpcC; pfam12642
759913005064	Antirestriction protein (ArdA); Region: ArdA; cl01953
759913005065	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
759913005066	non-specific DNA binding site [nucleotide binding]; other site
759913005067	salt bridge; other site
759913005068	sequence-specific DNA binding site [nucleotide binding]; other site
759913005069	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
759913005070	non-specific DNA binding site [nucleotide binding]; other site
759913005071	salt bridge; other site
759913005072	sequence-specific DNA binding site [nucleotide binding]; other site
759913005073	Replication initiation factor; Region: Rep_trans; pfam02486
759913005074	FtsK/SpoIIIE family; Region: FtsK_SpoIIIE; pfam01580
759913005075	helix_turn_helix multiple antibiotic resistance protein; Region: HTH_MARR; smart00347
759913005076	adhesin isopeptide-forming domain, sspB-C2 type; Region: isopep_sspB_C2; TIGR04228
759913005077	A sub-family of peptidase family C39. Peptidase family C39 mostly contains bacteriocin-processing endopeptidases from bacteria. The cysteine peptidases in family C39 cleave the "double-glycine" leader peptides from the precursors of various...; Region: Peptidase_C39A; cd02549
759913005078	putative active site [active]
759913005079	TRX family; composed of two groups: Group I, which includes proteins that exclusively encode a TRX domain; and Group II, which are composed of fusion proteins of TRX and additional domains. Group I TRX is a small ancient protein that alter the redox...; Region: TRX_family; cd02947
759913005080	catalytic residues [active]
759913005081	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
759913005082	non-specific DNA binding site [nucleotide binding]; other site
759913005083	salt bridge; other site
759913005084	sequence-specific DNA binding site [nucleotide binding]; other site
759913005085	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
759913005086	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
759913005087	non-specific DNA binding site [nucleotide binding]; other site
759913005088	salt bridge; other site
759913005089	sequence-specific DNA binding site [nucleotide binding]; other site
759913005090	Domain of unknown function (DUF955); Region: DUF955; pfam06114
759913005091	RelB antitoxin; Region: RelB; cl01171
759913005092	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3328
759913005093	Rib/alpha-like repeat; Region: Rib; cl07159
759913005094	Rib/alpha/Esp surface antigen repeat; Region: rib_alpha; TIGR02331
759913005095	Rib/alpha/Esp surface antigen repeat; Region: rib_alpha; TIGR02331
759913005096	Gram-positive signal peptide, YSIRK family; Region: YSIRK_signal; TIGR01168
759913005097	Alpha C protein N terminal; Region: AlphaC_N; pfam08829
759913005098	YSIRK-targeted surface antigen transcriptional regulator; Region: adjacent_YSIRK; TIGR04094
759913005099	Sigma-70 region 3; Region: Sigma70_r3; pfam04539
759913005100	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
759913005101	3-deoxy-7-phosphoheptulonate synthase; Provisional; Region: PRK13397
759913005102	DAHP synthetase I family; Region: DAHP_synth_1; pfam00793
759913005103	Dehydroquinate synthase (DHQS) catalyzes the conversion of DAHP to DHQ in shikimate pathway for aromatic compounds synthesis; Region: DHQS; cd08195
759913005104	active site
759913005105	dimer interface [polypeptide binding]; other site
759913005106	metal binding site [ion binding]; metal-binding site
759913005107	SEC10/PgrA surface exclusion domain; Region: Surf_Exclu_PgrA; TIGR04320
759913005108	Membrane transport protein; Region: Mem_trans; cl09117
759913005109	shikimate 5-dehydrogenase; Provisional; Region: PRK12548
759913005110	Shikimate dehydrogenase substrate binding domain; Region: Shikimate_dh_N; pfam08501
759913005111	NAD(P) binding domain of Shikimate dehydrogenase; Region: NAD_bind_Shikimate_DH; cd01065
759913005112	shikimate binding site; other site
759913005113	NAD(P) binding site [chemical binding]; other site
759913005114	Beta-galactosidase/beta-glucuronidase [Carbohydrate transport and metabolism]; Region: LacZ; COG3250
759913005115	Glycosyl hydrolases family 2, sugar binding domain; Region: Glyco_hydro_2_N; pfam02837
759913005116	Glycosyl hydrolases family 2; Region: Glyco_hydro_2; pfam00703
759913005117	Glycosyl hydrolases family 2, TIM barrel domain; Region: Glyco_hydro_2_C; pfam02836
759913005118	Response regulator containing CheY-like receiver domain and AraC-type DNA-binding domain [Signal transduction mechanisms]; Region: COG4753
759913005119	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
759913005120	active site
759913005121	phosphorylation site [posttranslational modification]
759913005122	intermolecular recognition site; other site
759913005123	dimerization interface [polypeptide binding]; other site
759913005124	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
759913005125	Predicted signal transduction protein with a C-terminal ATPase domain [Signal transduction mechanisms]; Region: COG2972
759913005126	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cl01054
759913005127	Histidine kinase; Region: His_kinase; pfam06580
759913005128	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
759913005129	ATP binding site [chemical binding]; other site
759913005130	Mg2+ binding site [ion binding]; other site
759913005131	G-X-G motif; other site
759913005132	Predicted integral membrane protein [Function unknown]; Region: COG5578
759913005133	ABC-type sugar transport system, periplasmic component [Carbohydrate transport and metabolism]; Region: UgpB; COG1653
759913005134	Bacterial extracellular solute-binding protein; Region: SBP_bac_1; pfam01547
759913005135	Domain of unknown function (DUF3502); Region: DUF3502; pfam12010
759913005136	ABC-type sugar transport system, permease component [Carbohydrate transport and metabolism]; Region: UgpE; COG0395
759913005137	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
759913005138	dimer interface [polypeptide binding]; other site
759913005139	conserved gate region; other site
759913005140	putative PBP binding loops; other site
759913005141	ABC-ATPase subunit interface; other site
759913005142	ABC-type polysaccharide transport system, permease component [Carbohydrate transport and metabolism]; Region: LplB; COG4209
759913005143	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
759913005144	putative PBP binding loops; other site
759913005145	dimer interface [polypeptide binding]; other site
759913005146	ABC-ATPase subunit interface; other site
759913005147	Transcriptional regulator/sugar kinase [Transcription / Carbohydrate transport and metabolism]; Region: NagC; COG1940
759913005148	Nucleotide-Binding Domain of the sugar kinase/HSP70/actin superfamily; Region: NBD_sugar-kinase_HSP70_actin; cd00012
759913005149	nucleotide binding site [chemical binding]; other site
759913005150	Putative alpha-1,2-mannosidase [Carbohydrate transport and metabolism]; Region: COG3537
759913005151	Glycosyl hydrolase family 92; Region: Glyco_hydro_92; pfam07971
759913005152	Beta-glucosidase/6-phospho-beta-glucosidase/beta- galactosidase [Carbohydrate transport and metabolism]; Region: BglB; COG2723
759913005153	beta-galactosidase; Region: BGL; TIGR03356
759913005154	beta-N-acetylglucosaminidase; Region: NAGidase; pfam07555
759913005155	Transcriptional regulators [Transcription]; Region: PhnF; COG2188
759913005156	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
759913005157	DNA-binding site [nucleotide binding]; DNA binding site
759913005158	Transcriptional regulators [Transcription]; Region: PurR; COG1609
759913005159	Ligand binding domain of the LacI tanscriptional regulator family belonging to the type I periplasmic-binding fold protein superfamily; Region: PBP1_LacI_sugar_binding_like; cd06267
759913005160	ligand binding site [chemical binding]; other site
759913005161	dimerization interface [polypeptide binding]; other site
759913005162	Uncharacterized conserved protein [Function unknown]; Region: COG3538
759913005163	Protein of unknown function (DUF1237); Region: DUF1237; pfam06824
759913005164	Alpha-mannosidase [Carbohydrate transport and metabolism]; Region: AMS1; COG0383
759913005165	N-terminal catalytic domain of SPGH38, a putative alpha-mannosidase of Streptococcus pyogenes, and its prokaryotic homologs; glycoside hydrolase family 38 (GH38); Region: GH38N_AMII_SpGH38_like; cd10814
759913005166	active site
759913005167	metal binding site [ion binding]; metal-binding site
759913005168	homodimer interface [polypeptide binding]; other site
759913005169	catalytic site [active]
759913005170	Alpha mannosidase, middle domain; Region: Alpha-mann_mid; smart00872
759913005171	ParB-like nuclease domain; Region: ParB; smart00470
759913005172	Sortase and related acyltransferases [Cell envelope biogenesis, outer membrane]; Region: COG1247
759913005173	DM4/DM12 family; Region: DM4_12; cl11657
759913005174	Flavin-utilizing monoxygenases; Region: Flavin_utilizing_monoxygenases; cd00347
759913005175	luciferase family oxidoreductase, group 1; Region: oxido_grp_1; TIGR03558
759913005176	Flavin-utilizing monoxygenases; Region: Flavin_utilizing_monoxygenases; cl07892
759913005177	acyl-CoA synthetase; Validated; Region: PRK08316
759913005178	Adenylate forming domain, Class I; Region: AFD_class_I; cl17068
759913005179	acyl-activating enzyme (AAE) consensus motif; other site
759913005180	AMP binding site [chemical binding]; other site
759913005181	active site
759913005182	CoA binding site [chemical binding]; other site
759913005183	putative enoyl-[acyl-carrier-protein] reductase II; Region: enACPred_II; TIGR03151
759913005184	2-Nitropropane dioxygenase (NPD), one of the nitroalkane oxidizing enzyme families, catalyzes oxidative denitrification of nitroalkanes to their corresponding carbonyl compounds and nitrites. NDP is a member of the NAD(P)H-dependent flavin oxidoreductase...; Region: NPD_like; cd04730
759913005185	FMN binding site [chemical binding]; other site
759913005186	substrate binding site [chemical binding]; other site
759913005187	putative catalytic residue [active]
759913005188	Thiolase are ubiquitous enzymes that catalyze the reversible thiolytic cleavage of 3-ketoacyl-CoA into acyl-CoA and acetyl-CoA, a 2-step reaction involving a covalent intermediate formed with a catalytic cysteine. They are found in prokaryotes and...; Region: thiolase; cd00751
759913005189	active site
759913005190	Thiolase, N-terminal domain; Region: Thiolase_N; pfam00108
759913005191	Thiolase are ubiquitous enzymes that catalyze the reversible thiolytic cleavage of 3-ketoacyl-CoA into acyl-CoA and acetyl-CoA, a 2-step reaction involving a covalent intermediate formed with a catalytic cysteine. They are found in prokaryotes and...; Region: thiolase; cd00751
759913005192	dimer interface [polypeptide binding]; other site
759913005193	3-hydroxybutyryl-CoA dehydrogenase; Validated; Region: PRK09260
759913005194	3-hydroxyacyl-CoA dehydrogenase, NAD binding domain; Region: 3HCDH_N; pfam02737
759913005195	3-hydroxyacyl-CoA dehydrogenase, C-terminal domain; Region: 3HCDH; pfam00725
759913005196	3-hydroxyacyl-CoA dehydrogenase, C-terminal domain; Region: 3HCDH; pfam00725
759913005197	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
759913005198	enoyl-CoA hydratase; Region: PLN02600
759913005199	substrate binding site [chemical binding]; other site
759913005200	oxyanion hole (OAH) forming residues; other site
759913005201	trimer interface [polypeptide binding]; other site
759913005202	DDE superfamily endonuclease; Region: DDE_4_2; pfam13613
759913005203	ABC-type multidrug transport system, ATPase component [Defense mechanisms]; Region: CcmA; COG1131
759913005204	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
759913005205	Walker A/P-loop; other site
759913005206	ATP binding site [chemical binding]; other site
759913005207	Q-loop/lid; other site
759913005208	ABC transporter signature motif; other site
759913005209	Walker B; other site
759913005210	D-loop; other site
759913005211	H-loop/switch region; other site
759913005212	TRAM domain; Region: TRAM; pfam01938
759913005213	SAM-dependent methyltransferases related to tRNA (uracil-5-)-methyltransferase [Translation, ribosomal structure and biogenesis]; Region: TrmA; COG2265
759913005214	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
759913005215	S-adenosylmethionine binding site [chemical binding]; other site
759913005216	recombination regulator RecX; Provisional; Region: recX; PRK14135
759913005217	hypothetical protein; Provisional; Region: PRK13662
759913005218	Staphylococcal protein of unknown function (DUF960); Region: DUF960; pfam06124
759913005219	Transposase and inactivated derivatives, IS30 family [DNA replication, recombination, and repair]; Region: Tra8; COG2826
759913005220	Integrase core domain; Region: rve; pfam00665
759913005221	RaiA ("ribosome-associated inhibitor A", also known as Protein Y (PY), YfiA, and SpotY,  is a stress-response protein that binds the ribosomal subunit interface and arrests translation by interfering with aminoacyl-tRNA binding to the ribosomal...; Region: RaiA; cd00552
759913005222	30S subunit binding site; other site
759913005223	Predicted amidophosphoribosyltransferases [General function prediction only]; Region: ComFC; COG1040
759913005224	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
759913005225	active site
759913005226	Superfamily II DNA/RNA helicase required for DNA uptake (late competence protein) [DNA replication, recombination, and repair]; Region: comFA; COG4098
759913005227	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
759913005228	ATP binding site [chemical binding]; other site
759913005229	putative Mg++ binding site [ion binding]; other site
759913005230	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
759913005231	nucleotide binding region [chemical binding]; other site
759913005232	ATP-binding site [chemical binding]; other site
759913005233	Uncharacterized conserved protein [Function unknown]; Region: COG1739
759913005234	Uncharacterized protein family UPF0029; Region: UPF0029; pfam01205
759913005235	Cysteine synthase [Amino acid transport and metabolism]; Region: CysK; COG0031
759913005236	CBS_like: This subgroup includes Cystathionine beta-synthase (CBS) and Cysteine synthase. CBS is a unique heme-containing enzyme that catalyzes a pyridoxal 5'-phosphate (PLP)-dependent condensation of serine and homocysteine to give cystathionine; Region: CBS_like; cd01561
759913005237	dimer interface [polypeptide binding]; other site
759913005238	pyridoxal 5'-phosphate binding site [chemical binding]; other site
759913005239	catalytic residue [active]
759913005240	hypothetical protein; Provisional; Region: PRK07252
759913005241	general stress protein 13; Validated; Region: PRK08059
759913005242	RNA binding site [nucleotide binding]; other site
759913005243	haloacid dehalogenase-like hydrolase; Region: Hydrolase_3; pfam08282
759913005244	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
759913005245	active site
759913005246	motif I; other site
759913005247	motif II; other site
759913005248	haloacid dehalogenase-like hydrolase; Region: HAD; cl17202
759913005249	cyclophilin: cyclophilin-type peptidylprolyl cis- trans isomerases. This family contains eukaryotic, bacterial and archeal proteins which exhibit a peptidylprolyl cis- trans isomerases activity (PPIase, Rotamase) and in addition bind the...; Region: cyclophilin; cd00317
759913005250	active site
759913005251	Response regulator containing a CheY-like receiver domain and an HTH DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: CitB; COG2197
759913005252	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
759913005253	active site
759913005254	phosphorylation site [posttranslational modification]
759913005255	intermolecular recognition site; other site
759913005256	dimerization interface [polypeptide binding]; other site
759913005257	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
759913005258	DNA binding residues [nucleotide binding]
759913005259	dimerization interface [polypeptide binding]; other site
759913005260	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: COG4585
759913005261	Histidine kinase; Region: HisKA_3; pfam07730
759913005262	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
759913005263	ATP binding site [chemical binding]; other site
759913005264	Mg2+ binding site [ion binding]; other site
759913005265	G-X-G motif; other site
759913005266	Predicted membrane protein [Function unknown]; Region: COG4758
759913005267	Cell wall-active antibiotics response protein (DUF2154); Region: DUF2154; pfam09922
759913005268	Serine/Threonine protein kinases, catalytic domain; Region: S_TKc; smart00220
759913005269	Catalytic domain of Protein Kinases; Region: PKc; cd00180
759913005270	active site
759913005271	ATP binding site [chemical binding]; other site
759913005272	substrate binding site [chemical binding]; other site
759913005273	activation loop (A-loop); other site
759913005274	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2815
759913005275	PASTA domain of bacterial serine/threonine kinase pknB-like proteins. PknB is a member of a group of related transmembrane sensor kinases present in many gram positive bacteria, which has been shown to regulate cell shape in Mycobacterium tubercolosis; Region: PASTA_pknB; cd06577
759913005276	PASTA domain of bacterial serine/threonine kinase pknB-like proteins. PknB is a member of a group of related transmembrane sensor kinases present in many gram positive bacteria, which has been shown to regulate cell shape in Mycobacterium tubercolosis; Region: PASTA_pknB; cd06577
759913005277	PASTA domain. This domain is found at the C-termini of several Penicillin-binding proteins (PBPs) and bacterial serine/threonine kinases. It is a small globular fold consisting of 3 beta-sheets and an alpha-helix. The name PASTA is derived from PBP and...; Region: PASTA; cl02768
759913005278	Serine/threonine phosphatases, family 2C, catalytic domain; The protein architecture and deduced catalytic mechanism of PP2C phosphatases are similar to the PP1, PP2A, PP2B family of protein Ser/Thr phosphatases, with which PP2C shares no sequence...; Region: PP2Cc; cd00143
759913005279	active site
759913005280	16S rRNA methyltransferase B; Provisional; Region: PRK14902
759913005281	NusB family; Region: NusB; pfam01029
759913005282	putative RNA binding site [nucleotide binding]; other site
759913005283	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
759913005284	S-adenosylmethionine binding site [chemical binding]; other site
759913005285	methionyl-tRNA formyltransferase; Reviewed; Region: fmt; PRK00005
759913005286	Methionyl-tRNA formyltransferase, N-terminal hydrolase domain; Region: FMT_core_Met-tRNA-FMT_N; cd08646
759913005287	putative active site [active]
759913005288	substrate binding site [chemical binding]; other site
759913005289	putative cosubstrate binding site; other site
759913005290	catalytic site [active]
759913005291	C-terminal domain of Formyltransferase and other enzymes; Region: Met_tRNA_FMT_C; cd08704
759913005292	substrate binding site [chemical binding]; other site
759913005293	Primosomal protein N' (replication factor Y) - superfamily II helicase [DNA replication, recombination, and repair]; Region: PriA; COG1198
759913005294	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
759913005295	ATP binding site [chemical binding]; other site
759913005296	putative Mg++ binding site [ion binding]; other site
759913005297	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
759913005298	ATP-binding site [chemical binding]; other site
759913005299	DNA-directed RNA polymerase subunit omega; Reviewed; Region: rpoZ; PRK00392
759913005300	Guanylate kinase [Nucleotide transport and metabolism]; Region: Gmk; COG0194
759913005301	Guanosine monophosphate kinase (GMPK, EC 2.7.4.8), also known as guanylate kinase (GKase), catalyzes the reversible phosphoryl transfer from adenosine triphosphate (ATP) to guanosine monophosphate (GMP) to yield adenosine diphosphate (ADP) and guanosine...; Region: GMPK; cd00071
759913005302	catalytic site [active]
759913005303	G-X2-G-X-G-K; other site
759913005304	hypothetical protein; Provisional; Region: PRK00106
759913005305	Metal dependent phosphohydrolases with conserved 'HD' motif; Region: HDc; cd00077
759913005306	Zn2+ binding site [ion binding]; other site
759913005307	Mg2+ binding site [ion binding]; other site
759913005308	Transcriptional regulator [Transcription]; Region: LysR; COG0583
759913005309	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
759913005310	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cl11398
759913005311	dimerization interface [polypeptide binding]; other site
759913005312	putative acyltransferase; Provisional; Region: PRK05790
759913005313	Thiolase are ubiquitous enzymes that catalyze the reversible thiolytic cleavage of 3-ketoacyl-CoA into acyl-CoA and acetyl-CoA, a 2-step reaction involving a covalent intermediate formed with a catalytic cysteine. They are found in prokaryotes and...; Region: thiolase; cd00751
759913005314	dimer interface [polypeptide binding]; other site
759913005315	active site
759913005316	Acyl CoA:acetate/3-ketoacid CoA transferase, alpha subunit [Lipid metabolism]; Region: AtoD; COG1788
759913005317	3-oxoacid CoA-transferase, B subunit; Region: pcaJ_scoB_fam; TIGR02428
759913005318	classical (c) SDRs; Region: SDR_c; cd05233
759913005319	NAD(P) binding site [chemical binding]; other site
759913005320	active site
759913005321	H+/gluconate symporter and related permeases [Carbohydrate transport and metabolism / Amino acid transport and metabolism]; Region: GntT; COG2610
759913005322	S-ribosylhomocysteinase; Provisional; Region: PRK02260
759913005323	Predicted N6-adenine-specific DNA methylase [DNA replication, recombination, and repair]; Region: COG0116
759913005324	THUMP domain associated with S-adenosylmethionine-dependent methyltransferases; Region: THUMP_AdoMetMT; cd11715
759913005325	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cl17173
759913005326	cell division protein GpsB; Provisional; Region: PRK14127
759913005327	DivIVA domain; Region: DivI1A_domain; TIGR03544
759913005328	hypothetical protein; Provisional; Region: PRK13660
759913005329	Holliday junction-specific endonuclease; Reviewed; Region: recU; PRK02234
759913005330	Membrane carboxypeptidase (penicillin-binding protein) [Cell envelope biogenesis, outer membrane]; Region: MrcB; COG0744
759913005331	Transglycosylase; Region: Transgly; pfam00912
759913005332	Penicillin binding protein transpeptidase domain; Region: Transpeptidase; cl17760
759913005333	Peptidase C1B subfamily (MEROPS database nomenclature); composed of eukaryotic bleomycin hydrolases (BH) and bacterial aminopeptidases C (pepC). The proteins of this subfamily contain a large insert relative to the C1A peptidase (papain) subfamily. BH is...; Region: Peptidase_C1B; cd00585
759913005334	trimer interface [polypeptide binding]; other site
759913005335	active site
759913005336	G bulge; other site
759913005337	NAD synthase [Coenzyme metabolism]; Region: NadE; COG0171
759913005338	NAD+ synthase is a homodimer, which catalyzes the final step in de novo nicotinamide adenine dinucleotide (NAD+) biosynthesis, an amide transfer from either ammonia or glutamine to nicotinic acid adenine dinucleotide (NaAD). The conversion of NaAD to NAD...; Region: NAD_synthase; cd00553
759913005339	homodimer interface [polypeptide binding]; other site
759913005340	NAD binding pocket [chemical binding]; other site
759913005341	ATP binding pocket [chemical binding]; other site
759913005342	Mg binding site [ion binding]; other site
759913005343	active-site loop [active]
759913005344	nicotinate phosphoribosyltransferase; Validated; Region: PRK09243
759913005345	Nicotinate phosphoribosyltransferase (NAPRTase), subgroup A. Nicotinate phosphoribosyltransferase catalyses the formation of NAMN and PPi from 5-phosphoribosy -1-pyrophosphate (PRPP) and nicotinic acid, this is the first, and also rate limiting, reaction...; Region: NAPRTase_A; cd01570
759913005346	active site
759913005347	Gamma-aminobutyrate permease and related permeases [Amino acid transport and metabolism]; Region: AnsP; COG1113
759913005348	thioredoxin-disulfide reductase; Region: TRX_reduct; TIGR01292
759913005349	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
759913005350	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
759913005351	Protein of unknown function (DUF4059); Region: DUF4059; pfam13268
759913005352	ABC-type polar amino acid transport system, ATPase component [Amino acid transport and metabolism]; Region: GlnQ; COG1126
759913005353	ATP-binding cassette domain of the histidine and glutamine transporters; Region: ABC_HisP_GlnQ; cd03262
759913005354	Walker A/P-loop; other site
759913005355	ATP binding site [chemical binding]; other site
759913005356	Q-loop/lid; other site
759913005357	ABC transporter signature motif; other site
759913005358	Walker B; other site
759913005359	D-loop; other site
759913005360	H-loop/switch region; other site
759913005361	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
759913005362	dimer interface [polypeptide binding]; other site
759913005363	conserved gate region; other site
759913005364	putative PBP binding loops; other site
759913005365	ABC-ATPase subunit interface; other site
759913005366	Bacterial extracellular solute-binding proteins, family 3; Region: SBP_bac_3; pfam00497
759913005367	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
759913005368	substrate binding pocket [chemical binding]; other site
759913005369	membrane-bound complex binding site; other site
759913005370	hinge residues; other site
759913005371	DEAD-box helicases. A diverse family of proteins involved in ATP-dependent RNA unwinding, needed in a variety of cellular processes including splicing, ribosome biogenesis and RNA degradation. The name derives from the sequence of the Walker  B motif; Region: DEADc; cd00268
759913005372	DEAD-like helicases superfamily; Region: DEXDc; smart00487
759913005373	ATP binding site [chemical binding]; other site
759913005374	Mg++ binding site [ion binding]; other site
759913005375	motif III; other site
759913005376	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
759913005377	nucleotide binding region [chemical binding]; other site
759913005378	ATP-binding site [chemical binding]; other site
759913005379	phospho-N-acetylmuramoyl-pentapeptide-transferase; Provisional; Region: mraY; PRK00108
759913005380	Phospho-N-acetylmuramoyl-pentapeptide-transferase (mraY) is an enzyme responsible for the formation of the first lipid intermediate in the synthesis of bacterial cell wall peptidoglycan. It catalyzes the formation of...; Region: GT_MraY; cd06852
759913005381	Mg++ binding site [ion binding]; other site
759913005382	putative catalytic motif [active]
759913005383	putative substrate binding site [chemical binding]; other site
759913005384	Cell division protein FtsI/penicillin-binding protein 2 [Cell envelope biogenesis, outer membrane]; Region: FtsI; COG0768
759913005385	Penicillin-binding Protein dimerisation domain; Region: PBP_dimer; pfam03717
759913005386	Penicillin binding protein transpeptidase domain; Region: Transpeptidase; pfam00905
759913005387	PASTA domain of PBP2x-like proteins, first repeat. Penicillin-binding proteins (PBPs) are the major targets for beta-lactam antibiotics, like penicillins and cephalosporins. Beta-lactam antibiotics specifically inhibit transpeptidase activity by...; Region: PASTA_Pbp2x-like_1; cd06576
759913005388	PASTA domain of PBP2x-like proteins, second repeat. Penicillin-binding proteins (PBPs) are the major targets for beta-lactam antibiotics, like penicillins and cephalosporins. Beta-lactam antibiotics specifically inhibit transpeptidase activity by...; Region: PASTA_Pbp2x-like_2; cd06575
759913005389	Protein required for the initiation of cell division [Cell division and chromosome partitioning]; Region: FtsL; COG4839
759913005390	Predicted S-adenosylmethionine-dependent methyltransferase involved in cell envelope biogenesis [Cell envelope biogenesis, outer membrane]; Region: COG0275
759913005391	MraW methylase family; Region: Methyltransf_5; pfam01795
759913005392	Gamma-glutamyl phosphate reductase (GPR), aldehyde dehydrogenase families 18 and 19; Region: ALDH_F18-19_ProA-GPR; cd07079
759913005393	gamma-glutamyl phosphate reductase; Region: proA; TIGR00407
759913005394	putative catalytic cysteine [active]
759913005395	Glutamate 5-kinase [Amino acid transport and metabolism]; Region: ProB; COG0263
759913005396	AAK_G5K_ProB: Glutamate-5-kinase (G5K) catalyzes glutamate-dependent ATP cleavage; G5K transfers the terminal phosphoryl group of ATP to the gamma-carboxyl group of glutamate, in the first and controlling step of proline (and, in mammals, ornithine)...; Region: AAK_G5K_ProB; cd04242
759913005397	nucleotide binding site [chemical binding]; other site
759913005398	homotetrameric interface [polypeptide binding]; other site
759913005399	putative phosphate binding site [ion binding]; other site
759913005400	putative allosteric binding site; other site
759913005401	ABC-type Na+ transport system, ATPase component [Energy production and conversion / Inorganic ion transport and metabolism]; Region: NatA; COG4555
759913005402	ATP-binding cassette domain of the drug resistance transporter and related proteins, subfamily A; Region: ABC_DR_subfamily_A; cd03230
759913005403	Walker A/P-loop; other site
759913005404	ATP binding site [chemical binding]; other site
759913005405	Q-loop/lid; other site
759913005406	ABC transporter signature motif; other site
759913005407	Walker B; other site
759913005408	D-loop; other site
759913005409	H-loop/switch region; other site
759913005410	Transketolase [Carbohydrate transport and metabolism]; Region: TktA; COG0021
759913005411	Thiamine pyrophosphate (TPP) family, Transketolase (TK) subfamily, TPP-binding module; TK catalyzes the transfer of a two-carbon unit from ketose phosphates to aldose phosphates. In heterotrophic organisms, TK provides a link between glycolysis and the...; Region: TPP_TK; cd02012
759913005412	TPP-binding site [chemical binding]; other site
759913005413	dimer interface [polypeptide binding]; other site
759913005414	Pyrimidine (PYR) binding domain of 1-deoxy-D-xylulose-5-phosphate synthase (DXS), transketolase (TK), and related proteins; Region: TPP_PYR_DXS_TK_like; cd07033
759913005415	PYR/PP interface [polypeptide binding]; other site
759913005416	dimer interface [polypeptide binding]; other site
759913005417	TPP binding site [chemical binding]; other site
759913005418	Transketolase, C-terminal domain; Region: Transketolase_C; pfam02780
759913005419	Transaldolase-like fructose-6-phosphate aldolases (FSA) found in bacteria and archaea; Region: Transaldolase_FSA; cd00956
759913005420	active site
759913005421	intersubunit interactions; other site
759913005422	catalytic residue [active]
759913005423	Mga helix-turn-helix domain; Region: Mga; pfam05043
759913005424	Uncharacterized NAD(FAD)-dependent dehydrogenases [General function prediction only]; Region: HcaD; COG0446
759913005425	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
759913005426	Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain; Region: Pyr_redox_dim; pfam02852
759913005427	Glycerol uptake facilitator and related permeases (Major Intrinsic Protein Family) [Carbohydrate transport and metabolism]; Region: GlpF; COG0580
759913005428	amphipathic channel; other site
759913005429	Asn-Pro-Ala signature motifs; other site
759913005430	Glycerol-3-phosphate dehydrogenase [Energy production and conversion]; Region: GlpA; COG0578
759913005431	glycerol kinase; Provisional; Region: glpK; PRK00047
759913005432	Escherichia coli glycerol kinase-like proteins; belongs to the FGGY family of carbohydrate kinases; Region: FGGY_EcGK_like; cd07786
759913005433	N- and C-terminal domain interface [polypeptide binding]; other site
759913005434	active site
759913005435	MgATP binding site [chemical binding]; other site
759913005436	catalytic site [active]
759913005437	metal binding site [ion binding]; metal-binding site
759913005438	glycerol binding site [chemical binding]; other site
759913005439	homotetramer interface [polypeptide binding]; other site
759913005440	homodimer interface [polypeptide binding]; other site
759913005441	FBP binding site [chemical binding]; other site
759913005442	protein IIAGlc interface [polypeptide binding]; other site
759913005443	Predicted membrane protein [Function unknown]; Region: COG3212
759913005444	Peptidase propeptide and YPEB domain; Region: PepSY; pfam03413
759913005445	hypothetical protein; Provisional; Region: PRK02539
759913005446	glycyl-tRNA synthetase subunit beta; Validated; Region: glyS; PRK01233
759913005447	Anticodon-binding domain of class Ia aminoacyl tRNA synthetases and similar domains; Region: Anticodon_Ia_like; cl12020
759913005448	Class II Glycyl-tRNA synthetase (GlyRS) alpha subunit core catalytic domain. GlyRS functions as a homodimer in eukaryotes, archaea and some bacteria and as a heterotetramer in the remainder of prokaryotes and in arabidopsis. It is responsible for the...; Region: GlyRS_alpha_core; cd00733
759913005449	dimer interface [polypeptide binding]; other site
759913005450	motif 1; other site
759913005451	active site
759913005452	motif 2; other site
759913005453	motif 3; other site
759913005454	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG1755
759913005455	Aldo-keto reductases (AKRs) are a superfamily of soluble NAD(P)(H) oxidoreductases whose chief purpose is to reduce aldehydes and ketones to primary and secondary alcohols. AKRs are present in all phyla and are of importance to both health and industrial...; Region: Aldo_ket_red; cd06660
759913005456	Aldo/keto reductase family; Region: Aldo_ket_red; pfam00248
759913005457	active site
759913005458	catalytic tetrad [active]
759913005459	N-acetylglucosamine-6-phosphate deacetylase [Carbohydrate transport and metabolism]; Region: NagA; COG1820
759913005460	N-acetylglucosamine-6-phosphate deacetylase, NagA, catalyzes the hydrolysis of the N-acetyl group of N-acetyl-glucosamine-6-phosphate (GlcNAc-6-P) to glucosamine 6-phosphate and acetate. This is the first committed step in the biosynthetic pathway to...; Region: NagA; cd00854
759913005461	active site
759913005462	dimer interface [polypeptide binding]; other site
759913005463	Na+/phosphate symporter [Inorganic ion transport and metabolism]; Region: NptA; COG1283
759913005464	Na+/Pi-cotransporter; Region: Na_Pi_cotrans; pfam02690
759913005465	Na+/Pi-cotransporter; Region: Na_Pi_cotrans; pfam02690
759913005466	PhoU domain; Region: PhoU; pfam01895
759913005467	PhoU domain; Region: PhoU; pfam01895
759913005468	valyl-tRNA synthetase; Provisional; Region: valS; PRK14900
759913005469	Uncharacterized protein conserved in bacteria [Function unknown]; Region: DegV; COG1307
759913005470	Uncharacterized protein, DegV family COG1307; Region: DegV; pfam02645
759913005471	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
759913005472	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
759913005473	Predicted hydrolases of the HAD superfamily [General function prediction only]; Region: Cof; COG0561
759913005474	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
759913005475	active site
759913005476	motif I; other site
759913005477	motif II; other site
759913005478	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
759913005479	Predicted membrane protein [Function unknown]; Region: COG2860
759913005480	UPF0126 domain; Region: UPF0126; pfam03458
759913005481	UPF0126 domain; Region: UPF0126; pfam03458
759913005482	tagatose 1,6-diphosphate aldolase; Reviewed; Region: PRK12399
759913005483	1-phosphofructokinase (FruK), minor 6-phosphofructokinase (pfkB) and related sugar kinases. FruK plays an important role in the predominant pathway for fructose utilisation.This group also contains tagatose-6-phophate kinase, an enzyme of the tagatose...; Region: FruK_PfkB_like; cd01164
759913005484	tagatose-6-phosphate kinase; Region: lacC; TIGR01231
759913005485	putative substrate binding site [chemical binding]; other site
759913005486	putative ATP binding site [chemical binding]; other site
759913005487	galactose-6-phosphate isomerase subunit LacB; Reviewed; Region: PRK08622
759913005488	galactose-6-phosphate isomerase subunit LacA; Provisional; Region: PRK12613
759913005489	Phosphotransferase system, galactitol-specific IIC component [Carbohydrate transport and metabolism]; Region: GatC; COG3775
759913005490	PTS system sugar-specific permease component; Region: EIIC-GAT; pfam03611
759913005491	Phosphotransferase system, galactitol-specific IIB component [Carbohydrate transport and metabolism]; Region: SgaB; COG3414
759913005492	active site
759913005493	P-loop; other site
759913005494	phosphorylation site [posttranslational modification]
759913005495	Phosphotransferase system mannitol/fructose-specific IIA domain (Ntr-type) [Carbohydrate transport and metabolism / Signal transduction mechanisms]; Region: PtsN; COG1762
759913005496	active site
759913005497	phosphorylation site [posttranslational modification]
759913005498	Transcriptional regulators of sugar metabolism [Transcription / Carbohydrate transport and metabolism]; Region: GlpR; COG1349
759913005499	helix_turn_helix, Deoxyribose operon repressor; Region: HTH_DEOR; smart00420
759913005500	DeoR C terminal sensor domain; Region: DeoRC; pfam00455
759913005501	Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371
759913005502	metal-binding site [ion binding]
759913005503	Cation transport ATPase [Inorganic ion transport and metabolism]; Region: ZntA; COG2217
759913005504	Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371
759913005505	metal-binding site [ion binding]
759913005506	E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122
759913005507	Soluble P-type ATPase [General function prediction only]; Region: COG4087
759913005508	Predicted transcriptional regulator [Transcription]; Region: COG3682
759913005509	copper transport repressor, CopY/TcrY family; Region: CopY_TcrY; TIGR02698
759913005510	Esterase/lipase [Lipid metabolism]; Region: Aes; COG0657
759913005511	ribosome-binding factor A; Validated; Region: rbfA; PRK00521
759913005512	Translation initiation factor IF-2, N-terminal region; Region: IF2_N; pfam04760
759913005513	translation initiation factor IF-2; Region: IF-2; TIGR00487
759913005514	Translation initiation factor IF-2, N-terminal region; Region: IF2_N; pfam04760
759913005515	Initiation Factor 2 (IF2)/ eukaryotic Initiation Factor 5B (eIF5B) family; Region: IF2_eIF5B; cd01887
759913005516	G1 box; other site
759913005517	putative GEF interaction site [polypeptide binding]; other site
759913005518	GTP/Mg2+ binding site [chemical binding]; other site
759913005519	Switch I region; other site
759913005520	G2 box; other site
759913005521	G3 box; other site
759913005522	Switch II region; other site
759913005523	G4 box; other site
759913005524	G5 box; other site
759913005525	This family represents the domain II of bacterial Initiation Factor 2 (IF2) and its eukaryotic mitochondrial homologue mtIF2. IF2, the largest initiation factor is an essential GTP binding protein. In E. coli three natural forms of IF2 exist in the cell; Region: IF2_mtIF2_II; cd03702
759913005526	Translation-initiation factor 2; Region: IF-2; pfam11987
759913005527	mtIF2_IVc: this family represents the C2 subdomain of domain IV of mitochondrial translation initiation factor 2 (mtIF2) which adopts a beta-barrel fold displaying a high degree of structural similarity with domain II of the translation elongation factor...; Region: mtIF2_IVc; cd03692
759913005528	hypothetical protein; Provisional; Region: PRK07283
759913005529	Ylxr homologs; group of conserved hypothetical bacterial proteins of unknown function; structure revealed putative RNA binding cleft; proteins are encoded by an operon that includes other proteins involved in transcription and/or translation; Region: YlxR; cd00279
759913005530	putative RNA binding cleft [nucleotide binding]; other site
759913005531	transcription elongation factor NusA; Provisional; Region: nusA; PRK12327
759913005532	NusA N-terminal domain; Region: NusA_N; pfam08529
759913005533	S1_NusA: N-utilizing substance A protein (NusA), S1-like RNA-binding domain. S1-like RNA-binding domains are found in a wide variety of RNA-associated proteins. NusA is a transcription elongation factor containing an N-terminal catalytic domain and three...; Region: S1_NusA; cd04455
759913005534	RNA binding site [nucleotide binding]; other site
759913005535	homodimer interface [polypeptide binding]; other site
759913005536	NusA-like KH domain; Region: KH_5; pfam13184
759913005537	NusA_K homology RNA-binding domain (KH). NusA is an essential multifunctional transcription elongation factor that is universally conserved among prokaryotes and archaea. NusA anti-termination function plays an important role in the expression of...; Region: NusA_KH; cd02134
759913005538	G-X-X-G motif; other site
759913005539	ribosome maturation protein RimP; Reviewed; Region: PRK00092
759913005540	Bacillus subtilis YxlS-like, C-terminal domain; Region: YlxS_C; cd01734
759913005541	putative oligomer interface [polypeptide binding]; other site
759913005542	putative RNA binding site [nucleotide binding]; other site
759913005543	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
759913005544	S-adenosylmethionine binding site [chemical binding]; other site
759913005545	Thiamine kinase and related kinases [Coenzyme transport and metabolism]; Region: ycfN; COG0510
759913005546	Phosphotransferase enzyme family; Region: APH; pfam01636
759913005547	substrate binding site [chemical binding]; other site
759913005548	Bacterial ABC transporter protein EcsB; Region: EcsB; cl11542
759913005549	Bacterial ABC transporter protein EcsB; Region: EcsB; pfam05975
759913005550	ABC-type Na+ transport system, ATPase component [Energy production and conversion / Inorganic ion transport and metabolism]; Region: NatA; COG4555
759913005551	ATP-binding cassette domain of the drug resistance transporter and related proteins, subfamily A; Region: ABC_DR_subfamily_A; cd03230
759913005552	Walker A/P-loop; other site
759913005553	ATP binding site [chemical binding]; other site
759913005554	Q-loop/lid; other site
759913005555	ABC transporter signature motif; other site
759913005556	Walker B; other site
759913005557	D-loop; other site
759913005558	H-loop/switch region; other site
759913005559	HINT (histidine triad nucleotide-binding protein) subgroup: Members of this CD belong to the superfamily of histidine triad hydrolases that act on alpha-phosphate of ribonucleotides. This subgroup includes members from all three forms of cellular life; Region: HINT_subgroup; cd01277
759913005560	HIT family signature motif; other site
759913005561	catalytic residue [active]
759913005562	Transcriptional regulator [Transcription]; Region: LytR; COG1316
759913005563	Acetyltransferases [General function prediction only]; Region: RimI; COG0456
759913005564	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
759913005565	Coenzyme A binding pocket [chemical binding]; other site
759913005566	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cl17182
759913005567	Predicted ATPase or kinase [General function prediction only]; Region: COG0802
759913005568	Xanthine/uracil/vitamin C permease [Nucleotide transport and    metabolism]; Region: COG2252
759913005569	haloacid dehalogenase-like hydrolase; Region: Hydrolase_3; pfam08282
759913005570	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
759913005571	active site
759913005572	motif I; other site
759913005573	motif II; other site
759913005574	PTS system mannose-specific transporter subunits IIAB; Provisional; Region: PRK15088
759913005575	PTS_IIA, PTS system, mannose/sorbose specific IIA subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This family...; Region: PTS_IIA_man; cd00006
759913005576	active pocket/dimerization site; other site
759913005577	active site
759913005578	phosphorylation site [posttranslational modification]
759913005579	PTS_IIB, PTS system, Mannose/sorbose specific IIB subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This family...; Region: PTS_IIB_man; cd00001
759913005580	active site
759913005581	phosphorylation site [posttranslational modification]
759913005582	PTS system mannose-specific transporter subunit IIC; Provisional; Region: PRK15065
759913005583	Phosphotransferase system, mannose/fructose/N-acetylgalactosamine-specific component IID [Carbohydrate transport and metabolism]; Region: ManZ; COG3716
759913005584	Domain of unknown function (DUF956); Region: DUF956; pfam06115
759913005585	Predicted O-acyltransferase [General function prediction only]; Region: COG3274
759913005586	Acyltransferase family; Region: Acyl_transf_3; pfam01757
759913005587	seryl-tRNA synthetase; Provisional; Region: PRK05431
759913005588	Seryl-tRNA synthetase N-terminal domain; Region: Seryl_tRNA_N; pfam02403
759913005589	Seryl-tRNA synthetase (SerRS) class II core catalytic domain. SerRS is responsible for the attachment of serine to the 3' OH group of ribose of the appropriate tRNA. This domain It is primarily responsible for ATP-dependent formation of the enzyme...; Region: SerRS_core; cd00770
759913005590	dimer interface [polypeptide binding]; other site
759913005591	active site
759913005592	motif 1; other site
759913005593	motif 2; other site
759913005594	motif 3; other site
759913005595	acetyl-CoA carboxylase subunit alpha; Provisional; Region: PRK12319
759913005596	acetyl-CoA carboxylase subunit beta; Validated; Region: PRK05654
759913005597	malonate decarboxylase subunit beta; Reviewed; Region: PRK07189; cl17682
759913005598	acetyl-CoA carboxylase biotin carboxylase subunit; Validated; Region: PRK08591
759913005599	Carbamoyl-phosphate synthase L chain, N-terminal domain; Region: CPSase_L_chain; pfam00289
759913005600	Carbamoyl-phosphate synthase L chain, ATP binding domain; Region: CPSase_L_D2; pfam02786
759913005601	Biotin carboxylase C-terminal domain; Region: Biotin_carb_C; smart00878
759913005602	FabZ is a 17kD beta-hydroxyacyl-acyl carrier protein (ACP) dehydratase that primarily catalyzes the dehydration of beta-hydroxyacyl-ACP to trans-2-acyl-ACP, the third step in the elongation phase of the bacterial/ plastid, type II, fatty-acid...; Region: FabZ; cd01288
759913005603	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit; Validated; Region: PRK06302
759913005604	The biotinyl-domain or biotin carboxyl carrier protein (BCCP) domain is present in all biotin-dependent enzymes, such as acetyl-CoA carboxylase, pyruvate carboxylase, propionyl-CoA carboxylase, methylcrotonyl-CoA carboxylase, geranyl-CoA carboxylase; Region: biotinyl_domain; cd06850
759913005605	carboxyltransferase (CT) interaction site; other site
759913005606	biotinylation site [posttranslational modification]; other site
759913005607	3-oxoacyl-(acyl carrier protein) synthase II; Reviewed; Region: PRK07314
759913005608	Beta-ketoacyl-acyl carrier protein (ACP) synthase (KAS), type I and II. KASs are responsible for the elongation steps in fatty acid biosynthesis. KASIII catalyses the initial condensation and KAS I and II catalyze further elongation steps by Claisen...; Region: KAS_I_II; cd00834
759913005609	dimer interface [polypeptide binding]; other site
759913005610	active site
759913005611	3-ketoacyl-(acyl-carrier-protein) reductase; Validated; Region: fabG; PRK05557
759913005612	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
759913005613	NAD(P) binding site [chemical binding]; other site
759913005614	active site
759913005615	(acyl-carrier-protein) S-malonyltransferase [Lipid metabolism]; Region: FabD; COG0331
759913005616	malonyl CoA-acyl carrier protein transacylase; Region: fabD; TIGR00128
759913005617	putative enoyl-[acyl-carrier-protein] reductase II; Region: enACPred_II; TIGR03151
759913005618	2-Nitropropane dioxygenase (NPD), one of the nitroalkane oxidizing enzyme families, catalyzes oxidative denitrification of nitroalkanes to their corresponding carbonyl compounds and nitrites. NDP is a member of the NAD(P)H-dependent flavin oxidoreductase...; Region: NPD_like; cd04730
759913005619	FMN binding site [chemical binding]; other site
759913005620	substrate binding site [chemical binding]; other site
759913005621	putative catalytic residue [active]
759913005622	acyl carrier protein; Provisional; Region: acpP; PRK00982
759913005623	3-oxoacyl-(acyl carrier protein) synthase III; Reviewed; Region: PRK09352
759913005624	Ketoacyl-acyl carrier protein synthase III (KASIII) initiates the elongation in type II fatty acid synthase systems. It is found in bacteria and plants. Elongation of fatty acids in the type II systems occurs by Claisen condensation of malonyl-acyl...; Region: KAS_III; cd00830
759913005625	dimer interface [polypeptide binding]; other site
759913005626	active site
759913005627	CoA binding pocket [chemical binding]; other site
759913005628	helix_turn_helix multiple antibiotic resistance protein; Region: HTH_MARR; smart00347
759913005629	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
759913005630	putative Zn2+ binding site [ion binding]; other site
759913005631	putative DNA binding site [nucleotide binding]; other site
759913005632	enoyl-CoA hydratase; Provisional; Region: PRK07260
759913005633	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
759913005634	substrate binding site [chemical binding]; other site
759913005635	oxyanion hole (OAH) forming residues; other site
759913005636	trimer interface [polypeptide binding]; other site
759913005637	chaperone protein DnaJ; Provisional; Region: PRK14276
759913005638	DnaJ domain or J-domain.  DnaJ/Hsp40 (heat shock protein 40) proteins are highly conserved and play crucial roles in protein translation, folding, unfolding, translocation, and degradation. They act primarily by stimulating the ATPase activity of Hsp70s; Region: DnaJ; cd06257
759913005639	HSP70 interaction site [polypeptide binding]; other site
759913005640	C-terminal substrate binding domain of DnaJ and HSP40; Region: DnaJ_C; cl03262
759913005641	substrate binding site [polypeptide binding]; other site
759913005642	Zinc finger domain of DnaJ and HSP40; Region: DnaJ_zf; cd10719
759913005643	Zn binding sites [ion binding]; other site
759913005644	C-terminal substrate binding domain of DnaJ and HSP40; Region: DnaJ_C; cd10747
759913005645	dimer interface [polypeptide binding]; other site
759913005646	Type 1 glutamine amidotransferase (GATase1)-like domain; Region: GAT_1; cl00020
759913005647	conserved cys residue [active]
759913005648	molecular chaperone DnaK; Provisional; Region: dnaK; PRK00290
759913005649	Nucleotide-binding domain of human HSPA9 and similar proteins; Region: HSPA9-Ssq1-like_NBD; cd10234
759913005650	nucleotide binding site [chemical binding]; other site
759913005651	NEF interaction site [polypeptide binding]; other site
759913005652	SBD interface [polypeptide binding]; other site
759913005653	GrpE; Region: GrpE; pfam01025
759913005654	GrpE is the adenine nucleotide exchange factor of DnaK (Hsp70)-type ATPases. The GrpE dimer binds to the ATPase domain of Hsp70 catalyzing the dissociation of ADP, which enables rebinding of ATP, one step in the Hsp70 reaction cycle in protein folding; Region: GrpE; cd00446
759913005655	dimer interface [polypeptide binding]; other site
759913005656	hsp70 (ATPase domain) interactions [polypeptide binding]; other site
759913005657	heat-inducible transcription repressor; Provisional; Region: hrcA; PRK00082
759913005658	Winged helix-turn-helix transcription repressor, HrcA DNA-binding; Region: HrcA_DNA-bdg; pfam03444
759913005659	Transposase and inactivated derivatives, IS30 family [DNA replication, recombination, and repair]; Region: Tra8; COG2826
759913005660	Helix-turn-helix domain; Region: HTH_38; pfam13936
759913005661	Integrase core domain; Region: rve; pfam00665
759913005662	Mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase; Region: Glucosaminidase; cl17361
759913005663	D-alanyl-D-alanine carboxypeptidase [Cell envelope biogenesis, outer membrane]; Region: VanY; COG1876
759913005664	D-alanyl-D-alanine carboxypeptidase; Region: VanY; pfam02557
759913005665	Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067
759913005666	catalytic core [active]
759913005667	Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067
759913005668	Predicted membrane protein [Function unknown]; Region: COG2261
759913005669	EamA-like transporter family; Region: EamA; pfam00892
759913005670	EamA-like transporter family; Region: EamA; pfam00892
759913005671	aspartyl/glutamyl-tRNA amidotransferase subunit B; Validated; Region: gatB; PRK05477
759913005672	GatB/GatE catalytic domain; Region: GatB_N; pfam02934
759913005673	GatB domain; Region: GatB_Yqey; pfam02637
759913005674	Asp-tRNAAsn/Glu-tRNAGln amidotransferase A subunit and related amidases [Translation, ribosomal structure and biogenesis]; Region: GatA; COG0154
759913005675	aspartyl/glutamyl-tRNA amidotransferase subunit A; Reviewed; Region: gatA; PRK00012
759913005676	aspartyl/glutamyl-tRNA amidotransferase subunit C; Reviewed; Region: gatC; PRK00034
759913005677	pyruvate phosphate dikinase; Provisional; Region: PRK09279
759913005678	Pyruvate phosphate dikinase, PEP/pyruvate binding domain; Region: PPDK_N; pfam01326
759913005679	PEP-utilising enzyme, mobile domain; Region: PEP-utilizers; pfam00391
759913005680	PEP-utilising enzyme, TIM barrel domain; Region: PEP-utilizers_C; pfam02896
759913005681	PEP synthetase regulatory protein; Provisional; Region: PRK05339
759913005682	FOG: CBS domain [General function prediction only]; Region: COG0517
759913005683	The CBS domain, named after human CBS, is a small domain originally identified in cystathionine beta-synthase and is subsequently found in a wide range of different proteins. CBS domains usually occur in tandem repeats. They associate to form a so-called...; Region: CBS_pair_4; cd04617
759913005684	Rhodanese Homology Domain (RHOD); an alpha beta fold domain found duplicated in the rhodanese protein. The cysteine containing enzymatically active version of the domain is also found in the Cdc25 class of protein phosphatases and a variety of proteins...; Region: RHOD; cd00158
759913005685	active site residue [active]
759913005686	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
759913005687	CoA-disulfide reductase; Region: CoA_CoA_reduc; TIGR03385
759913005688	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
759913005689	Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain; Region: Pyr_redox_dim; pfam02852
759913005690	Member of the Rhodanese Homology Domain superfamily. Included in this CD are the Lactococcus lactis NADH oxidase, Bacillus cereus NADH dehydrogenase, and Bacteroides thetaiotaomicron pyridine nucleotide-disulphide oxidoreductase, and similar...; Region: RHOD_Pyr_redox; cd01524
759913005691	active site residue [active]
759913005692	Rhodanese Homology Domain (RHOD); an alpha beta fold domain found duplicated in the rhodanese protein. The cysteine containing enzymatically active version of the domain is also found in the Cdc25 class of protein phosphatases and a variety of proteins...; Region: RHOD; cd00158
759913005693	active site residue [active]
759913005694	Uncharacterized protein YrkD from Bacillus subtilis and related domains; this domain superfamily was previously known as part of DUF156; Region: BsYrkD-like_DUF156; cd10155
759913005695	putative homodimer interface [polypeptide binding]; other site
759913005696	putative homotetramer interface [polypeptide binding]; other site
759913005697	putative metal binding site [ion binding]; other site
759913005698	putative homodimer-homodimer interface [polypeptide binding]; other site
759913005699	putative allosteric switch controlling residues; other site
759913005700	Isochorismatase family; Region: Isochorismatase; pfam00857
759913005701	Cysteine hydrolases; This family contains amidohydrolases, like CSHase (N-carbamoylsarcosine amidohydrolase), involved in creatine metabolism and nicotinamidase, converting nicotinamide to nicotinic acid and ammonia in the pyridine nucleotide cycle. It...; Region: cysteine_hydrolases; cd00431
759913005702	catalytic triad [active]
759913005703	conserved cis-peptide bond; other site
759913005704	Pleiotropic transcriptional repressor [Transcription]; Region: CodY; COG4465
759913005705	CodY GAF-like domain; Region: CodY; pfam06018
759913005706	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
759913005707	dimerization interface [polypeptide binding]; other site
759913005708	putative Zn2+ binding site [ion binding]; other site
759913005709	putative DNA binding site [nucleotide binding]; other site
759913005710	aminotransferase AlaT; Validated; Region: PRK09265
759913005711	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
759913005712	pyridoxal 5'-phosphate binding site [chemical binding]; other site
759913005713	homodimer interface [polypeptide binding]; other site
759913005714	catalytic residue [active]
759913005715	Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293
759913005716	Ligand Binding Site [chemical binding]; other site
759913005717	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
759913005718	haloacid dehalogenase-like hydrolase; Region: Hydrolase_3; pfam08282
759913005719	active site
759913005720	motif I; other site
759913005721	motif II; other site
759913005722	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cl17915
759913005723	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4696
759913005724	metal binding site [ion binding]; metal-binding site
759913005725	Type II (periplasmic) bacterial L-asparaginase; Region: L-asparaginase_II; cd08964
759913005726	active site
759913005727	homotetramer interface [polypeptide binding]; other site
759913005728	homodimer interface [polypeptide binding]; other site
759913005729	Aldo-keto reductases (AKRs) are a superfamily of soluble NAD(P)(H) oxidoreductases whose chief purpose is to reduce aldehydes and ketones to primary and secondary alcohols. AKRs are present in all phyla and are of importance to both health and industrial...; Region: Aldo_ket_red; cd06660
759913005730	Aldo/keto reductase family; Region: Aldo_ket_red; pfam00248
759913005731	active site
759913005732	catalytic tetrad [active]
759913005733	ATP-dependent DNA helicase RecG; Provisional; Region: PRK10917
759913005734	RecG_wedge_OBF: A subfamily of OB folds corresponding to the OB fold found in the N-terminal (wedge) domain of Escherichia coli RecG. RecG is a branched-DNA-specific helicase, which catalyzes the interconversion of a DNA replication fork to a...; Region: RecG_wedge_OBF; cd04488
759913005735	generic binding surface II; other site
759913005736	ssDNA binding site; other site
759913005737	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
759913005738	ATP binding site [chemical binding]; other site
759913005739	putative Mg++ binding site [ion binding]; other site
759913005740	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
759913005741	nucleotide binding region [chemical binding]; other site
759913005742	ATP-binding site [chemical binding]; other site
759913005743	ABC-type cobalt transport system, ATPase component [Inorganic ion transport and metabolism]; Region: CbiO; COG1122
759913005744	First domain of the ATP-binding cassette component of cobalt transport system; Region: ABC_cobalt_CbiO_domain1; cd03225
759913005745	Walker A/P-loop; other site
759913005746	ATP binding site [chemical binding]; other site
759913005747	Q-loop/lid; other site
759913005748	ABC transporter signature motif; other site
759913005749	Walker B; other site
759913005750	D-loop; other site
759913005751	H-loop/switch region; other site
759913005752	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
759913005753	cobalt transport protein ATP-binding subunit; Region: cbiO; TIGR01166
759913005754	Walker A/P-loop; other site
759913005755	ATP binding site [chemical binding]; other site
759913005756	Q-loop/lid; other site
759913005757	ABC transporter signature motif; other site
759913005758	Walker B; other site
759913005759	D-loop; other site
759913005760	H-loop/switch region; other site
759913005761	Cobalt transport protein; Region: CbiQ; cl00463
759913005762	Hypothetical bacterial integral membrane protein (Trep_Strep); Region: Trep_Strep; pfam09605
759913005763	ABC-type multidrug transport system, ATPase and permease components [Defense mechanisms]; Region: MdlB; COG1132
759913005764	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
759913005765	ATP-binding cassette domain of multidrug resistance protein-like transporters; Region: ABCC_MRP_Like; cd03228
759913005766	Walker A/P-loop; other site
759913005767	ATP binding site [chemical binding]; other site
759913005768	Q-loop/lid; other site
759913005769	ABC transporter signature motif; other site
759913005770	Walker B; other site
759913005771	D-loop; other site
759913005772	H-loop/switch region; other site
759913005773	ABC-type transport system involved in cytochrome bd biosynthesis, ATPase and permease components [Energy production and conversion / Posttranslational modification, protein turnover, chaperones]; Region: CydD; COG4988
759913005774	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
759913005775	Walker A/P-loop; other site
759913005776	ATP binding site [chemical binding]; other site
759913005777	Q-loop/lid; other site
759913005778	ABC transporter signature motif; other site
759913005779	Walker B; other site
759913005780	D-loop; other site
759913005781	H-loop/switch region; other site
759913005782	ABC-type cobalamin/Fe3+-siderophores transport systems, ATPase components [Inorganic ion transport and metabolism / Coenzyme metabolism]; Region: FepC; COG1120
759913005783	ATP-binding component of iron-siderophores, vitamin B12 and hemin transporters and related proteins; Region: ABC_Iron-Siderophores_B12_Hemin; cd03214
759913005784	Walker A/P-loop; other site
759913005785	ATP binding site [chemical binding]; other site
759913005786	Q-loop/lid; other site
759913005787	ABC transporter signature motif; other site
759913005788	Walker B; other site
759913005789	D-loop; other site
759913005790	H-loop/switch region; other site
759913005791	iron-hydroxamate transporter permease subunit; Provisional; Region: PRK10577
759913005792	Transmembrane subunit (TM), of Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters involved in the uptake of siderophores, heme, vitamin B12, or the divalent cations Mg2+ and Zn2+. PBP-dependent ABC transporters consist of...; Region: TM_ABC_iron-siderophores_like; cd06550
759913005793	ABC-ATPase subunit  interface; other site
759913005794	dimer interface [polypeptide binding]; other site
759913005795	putative PBP binding regions; other site
759913005796	Helical backbone metal receptor (TroA-like domain). These proteins have been shown to function in the ABC transport of ferric siderophores and metal ions such as Mn2+, Fe3+, Cu2+ and/or Zn2+.  Their ligand binding site is formed in the interface between...; Region: TroA-like; cl00262
759913005797	Periplasmic binding protein; Region: Peripla_BP_2; pfam01497
759913005798	intersubunit interface [polypeptide binding]; other site
759913005799	Cell surface heme-binding protein Shp; Region: HemeBinding_Shp; pfam11545
759913005800	Protein of unknown function (DUF1533); Region: DUF1533; pfam07550
759913005801	Protein of unknown function (DUF1533); Region: DUF1533; pfam07550
759913005802	NEAr Transport domain, a component of cell surface proteins; Region: NEAT; cd06920
759913005803	heme-binding site [chemical binding]; other site
759913005804	Leucine-rich repeats (LRRs), ribonuclease inhibitor (RI)-like subfamily. LRRs are 20-29 residue sequence motifs present in many proteins that participate in protein-protein interactions and have different functions and cellular locations. LRRs correspond...; Region: LRR_RI; cl15309
759913005805	Leucine-rich repeats; other site
759913005806	Leucine rich repeat; Region: LRR_8; pfam13855
759913005807	Substrate binding site [chemical binding]; other site
759913005808	Leucine-rich repeat (LRR) protein [Function unknown]; Region: COG4886
759913005809	NEAr Transport domain, a component of cell surface proteins; Region: NEAT; cd06920
759913005810	heme-binding site [chemical binding]; other site
759913005811	Surface antigen [General function prediction only]; Region: COG3942
759913005812	CHAP domain; Region: CHAP; pfam05257
759913005813	alanine racemase; Reviewed; Region: alr; PRK00053
759913005814	Type III Pyridoxal 5-phosphate (PLP)-Dependent Enzyme Alanine Racemase; Region: PLPDE_III_AR; cd00430
759913005815	active site
759913005816	pyridoxal 5'-phosphate (PLP) binding site [chemical binding]; other site
759913005817	dimer interface [polypeptide binding]; other site
759913005818	substrate binding site [chemical binding]; other site
759913005819	catalytic residues [active]
759913005820	4'-phosphopantetheinyl transferase; Provisional; Region: acpS; PRK00070
759913005821	preprotein translocase subunit SecA; Reviewed; Region: PRK12904
759913005822	SecA preprotein cross-linking domain; Region: SecA_PP_bind; smart00958
759913005823	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
759913005824	nucleotide binding region [chemical binding]; other site
759913005825	ATP-binding site [chemical binding]; other site
759913005826	SEC-C motif; Region: SEC-C; pfam02810
759913005827	Phosphomannose isomerase [Carbohydrate transport and metabolism]; Region: ManA; COG1482
759913005828	mannose-6-phosphate isomerase, class I; Region: manA; TIGR00218
759913005829	Transcriptional regulator/sugar kinase [Transcription / Carbohydrate transport and metabolism]; Region: NagC; COG1940
759913005830	Nucleotide-Binding Domain of the sugar kinase/HSP70/actin superfamily; Region: NBD_sugar-kinase_HSP70_actin; cd00012
759913005831	nucleotide binding site [chemical binding]; other site
759913005832	PTS system, sucrose-specific IIBC component; Region: PTS-II-BC-sucr; TIGR01996
759913005833	PTS_IIB, PTS system, glucose/sucrose specific IIB subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This family...; Region: PTS_IIB_glc; cd00212
759913005834	active site turn [active]
759913005835	phosphorylation site [posttranslational modification]
759913005836	Phosphotransferase system IIC components, glucose/maltose/N-acetylglucosamine-specific [Carbohydrate transport and metabolism]; Region: PtsG; COG1263
759913005837	Phosphotransferase system IIA components [Carbohydrate transport and metabolism]; Region: NagE; COG2190
759913005838	HPr interaction site; other site
759913005839	glycerol kinase (GK) interaction site [polypeptide binding]; other site
759913005840	active site
759913005841	phosphorylation site [posttranslational modification]
759913005842	sucrose-6-phosphate hydrolase; Region: scrB_fam; TIGR01322
759913005843	Glycosyl hydrolase family 32, beta-fructosidases; Region: GH32_B_Fructosidase; cd08996
759913005844	substrate binding [chemical binding]; other site
759913005845	active site
759913005846	Glycosyl hydrolases family 32 C terminal; Region: Glyco_hydro_32C; pfam08244
759913005847	Transcriptional regulators [Transcription]; Region: PurR; COG1609
759913005848	Helix-turn-helix (HTH) DNA binding domain of the LacI family of transcriptional regulators; Region: HTH_LacI; cd01392
759913005849	DNA binding site [nucleotide binding]
759913005850	domain linker motif; other site
759913005851	Ligand binding domain of the lacI-like transcription regulator from a novel metal-reducing bacterium Alkaliphilus Metalliredigens (strain Qymf) and its close homologs; Region: PBP1_Qymf_like; cd06291
759913005852	dimerization interface [polypeptide binding]; other site
759913005853	ligand binding site [chemical binding]; other site
759913005854	sodium binding site [ion binding]; other site
759913005855	transcription antitermination protein NusB; Reviewed; Region: nusB; PRK00202
759913005856	putative RNA binding site [nucleotide binding]; other site
759913005857	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG1302
759913005858	elongation factor P; Validated; Region: PRK00529
759913005859	Elongation factor P (EF-P) KOW-like domain; Region: EFP_N; pfam08207
759913005860	S1_EF-P_repeat_1: Translation elongation factor P (EF-P), S1-like RNA-binding domain, repeat 1. EF-P stimulates the peptidyltransferase activity in the prokaryotic 70S ribosome. EF-P enhances the synthesis of certain dipeptides with...; Region: S1_EF-P_repeat_1; cd04470
759913005861	RNA binding site [nucleotide binding]; other site
759913005862	S1_EF-P_repeat_2: Translation elongation factor P (EF-P), S1-like RNA-binding domain, repeat 1. EF-P stimulates the peptidyltransferase activity in the prokaryotic 70S ribosome. EF-P enhances the synthesis of certain dipeptides with...; Region: S1_EF-P_repeat_2; cd05794
759913005863	RNA binding site [nucleotide binding]; other site
759913005864	Deoxycytidylate deaminase domain. Deoxycytidylate deaminase catalyzes the deamination of dCMP to dUMP, providing the nucleotide substrate for thymidylate synthase. The enzyme binds Zn++, which is required for catalytic activity. The activity of the...; Region: deoxycytidylate_deaminase; cd01286
759913005865	catalytic motif [active]
759913005866	Zn binding site [ion binding]; other site
759913005867	Xaa-Pro aminopeptidase [Amino acid transport and metabolism]; Region: PepP; COG0006
759913005868	Creatinase/Prolidase N-terminal domain; Region: Creatinase_N; pfam01321
759913005869	Similar to Prolidase and Aminopeptidase P. The members of this subfamily presumably catalyse hydrolysis of Xaa-Pro dipeptides and/or release of any N-terminal amino acid, including proline, that is linked with proline; Region: APP-like; cd01092
759913005870	active site
759913005871	excinuclease ABC subunit A; Reviewed; Region: uvrA; PRK00349
759913005872	ATP-binding cassette domain I of the excision repair protein UvrA; Region: ABC_UvrA_I; cd03270
759913005873	ATP-binding cassette domain I of the excision repair protein UvrA; Region: ABC_UvrA_I; cd03270
759913005874	ATP-binding cassette domain II of the excision repair protein UvrA; Region: ABC_UvrA_II; cd03271
759913005875	Mg2+ and Co2+ transporters [Inorganic ion transport and metabolism]; Region: CorA; COG0598
759913005876	uncharacterized bacterial subfamily of the Escherichia coli CorA-Salmonella typhimurium ZntB family; Region: EcCorA_ZntB-like_u2; cd12827
759913005877	Cl binding site [ion binding]; other site
759913005878	oligomer interface [polypeptide binding]; other site
759913005879	Uncharacterized membrane-bound protein conserved in bacteria [Function unknown]; Region: COG4858
759913005880	30S ribosomal protein S18; Reviewed; Region: rpsR; PRK00391
759913005881	Single-stranded DNA-binding protein [DNA replication, recombination, and repair]; Region: Ssb; COG0629
759913005882	SSB_OBF: A subfamily of OB folds similar to the OB fold of ssDNA-binding protein (SSB). SSBs bind with high affinity to ssDNA. They bind to and protect ssDNA intermediates during DNA metabolic pathways. All bacterial and eukaryotic SSBs studied to date...; Region: SSB_OBF; cd04496
759913005883	dimer interface [polypeptide binding]; other site
759913005884	ssDNA binding site [nucleotide binding]; other site
759913005885	tetramer (dimer of dimers) interface [polypeptide binding]; other site
759913005886	30S ribosomal protein S6; Reviewed; Region: rpsF; PRK00453
759913005887	A/G-specific DNA glycosylase [DNA replication, recombination, and repair]; Region: MutY; COG1194
759913005888	endonuclease III; includes endonuclease III (DNA-(apurinic or apyrimidinic site) lyase), alkylbase DNA glycosidases (Alka-family) and other DNA glycosidases; Region: ENDO3c; cd00056
759913005889	minor groove reading motif; other site
759913005890	helix-hairpin-helix signature motif; other site
759913005891	substrate binding pocket [chemical binding]; other site
759913005892	active site
759913005893	DNA glycosylase (MutY in bacteria and hMYH in humans) is responsible for repairing misread  A*oxoG residues to C*G by removing the inappropriately paired adenine base from the DNA backbone. It belongs to the Nudix hydrolase superfamily and is important...; Region: DNA_Glycosylase_C; cd03431
759913005894	DNA binding and oxoG recognition site [nucleotide binding]
759913005895	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG2963
759913005896	Transposase; Region: HTH_Tnp_1; cl17663
759913005897	HTH-like domain; Region: HTH_21; pfam13276
759913005898	Integrase core domain; Region: rve; pfam00665
759913005899	Integrase core domain; Region: rve_2; pfam13333
759913005900	TRX family; composed of two groups: Group I, which includes proteins that exclusively encode a TRX domain; and Group II, which are composed of fusion proteins of TRX and additional domains. Group I TRX is a small ancient protein that alter the redox...; Region: TRX_family; cd02947
759913005901	Thioredoxin-like; Region: Thioredoxin_8; pfam13905
759913005902	catalytic residues [active]
759913005903	pyridine nucleotide-disulfide oxidoreductase; Provisional; Region: PRK07251
759913005904	ubiquinone biosynthesis hydroxylase family protein; Provisional; Region: PRK07608; cl17314
759913005905	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
759913005906	Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain; Region: Pyr_redox_dim; pfam02852
759913005907	Mismatch repair ATPase (MutS family) [DNA replication, recombination, and repair]; Region: COG1193
759913005908	MutS domain III; Region: MutS_III; pfam05192
759913005909	ATP-binding cassette domain of MutS2; Region: ABC_MutS2; cd03280
759913005910	Walker A/P-loop; other site
759913005911	ATP binding site [chemical binding]; other site
759913005912	Q-loop/lid; other site
759913005913	ABC transporter signature motif; other site
759913005914	Walker B; other site
759913005915	D-loop; other site
759913005916	H-loop/switch region; other site
759913005917	Smr domain; Region: Smr; pfam01713
759913005918	Uncharacterized membrane protein, required for colicin V production [General function prediction only]; Region: CvpA; COG1286
759913005919	Colicin V production protein; Region: Colicin_V; pfam02674
759913005920	ribonuclease HIII; Provisional; Region: PRK00996
759913005921	bacterial Ribonuclease HIII-like; Region: RNase_HII_bacteria_HIII_like; cd06590
759913005922	RNA/DNA hybrid binding site [nucleotide binding]; other site
759913005923	active site
759913005924	signal peptidase I, bacterial type; Region: sigpep_I_bact; TIGR02227
759913005925	The S24, S26 LexA/signal peptidase superfamily contains LexA-related and type I signal peptidase families. The S24 LexA protein domains include: the lambda repressor CI/C2 family and related bacterial prophage repressor proteins; LexA (EC 3.4.21.88), the...; Region: Peptidase_S24_S26; cd06462
759913005926	Catalytic site [active]
759913005927	The S24, S26 LexA/signal peptidase superfamily contains LexA-related and type I signal peptidase families. The S24 LexA protein domains include: the lambda repressor CI/C2 family and related bacterial prophage repressor proteins; LexA (EC 3.4.21.88), the...; Region: Peptidase_S24_S26; cl10465
759913005928	helicase, putative, RecD/TraA family; Region: recD_rel; TIGR01448
759913005929	H3TH domains of structure-specific 5' nucleases (or flap endonuclease-1-like) involved in DNA replication, repair, and recombination; Region: H3TH_StructSpec-5'-nucleases; cl14815
759913005930	DNA binding site [nucleotide binding]
759913005931	AAA domain; Region: AAA_30; pfam13604
759913005932	Family description; Region: UvrD_C_2; pfam13538
759913005933	DNA Polymerase IV/Kappa; Region: PolY_Pol_IV_kappa; cd03586
759913005934	active site
759913005935	DNA polymerase IV; Validated; Region: PRK02406
759913005936	DNA binding site [nucleotide binding]
759913005937	formate acetyltransferase 1; Region: pyr_form_ly_1; TIGR01255
759913005938	Ribonucleotide reductase and Pyruvate formate lyase; Region: RNR_PFL; cl09939
759913005939	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
759913005940	Coenzyme A binding pocket [chemical binding]; other site
759913005941	N-terminal Early set domain associated with the catalytic domain of cyclomaltodextrinase and pullulan-degrading enzymes; Region: E_set_CDase_PDE_N; cd02857
759913005942	homodimer interface [polypeptide binding]; other site
759913005943	maltodextrin glucosidase; Provisional; Region: PRK10785
759913005944	Alpha amylase catalytic domain found in cyclomaltodextrinases and related proteins; Region: AmyAc_CMD; cd11338
759913005945	active site
759913005946	homodimer interface [polypeptide binding]; other site
759913005947	catalytic site [active]
759913005948	ABC-type sugar transport system, periplasmic component [Carbohydrate transport and metabolism]; Region: UgpB; COG1653
759913005949	Protein of unknown function, DUF624; Region: DUF624; pfam04854
759913005950	ABC-type sugar transport system, permease component [Carbohydrate transport and metabolism]; Region: UgpE; COG0395
759913005951	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
759913005952	dimer interface [polypeptide binding]; other site
759913005953	ABC-ATPase subunit interface; other site
759913005954	ABC-type polysaccharide transport system, permease component [Carbohydrate transport and metabolism]; Region: LplB; COG4209
759913005955	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
759913005956	dimer interface [polypeptide binding]; other site
759913005957	conserved gate region; other site
759913005958	ABC-ATPase subunit interface; other site
759913005959	Transcriptional regulators [Transcription]; Region: PurR; COG1609
759913005960	Helix-turn-helix (HTH) DNA binding domain of the LacI family of transcriptional regulators; Region: HTH_LacI; cd01392
759913005961	DNA binding site [nucleotide binding]
759913005962	domain linker motif; other site
759913005963	Ligand binding domain of the LacI tanscriptional regulator family belonging to the type I periplasmic-binding fold protein superfamily; Region: PBP1_LacI_sugar_binding_like; cd06267
759913005964	dimerization interface [polypeptide binding]; other site
759913005965	ligand binding site [chemical binding]; other site
759913005966	Beta-lactamase; Region: Beta-lactamase; pfam00144
759913005967	Beta-lactamase class C and other penicillin binding proteins [Defense mechanisms]; Region: AmpC; COG1680
759913005968	This domain superfamily is found in a variety of structurally related metalloproteins, including the type I extradiol dioxygenases, glyoxalase I and a group of antibiotic resistance proteins; Region: Glo_EDI_BRP_like; cl14632
759913005969	This domain superfamily is found in a variety of structurally related metalloproteins, including the type I extradiol dioxygenases, glyoxalase I and a group of antibiotic resistance proteins; Region: Glo_EDI_BRP_like; cl14632
759913005970	active site
759913005971	Major intrinsic protein (MIP) superfamily. Members of the MIP superfamily function as membrane channels that selectively transport water, small neutral molecules, and ions out of and between cells. The channel proteins share a common fold: the N-terminal...; Region: MIP; cd00333
759913005972	amphipathic channel; other site
759913005973	Asn-Pro-Ala signature motifs; other site
759913005974	x-prolyl-dipeptidyl aminopeptidase; Provisional; Region: PRK05371
759913005975	X-Prolyl dipeptidyl aminopeptidase PepX, N-terminal; Region: PepX_N; pfam09168
759913005976	X-Pro dipeptidyl-peptidase C-terminal non-catalytic domain; Region: PepX_C; pfam08530
759913005977	Pyridoxine 5'-phosphate (PNP) oxidase-like proteins; Region: PNPOx_like; cl00381
759913005978	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
759913005979	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
759913005980	non-specific DNA binding site [nucleotide binding]; other site
759913005981	salt bridge; other site
759913005982	sequence-specific DNA binding site [nucleotide binding]; other site
759913005983	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
759913005984	non-specific DNA binding site [nucleotide binding]; other site
759913005985	salt bridge; other site
759913005986	sequence-specific DNA binding site [nucleotide binding]; other site
759913005987	hypothetical protein; Validated; Region: PRK00153
759913005988	Helix-Turn-Helix DNA binding domain of the transcription regulators TipAL, Mta, and SkgA; Region: HTH_TipAL-Mta; cd01106
759913005989	MerR HTH family regulatory protein; Region: MerR_1; pfam13411
759913005990	DNA binding residues [nucleotide binding]
759913005991	dimer interface [polypeptide binding]; other site
759913005992	DNA polymerase III, epsilon subunit and related 3'-5' exonucleases [DNA replication, recombination, and repair]; Region: DnaQ; COG0847
759913005993	DEDDh 3'-5' exonuclease domain family; Region: DEDDh; cd06127
759913005994	active site
759913005995	catalytic site [active]
759913005996	substrate binding site [chemical binding]; other site
759913005997	HTH domain; Region: HTH_11; cl17392
759913005998	HI0933-like protein; Region: HI0933_like; pfam03486
759913005999	Chromate resistance exported protein; Region: Chrome_Resist; cl01744
759913006000	DNA-directed RNA polymerase, subunit A'' Region: RNA_pol_rpoA2; TIGR02389
759913006001	30S ribosomal protein S14; Reviewed; Region: rpsN; PRK08881
759913006002	UGMP family protein; Validated; Region: PRK09604
759913006003	Inactive homolog of metal-dependent proteases, putative molecular chaperone [Posttranslational modification, protein turnover, chaperones]; Region: COG1214; cl17884
759913006004	Acetyltransferase (GNAT) domain; Region: Acetyltransf_10; pfam13673
759913006005	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
759913006006	Coenzyme A binding pocket [chemical binding]; other site
759913006007	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cl17182
759913006008	Inactive homolog of metal-dependent proteases, putative molecular chaperone [Posttranslational modification, protein turnover, chaperones]; Region: COG1214
759913006009	Glycoprotease family; Region: Peptidase_M22; pfam00814
759913006010	hypothetical protein; Provisional; Region: PRK13667
759913006011	mRNA degradation ribonucleases J1/J2 (metallo-beta-lactamase superfamily) [Translation, ribosomal structure and biogenesis; Replication, recombination and repair]; Region: COG0595
759913006012	Metallo-beta-lactamase superfamily; Region: Lactamase_B; smart00849
759913006013	RNA-metabolising metallo-beta-lactamase; Region: RMMBL; pfam07521
759913006014	ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component [Amino acid transport and metabolism / Inorganic ion transport and metabolism]; Region: DppF; COG1124
759913006015	ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257
759913006016	Walker A/P-loop; other site
759913006017	ATP binding site [chemical binding]; other site
759913006018	Q-loop/lid; other site
759913006019	ABC transporter signature motif; other site
759913006020	Walker B; other site
759913006021	D-loop; other site
759913006022	H-loop/switch region; other site
759913006023	Oligopeptide/dipeptide transporter, C-terminal region; Region: oligo_HPY; pfam08352
759913006024	ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component [Amino acid transport and metabolism / Inorganic ion transport and metabolism]; Region: DppD; COG0444
759913006025	ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257
759913006026	Walker A/P-loop; other site
759913006027	ATP binding site [chemical binding]; other site
759913006028	Q-loop/lid; other site
759913006029	ABC transporter signature motif; other site
759913006030	Walker B; other site
759913006031	D-loop; other site
759913006032	H-loop/switch region; other site
759913006033	Oligopeptide/dipeptide transporter, C-terminal region; Region: oligo_HPY; cl07097
759913006034	ABC-type dipeptide/oligopeptide/nickel transport systems, permease components [Amino acid transport and metabolism / Inorganic ion transport and metabolism]; Region: DppC; COG1173
759913006035	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
759913006036	dimer interface [polypeptide binding]; other site
759913006037	conserved gate region; other site
759913006038	putative PBP binding loops; other site
759913006039	ABC-ATPase subunit interface; other site
759913006040	ABC-type dipeptide/oligopeptide/nickel transport systems, permease components [Amino acid transport and metabolism / Inorganic ion transport and metabolism]; Region: DppB; COG0601
759913006041	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
759913006042	dimer interface [polypeptide binding]; other site
759913006043	conserved gate region; other site
759913006044	putative PBP binding loops; other site
759913006045	ABC-ATPase subunit interface; other site
759913006046	ABC-type oligopeptide transport system, periplasmic component [Amino acid transport and metabolism]; Region: OppA; COG4166
759913006047	The substrate-binding component of an ABC-type oligopetide import system contains the type 2 periplasmic binding fold; Region: PBP2_OppA; cd08504
759913006048	peptide binding site [polypeptide binding]; other site
759913006049	Glutamine synthetase [Amino acid transport and metabolism]; Region: GlnA; COG0174
759913006050	Glutamine synthetase, beta-Grasp domain; Region: Gln-synt_N; pfam03951
759913006051	Glutamine synthetase, catalytic domain; Region: Gln-synt_C; pfam00120
759913006052	Helix-Turn-Helix DNA binding domain of GlnR-like transcription regulators; Region: HTH_GlnR-like; cd01105
759913006053	MerR HTH family regulatory protein; Region: MerR_1; pfam13411
759913006054	DNA binding residues [nucleotide binding]
759913006055	putative dimer interface [polypeptide binding]; other site
759913006056	Bacterial protein of unknown function (DUF939); Region: DUF939; pfam06081
759913006057	Fusaric acid resistance protein-like; Region: FUSC_2; pfam13515
759913006058	phosphoglycerate kinase; Provisional; Region: pgk; PRK00073
759913006059	Phosphoglycerate kinase; Region: PGK; pfam00162
759913006060	substrate binding site [chemical binding]; other site
759913006061	hinge regions; other site
759913006062	ADP binding site [chemical binding]; other site
759913006063	catalytic site [active]
759913006064	5'-nucleotidase, lipoprotein e(P4) family; Region: lipo_e_P4; TIGR01533
759913006065	Glyceraldehyde-3-phosphate dehydrogenase/erythrose-4-phosphate dehydrogenase [Carbohydrate transport and metabolism]; Region: GapA; COG0057
759913006066	Glyceraldehyde 3-phosphate dehydrogenase, NAD binding domain; Region: Gp_dh_N; smart00846
759913006067	Glyceraldehyde 3-phosphate dehydrogenase, C-terminal domain; Region: Gp_dh_C; pfam02800
759913006068	elongation factor G; Reviewed; Region: PRK00007
759913006069	Elongation factor G (EF-G) family involved in both the elongation and ribosome recycling phases of protein synthesis; Region: EF-G; cd01886
759913006070	G1 box; other site
759913006071	putative GEF interaction site [polypeptide binding]; other site
759913006072	GTP/Mg2+ binding site [chemical binding]; other site
759913006073	Switch I region; other site
759913006074	G2 box; other site
759913006075	G3 box; other site
759913006076	Switch II region; other site
759913006077	G4 box; other site
759913006078	G5 box; other site
759913006079	EFG_mtEFG_II: this subfamily represents the domain II of elongation factor G (EF-G) in bacteria and, the C-terminus of mitochondrial Elongation factor G1 (mtEFG1) and G2 (mtEFG2)_like proteins found in eukaryotes. During the process of peptide synthesis...; Region: EFG_mtEFG_II; cd04088
759913006080	EFG_mtEFG1_IV: domains similar to domain IV of the bacterial translational elongation factor (EF) EF-G. Included in this group is a domain of mitochondrial Elongation factor G1 (mtEFG1) proteins homologous to domain IV of EF-G. Eukaryotic cells harbor 2...; Region: EFG_mtEFG1_IV; cd01434
759913006081	EFG_mtEFG_C: domains similar to the C-terminal domain of the bacterial translational elongation factor (EF) EF-G.  Included in this group is the C-terminus of mitochondrial Elongation factor G1 (mtEFG1) and G2 (mtEFG2) proteins. Eukaryotic cells harbor 2...; Region: EFG_mtEFG_C; cd03713
759913006082	30S ribosomal protein S7; Validated; Region: PRK05302
759913006083	S12-like family, 30S ribosomal protein S12 subfamily; S12 is located at the interface of the large and small ribosomal subunits of prokaryotes, chloroplasts and mitochondria, where it plays an important role in both tRNA and ribosomal subunit...; Region: Ribosomal_S12; cd03368
759913006084	S17 interaction site [polypeptide binding]; other site
759913006085	S8 interaction site; other site
759913006086	16S rRNA interaction site [nucleotide binding]; other site
759913006087	streptomycin interaction site [chemical binding]; other site
759913006088	23S rRNA interaction site [nucleotide binding]; other site
759913006089	aminoacyl-tRNA interaction site (A-site) [nucleotide binding]; other site
759913006090	SEC10/PgrA surface exclusion domain; Region: Surf_Exclu_PgrA; TIGR04320
759913006091	pur operon repressor; Provisional; Region: PRK09213
759913006092	Bacterial purine repressor, N-terminal; Region: PuR_N; pfam09182
759913006093	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
759913006094	active site
759913006095	Predicted HD-superfamily hydrolase [General function prediction only]; Region: COG3481
759913006096	YhaM_OBF_like: A subfamily of OB folds similar to that found in Bacillus subtilis YhaM and Staphylococcus aureus cmp-binding factor-1 (SaCBF1). Both these proteins are 3'-to-5'exoribonucleases. YhaM requires Mn2+ or Co2+ for activity and is...; Region: YhaM_OBF_like; cd04492
759913006097	generic binding surface II; other site
759913006098	generic binding surface I; other site
759913006099	Metal dependent phosphohydrolases with conserved 'HD' motif; Region: HDc; cd00077
759913006100	Zn2+ binding site [ion binding]; other site
759913006101	Mg2+ binding site [ion binding]; other site
759913006102	Predicted nuclease of restriction endonuclease-like fold, RmuC family [General function prediction only]; Region: COG1322
759913006103	RmuC family; Region: RmuC; pfam02646
759913006104	Thiamine pyrophosphokinase [Coenzyme metabolism]; Region: THI80; COG1564
759913006105	Thiamine pyrophosphokinase; Region: TPK; cd07995
759913006106	active site
759913006107	dimerization interface [polypeptide binding]; other site
759913006108	thiamine binding site [chemical binding]; other site
759913006109	Pentose-5-phosphate-3-epimerase [Carbohydrate transport and metabolism]; Region: Rpe; COG0036
759913006110	Ribulose-5-phosphate 3-epimerase (RPE). This enzyme catalyses the interconversion of D-ribulose 5-phosphate (Ru5P) into D-xylulose 5-phosphate, as part of the Calvin cycle (reductive pentose phosphate pathway) in chloroplasts and in the oxidative pentose...; Region: RPE; cd00429
759913006111	substrate binding site [chemical binding]; other site
759913006112	hexamer interface [polypeptide binding]; other site
759913006113	metal binding site [ion binding]; metal-binding site
759913006114	GTPase RsgA; Reviewed; Region: PRK00098
759913006115	S1_YloQ_GTPase: YloQ GTase family (also known as YjeQ and CpgA), S1-like RNA-binding domain. Proteins in the YloQ GTase family bind the ribosome and have GTPase activity. The precise role of this family is unknown. The protein structure is composed of...; Region: S1_YloQ_GTPase; cd04466
759913006116	RNA binding site [nucleotide binding]; other site
759913006117	homodimer interface [polypeptide binding]; other site
759913006118	Ribosomal interacting GTPase YjeQ/EngC, a circularly permuted subfamily of the Ras GTPases; Region: YjeQ_EngC; cd01854
759913006119	GTPase/Zn-binding domain interface [polypeptide binding]; other site
759913006120	GTP/Mg2+ binding site [chemical binding]; other site
759913006121	G4 box; other site
759913006122	G1 box; other site
759913006123	Switch I region; other site
759913006124	G2 box; other site
759913006125	G3 box; other site
759913006126	Switch II region; other site
759913006127	16S ribosomal RNA methyltransferase KsgA/Dim1 family protein; Reviewed; Region: ksgA; PRK00274
759913006128	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
759913006129	S-adenosylmethionine binding site [chemical binding]; other site
759913006130	ribonuclease M5; Region: 5S_RNA_mat_M5; TIGR00334
759913006131	TOPRIM_ RNase M5_like: The topoisomerase-primase (TOPRIM) nucleotidyl transferase/hydrolase domain found in Ribonuclease M5: (RNase M5) and other small primase-like proteins from bacteria and archaea.  RNase M5 catalyzes the maturation of 5S rRNA in low...; Region: TOPRIM_RNase_M5_like; cd01027
759913006132	putative active site [active]
759913006133	putative metal binding site [ion binding]; other site
759913006134	Domain of unknown function (DUF4093); Region: DUF4093; pfam13331
759913006135	TatD like proteins;  E.coli TatD is a cytoplasmic protein, shown to have magnesium dependent DNase activity; Region: TatD_DNAse; cd01310
759913006136	active site
759913006137	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3666
759913006138	Transposase DDE domain; Region: DDE_Tnp_1; pfam01609
759913006139	Transposase DDE domain; Region: DDE_Tnp_1_6; pfam13751
759913006140	Isochorismatase family; Region: Isochorismatase; pfam00857
759913006141	Cysteine hydrolases; This family contains amidohydrolases, like CSHase (N-carbamoylsarcosine amidohydrolase), involved in creatine metabolism and nicotinamidase, converting nicotinamide to nicotinic acid and ammonia in the pyridine nucleotide cycle. It...; Region: cysteine_hydrolases; cd00431
759913006142	catalytic triad [active]
759913006143	conserved cis-peptide bond; other site
759913006144	Transcriptional regulators [Transcription]; Region: RpiR; COG1737
759913006145	Helix-turn-helix domain, rpiR family; Region: HTH_6; pfam01418
759913006146	RpiR-like protein. RpiR contains a SIS (Sugar ISomerase) domain, which is found in many phosphosugar isomerases and phosphosugar binding proteins. In E. coli, rpiR negatively regulates the expression of rpiB gene. Both rpiB and rpiA are ribose phosphate...; Region: SIS_RpiR; cd05013
759913006147	putative active site [active]
759913006148	Transcriptional regulator/sugar kinase [Transcription / Carbohydrate transport and metabolism]; Region: NagC; COG1940
759913006149	Nucleotide-Binding Domain of the sugar kinase/HSP70/actin superfamily; Region: NBD_sugar-kinase_HSP70_actin; cd00012
759913006150	nucleotide binding site [chemical binding]; other site
759913006151	Dihydrodipicolinate synthase/N-acetylneuraminate lyase [Amino acid transport and metabolism / Cell envelope biogenesis, outer membrane]; Region: DapA; COG0329
759913006152	Class I aldolases; Region: Aldolase_Class_I; cl17187
759913006153	catalytic residue [active]
759913006154	Protein of unknown function, DUF624; Region: DUF624; pfam04854
759913006155	Domain of unknown function (DUF386); Region: DUF386; cl01047
759913006156	ABC-type sugar transport system, permease component [Carbohydrate transport and metabolism]; Region: UgpE; COG0395
759913006157	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
759913006158	dimer interface [polypeptide binding]; other site
759913006159	conserved gate region; other site
759913006160	putative PBP binding loops; other site
759913006161	ABC-ATPase subunit interface; other site
759913006162	ABC-type polysaccharide transport system, permease component [Carbohydrate transport and metabolism]; Region: LplB; COG4209
759913006163	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
759913006164	dimer interface [polypeptide binding]; other site
759913006165	ABC-ATPase subunit interface; other site
759913006166	putative PBP binding loops; other site
759913006167	ABC-type sugar transport system, periplasmic component [Carbohydrate transport and metabolism]; Region: UgpB; COG1653
759913006168	Bacterial extracellular solute-binding protein; Region: SBP_bac_1; pfam01547
759913006169	N-acetylmannosamine-6-phosphate epimerase (NanE) converts N-acetylmannosamine-6-phosphate to N-acetylglucosamine-6-phosphate. This reaction is part of the pathway that allows the usage of sialic acid as a carbohydrate source. Sialic acids are a family of...; Region: NanE; cd04729
759913006170	N-acetylmannosamine-6-phosphate 2-epimerase; Provisional; Region: PRK01130
759913006171	putative active site cavity [active]
759913006172	Ribosomal protein L34; Region: Ribosomal_L34; cl00370
759913006173	Predicted RNA-binding protein [General function prediction only]; Region: Jag; COG1847
759913006174	jag_K homology RNA-binding domain. The KH domain is found in proteins homologous to the Bacillus subtilis protein Jag, which is associated with SpoIIIJ and is necessary for the third stage of sporulation.  The KH motif is a beta-alpha-alpha-beta-beta...; Region: jag_KH; cd02414
759913006175	G-X-X-G motif; other site
759913006176	R3H domain found in proteins homologous to Bacillus subtilus Jag, which is associated with SpoIIIJ. SpoIIIJ is necessary for the third stage of sporulation. The name of the R3H domain comes from the characteristic spacing of the most conserved arginine...; Region: R3H_jag; cd02644
759913006177	RxxxH motif; other site
759913006178	Preprotein translocase subunit YidC [Intracellular trafficking and secretion]; Region: YidC; COG0706
759913006179	membrane protein insertase, YidC/Oxa1 family, C-terminal domain; Region: yidC_oxa1_cterm; TIGR03592
759913006180	ribonuclease P; Reviewed; Region: rnpA; PRK00499
759913006181	Response regulator of the LytR/AlgR family [Transcription / Signal transduction mechanisms]; Region: LytT; COG3279
759913006182	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
759913006183	active site
759913006184	phosphorylation site [posttranslational modification]
759913006185	intermolecular recognition site; other site
759913006186	dimerization interface [polypeptide binding]; other site
759913006187	LytTr DNA-binding domain; Region: LytTR; pfam04397
759913006188	Predicted signal transduction protein with a C-terminal ATPase domain [Signal transduction mechanisms]; Region: COG2972
759913006189	Predicted signal transduction protein with a C-terminal ATPase domain [Signal transduction mechanisms]; Region: COG2972
759913006190	Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase; Region: HATPase_c; pfam02518
759913006191	glutamyl-tRNA synthetase; Reviewed; Region: gltX; PRK01406
759913006192	catalytic core domain of discriminating glutamyl-tRNA synthetase; Region: GluRS_core; cd00808
759913006193	active site
759913006194	HIGH motif; other site
759913006195	catalytic core domain of discriminating glutamyl-tRNA synthetase; Region: GluRS_core; cd00808
759913006196	active site
759913006197	KMSKS motif; other site
759913006198	PTS_IIA, PTS system, mannose/sorbose specific IIA subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This family...; Region: PTS_IIA_man; cl00025
759913006199	H+ Antiporter protein; Region: 2A0121; TIGR00900
759913006200	LytTr DNA-binding domain; Region: LytTR; cl04498
759913006201	Uncharacterized conserved protein [Function unknown]; Region: COG2013
759913006202	Carbonic anhydrases (CA) are zinc-containing enzymes that catalyze the reversible hydration of carbon dioxide in a two-step mechanism in which the nucleophilic attack of a zinc-bound hydroxide ion on carbon dioxide is followed by the regeneration of an...; Region: beta_CA_cladeD; cd03379
759913006203	active site clefts [active]
759913006204	zinc binding site [ion binding]; other site
759913006205	dimer interface [polypeptide binding]; other site
759913006206	Sms (bacterial radA) DNA repair protein. This protein is not related to archael radA any more than is to other RecA-like NTPases. Sms has a role in recombination and recombinational repair and is responsible for the stabilization or processing of...; Region: Sms; cd01121
759913006207	DNA repair protein RadA; Provisional; Region: PRK11823
759913006208	Walker A motif/ATP binding site; other site
759913006209	ATP binding site [chemical binding]; other site
759913006210	Walker B motif; other site
759913006211	Subunit ChlI of Mg-chelatase; Region: ChlI; pfam13541
759913006212	Trimeric dUTP diphosphatases; Region: trimeric_dUTPase; cd07557
759913006213	trimer interface [polypeptide binding]; other site
759913006214	active site
759913006215	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG1636
759913006216	ABC-type multidrug transport system, ATPase and permease components [Defense mechanisms]; Region: MdlB; COG1132
759913006217	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
759913006218	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
759913006219	Walker A/P-loop; other site
759913006220	ATP binding site [chemical binding]; other site
759913006221	Q-loop/lid; other site
759913006222	ABC transporter signature motif; other site
759913006223	Walker B; other site
759913006224	D-loop; other site
759913006225	H-loop/switch region; other site
759913006226	ABC-type multidrug transport system, ATPase and permease components [Defense mechanisms]; Region: MdlB; COG1132
759913006227	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
759913006228	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
759913006229	Walker A/P-loop; other site
759913006230	ATP binding site [chemical binding]; other site
759913006231	Q-loop/lid; other site
759913006232	ABC transporter signature motif; other site
759913006233	Walker B; other site
759913006234	D-loop; other site
759913006235	H-loop/switch region; other site
759913006236	helix_turn_helix multiple antibiotic resistance protein; Region: HTH_MARR; smart00347
759913006237	MarR family; Region: MarR_2; pfam12802
759913006238	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase; Validated; Region: gpsA; PRK00094
759913006239	NAD-dependent glycerol-3-phosphate dehydrogenase N-terminus; Region: NAD_Gly3P_dh_N; pfam01210
759913006240	NAD-dependent glycerol-3-phosphate dehydrogenase C-terminus; Region: NAD_Gly3P_dh_C; pfam07479
759913006241	Prokaryotic UGPase catalyses the synthesis of UDP-glucose; Region: UGPase_prokaryotic; cd02541
759913006242	dTDP-glucose pyrophosphorylase [Cell envelope biogenesis, outer membrane]; Region: RfbA; COG1209
759913006243	active site
759913006244	tetramer interface; other site
759913006245	Predicted membrane protein [Function unknown]; Region: COG2364
759913006246	Membrane associated serine protease [Amino acid transport and metabolism]; Region: COG0705
759913006247	5-formyltetrahydrofolate cyclo-ligase family; Region: 5-FTHF_cyc-lig; pfam01812
759913006248	5,10-methenyltetrahydrofolate synthetase; Region: MTHFS_bact; TIGR02727
759913006249	Fibronectin-binding protein signal sequence; Region: Fb_signal; pfam08341
759913006250	TQXA domain; Region: TQXA_dom; TIGR03934
759913006251	Fibronectin binding repeat; Region: Fn_bind; pfam02986
759913006252	Fibronectin binding repeat; Region: Fn_bind; pfam02986
759913006253	Fibronectin binding repeat; Region: Fn_bind; pfam02986
759913006254	Gram positive anchor; Region: Gram_pos_anchor; pfam00746
759913006255	Transposase and inactivated derivatives, IS30 family [DNA replication, recombination, and repair]; Region: Tra8; COG2826
759913006256	Helix-turn-helix domain; Region: HTH_38; pfam13936
759913006257	Integrase core domain; Region: rve; pfam00665
759913006258	M protein trans-acting positive regulator (MGA) HTH domain; Region: HTH_Mga; pfam08280
759913006259	Mga helix-turn-helix domain; Region: Mga; pfam05043
759913006260	M protein trans-acting positive regulator (MGA) PRD domain; Region: PRD_Mga; pfam08270
759913006261	Transposase and inactivated derivatives, IS30 family [DNA replication, recombination, and repair]; Region: Tra8; COG2826
759913006262	Helix-turn-helix domain; Region: HTH_38; pfam13936
759913006263	Integrase core domain; Region: rve; pfam00665
759913006264	glucose-6-phosphate isomerase; Provisional; Region: pgi; PRK14097
759913006265	Phosphoglucose isomerase (PGI) contains two SIS (Sugar ISomerase) domains. This classification is based on the alignment of the first SIS domain. PGI is a multifunctional enzyme which as an intracellular dimer catalyzes the reversible isomerization of...; Region: SIS_PGI_1; cd05015
759913006266	active site
759913006267	dimer interface [polypeptide binding]; other site
759913006268	Phosphoglucose isomerase (PGI) contains two SIS (Sugar ISomerase) domains. This classification is based on the alignment of the second SIS domain. PGI is a multifunctional enzyme which as an intracellular dimer catalyzes the reversible isomerization of...; Region: SIS_PGI_2; cd05016
759913006269	dimer interface [polypeptide binding]; other site
759913006270	active site
759913006271	TlpA-like family; composed of  TlpA, ResA, DsbE and similar proteins. TlpA, ResA and DsbE are bacterial protein disulfide reductases with important roles in cytochrome maturation. They are membrane-anchored proteins with a soluble TRX domain containing a...; Region: TlpA_like_family; cd02966
759913006272	Thioredoxin-like; Region: Thioredoxin_8; pfam13905
759913006273	catalytic residues [active]
759913006274	Staphylococcal/Streptococcal toxin, OB-fold domain; Region: Stap_Strp_toxin; pfam01123
759913006275	Staphylococcal/Streptococcal toxin, beta-grasp domain; Region: Stap_Strp_tox_C; pfam02876
759913006276	Uncharacterized protein involved in cytokinesis, contains TGc (transglutaminase/protease-like) domain [Cell division and chromosome partitioning]; Region: CYK3; COG5279
759913006277	Uncharacterized protein involved in cytokinesis, contains TGc (transglutaminase/protease-like) domain [Cell division and chromosome partitioning]; Region: CYK3; COG5279
759913006278	Transglutaminase/protease-like homologues; Region: TGc; smart00460
759913006279	Nucleoside deaminases include adenosine, guanine and cytosine deaminases. These enzymes are Zn dependent and catalyze the deamination of nucleosides. The zinc ion in the active site plays a central role in the proposed catalytic mechanism, activating a...; Region: nucleoside_deaminase; cd01285
759913006280	nucleoside/Zn binding site; other site
759913006281	dimer interface [polypeptide binding]; other site
759913006282	catalytic motif [active]
759913006283	Metal-dependent hydrolases of the beta-lactamase superfamily III [General function prediction only]; Region: ElaC; COG1234
759913006284	Predicted Zn-dependent hydrolases of the beta-lactamase fold [General function prediction only]; Region: COG2220
759913006285	Uncharacterized conserved protein [General function prediction only]; Region: BioY; COG1268
759913006286	Zinc finger domain containing protein (CHY type) [Function unknown]; Region: COG4357
759913006287	CHY zinc finger; Region: zf-CHY; pfam05495
759913006288	queuine tRNA-ribosyltransferase; Provisional; Region: tgt; PRK00112
759913006289	Queuine/archaeosine tRNA-ribosyltransferase [Translation, ribosomal structure and biogenesis]; Region: Tgt; COG0343
759913006290	Protein of unknown function (DUF975); Region: DUF975; pfam06161
759913006291	Ferric uptake regulator(Fur) and related metalloregulatory proteins; typically iron-dependent, DNA-binding repressors and activators; Region: Fur_like; cd07153
759913006292	metal binding site 2 [ion binding]; metal-binding site
759913006293	putative DNA binding helix; other site
759913006294	metal binding site 1 [ion binding]; metal-binding site
759913006295	dimer interface [polypeptide binding]; other site
759913006296	structural Zn2+ binding site [ion binding]; other site
759913006297	Predicted CoA-binding protein [General function prediction only]; Region: COG1832
759913006298	DNA polymerase I; Provisional; Region: PRK05755
759913006299	PIN domain of the 5'-3' exonuclease of Taq DNA polymerase I and homologs; Region: PIN_53EXO; cd09859
759913006300	active site
759913006301	putative 5' ssDNA interaction site; other site
759913006302	metal binding site 3; metal-binding site
759913006303	metal binding site 1 [ion binding]; metal-binding site
759913006304	metal binding site 2 [ion binding]; metal-binding site
759913006305	H3TH domain of the 5'-3' exonuclease of Taq DNA polymerase I and homologs; Region: H3TH_53EXO; cd09898
759913006306	putative DNA binding site [nucleotide binding]; other site
759913006307	putative metal binding site [ion binding]; other site
759913006308	inactive DEDDy 3'-5' exonuclease domain of Bacillus stearothermophilus DNA polymerase I and similar family-A DNA polymerases; Region: DNA_polA_I_Bacillus_like_exo; cd06140
759913006309	Polymerase I functions primarily to fill DNA gaps that arise during DNA repair, recombination and replication; Region: DNA_pol_A_pol_I_C; cd08637
759913006310	active site
759913006311	DNA binding site [nucleotide binding]
759913006312	catalytic site [active]
759913006313	ABC-type nitrate/sulfonate/bicarbonate transport system, permease component [Inorganic ion transport and metabolism]; Region: TauC; COG0600
759913006314	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
759913006315	dimer interface [polypeptide binding]; other site
759913006316	conserved gate region; other site
759913006317	putative PBP binding loops; other site
759913006318	ABC-ATPase subunit interface; other site
759913006319	ABC-type proline/glycine betaine transport systems, periplasmic components [Amino acid transport and metabolism]; Region: ProX; COG2113
759913006320	Substrate binding domain of ABC-type glycine betaine transport system; Region: OpuAC; pfam04069
759913006321	ABC-type proline/glycine betaine transport system, ATPase component [Amino acid transport and metabolism]; Region: ProV; COG4175
759913006322	ATP-binding cassette domain of the osmoprotectant proline/glycine betaine uptake system; Region: ABC_Pro_Gly_Betaine; cd03294
759913006323	Walker A/P-loop; other site
759913006324	ATP binding site [chemical binding]; other site
759913006325	Q-loop/lid; other site
759913006326	ABC transporter signature motif; other site
759913006327	Walker B; other site
759913006328	D-loop; other site
759913006329	H-loop/switch region; other site
759913006330	The CBS domain, named after human CBS, is a small domain originally identified in cystathionine beta-synthase and is subsequently found in a wide range of different proteins. CBS domains usually occur in tandem repeats. They associate to form a so-called...; Region: CBS_pair; cl15354
759913006331	Sphingosine kinase and enzymes related to eukaryotic diacylglycerol kinase [Lipid metabolism / General function prediction only]; Region: LCB5; COG1597
759913006332	Diacylglycerol kinase catalytic domain; Region: DAGK_cat; pfam00781
759913006333	putative L-ascorbate 6-phosphate lactonase; Provisional; Region: PRK11709
759913006334	Predicted Zn-dependent hydrolases of the beta-lactamase fold [General function prediction only]; Region: COG2220
759913006335	Transcriptional antiterminator [Transcription]; Region: BglG; COG3711
759913006336	PRD domain; Region: PRD; pfam00874
759913006337	PRD domain; Region: PRD; pfam00874
759913006338	PTS_IIB_bgl_like: the PTS (phosphotransferase system) IIB domain of a family of sensory systems composed of a membrane-bound sugar-sensor (similar to BglF) and a transcription antiterminator (similar to BglG) which regulate expression of genes involved...; Region: PTS_IIB_bgl_like; cd05568
759913006339	active site
759913006340	P-loop; other site
759913006341	phosphorylation site [posttranslational modification]
759913006342	L-ribulose-5-phosphate 4-epimerase; Provisional; Region: araD; PRK13145
759913006343	L-ribulose-5-phosphate 4-epimerase; Reviewed; Region: araD; PRK08193
759913006344	intersubunit interface [polypeptide binding]; other site
759913006345	active site
759913006346	Zn2+ binding site [ion binding]; other site
759913006347	putative L-xylulose 5-phosphate 3-epimerase; Reviewed; Region: PRK13210
759913006348	AP endonuclease family 2; These endonucleases play a role in DNA repair. Cleave phosphodiester bonds at apurinic or apyrimidinic sites; the alignment also contains hexulose-6-phosphate isomerases, enzymes that catalyze the epimerization of...; Region: AP2Ec; cd00019
759913006349	AP (apurinic/apyrimidinic) site pocket; other site
759913006350	DNA interaction; other site
759913006351	Metal-binding active site; metal-binding site
759913006352	3-Keto-L-gulonate 6-phosphate decarboxylase (KGPDC) and D-arabino-3-hexulose-6-phosphate synthase (HPS). KGPDC catalyzes the formation of L-xylulose 5-phosphate and carbon dioxide from 3-keto-L-gulonate 6-phosphate as part of the anaerobic pathway for...; Region: KGPDC_HPS; cd04726
759913006353	active site
759913006354	dimer interface [polypeptide binding]; other site
759913006355	magnesium binding site [ion binding]; other site
759913006356	PTS_IIA, PTS system, fructose/mannitol specific IIA subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This...; Region: PTS_IIA_fru; cd00211
759913006357	active site
759913006358	phosphorylation site [posttranslational modification]
759913006359	PTS_IIB_ascorbate: subunit IIB of enzyme II (EII) of the L-ascorbate-specific phosphoenolpyruvate:carbohydrate phosphotransferase system (PTS). In this system, EII is an L-ascorbate-specific permease with two cytoplasmic subunits (IIA and IIB) and a...; Region: PTS_IIB_ascorbate; cd05563
759913006360	active site
759913006361	P-loop; other site
759913006362	phosphorylation site [posttranslational modification]
759913006363	PTS system ascorbate-specific transporter subunit IIC; Reviewed; Region: PRK12997
759913006364	leucyl-tRNA synthetase; Validated; Region: leuS; PRK00390
759913006365	catalytic core domain of leucyl-tRNA synthetases; Region: LeuRS_core; cd00812
759913006366	HIGH motif; other site
759913006367	Leucyl-tRNA synthetase, Domain 2; Region: tRNA-synt_1_2; pfam13603
759913006368	nucleotidyl transferase superfamily; Region: nt_trans; cl00015
759913006369	nucleotidyl transferase superfamily; Region: nt_trans; cl00015
759913006370	active site
759913006371	KMSKS motif; other site
759913006372	Anticodon-binding domain of bacterial and eukaryotic mitochondrial leucyl tRNA synthetases; Region: Anticodon_Ia_Leu_BEm; cd07958
759913006373	tRNA binding surface [nucleotide binding]; other site
759913006374	Aspartate aminotransferase (AAT) superfamily (fold type I) of pyridoxal phosphate (PLP)-dependent enzymes. PLP combines with an alpha-amino acid to form a compound called a Schiff base or aldimine intermediate, which depending on the reaction, is the...; Region: AAT_I; cl00321
759913006375	Cystathionine beta-lyases/cystathionine gamma-synthases [Amino acid transport and metabolism]; Region: MetC; COG0626
759913006376	Aspartate aminotransferase (AAT) superfamily (fold type I) of pyridoxal phosphate (PLP)-dependent enzymes. PLP combines with an alpha-amino acid to form a compound called a Schiff base or aldimine intermediate, which depending on the reaction, is the...; Region: AAT_I; cl00321
759913006377	catalytic residue [active]
759913006378	Transposase and inactivated derivatives, IS30 family [DNA replication, recombination, and repair]; Region: Tra8; COG2826
759913006379	Helix-turn-helix domain; Region: HTH_38; pfam13936
759913006380	Integrase core domain; Region: rve; pfam00665
759913006381	Transposase; Region: HTH_Tnp_1; pfam01527
759913006382	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG2963
759913006383	HTH-like domain; Region: HTH_21; pfam13276
759913006384	Integrase core domain; Region: rve; pfam00665
759913006385	Integrase core domain; Region: rve_3; pfam13683
759913006386	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
759913006387	ABC-type antimicrobial peptide transport system, ATPase component [Defense mechanisms]; Region: SalX; COG1136
759913006388	ATP-binding cassette domain of multidrug resistance protein-like transporters; Region: ABCC_MRP_Like; cd03228
759913006389	Walker A/P-loop; other site
759913006390	ATP binding site [chemical binding]; other site
759913006391	Q-loop/lid; other site
759913006392	ABC transporter signature motif; other site
759913006393	Walker B; other site
759913006394	D-loop; other site
759913006395	H-loop/switch region; other site
759913006396	Superfamily of activating enzymes (E1) of the ubiquitin-like proteins. This family includes classical ubiquitin-activating enzymes E1, ubiquitin-like (ubl) activating enzymes and other mechanistic homologes, like MoeB, Thif1 and others. The common...; Region: E1_enzyme_family; cd01483
759913006397	ATP binding site [chemical binding]; other site
759913006398	substrate interface [chemical binding]; other site
759913006399	Transposase DDE domain; Region: DDE_Tnp_1; pfam01609
759913006400	Transposase DDE domain; Region: DDE_Tnp_1_3; pfam13612
759913006401	Transposase DDE domain; Region: DDE_Tnp_1_3; pfam13612
759913006402	Thiol-activated cytolysin; Region: Thiol_cytolysin; pfam01289
759913006403	Nicotine adenine dinucleotide glycohydrolase (NADase); Region: NADase_NGA; pfam07461
759913006404	transcription antitermination protein NusG; Validated; Region: nusG; PRK05609
759913006405	Bacterial N-Utilization Substance G (NusG) N-terminal (NGN) domain, subgroup 1; Region: NGN_Bact_1; cd09891
759913006406	putative homodimer interface [polypeptide binding]; other site
759913006407	NusG contains an NGN domain at its N-terminus and KOW motif at its C-terminus; Region: KOW_NusG; cd06091
759913006408	heterodimer interface [polypeptide binding]; other site
759913006409	homodimer interface [polypeptide binding]; other site
759913006410	Preprotein translocase subunit SecE [Intracellular trafficking and secretion]; Region: SecE; COG0690
759913006411	50S ribosomal protein L33; Validated; Region: rpmG; PRK00504
759913006412	Transglycosylase; Region: Transgly; pfam00912
759913006413	penicillin-binding protein, 1A family; Region: PBP_1a_fam; TIGR02074
759913006414	Penicillin binding protein transpeptidase domain; Region: Transpeptidase; pfam00905
759913006415	YjgF, YER057c, and UK114 belong to a large family of proteins present in bacteria, archaea, and eukaryotes with no definitive function. The conserved domain is similar in structure to chorismate mutase but there is no sequence similarity and no...; Region: YjgF_YER057c_UK114_family; cd00448
759913006416	homotrimer interaction site [polypeptide binding]; other site
759913006417	putative active site [active]
759913006418	Pseudouridylate synthases, 23S RNA-specific [Translation, ribosomal structure and biogenesis]; Region: RluA; COG0564
759913006419	Pseudouridine synthase, RsuA/RluD family; Region: PseudoU_synth_RluCD_like; cd02869
759913006420	active site
759913006421	Predicted membrane protein [Function unknown]; Region: COG4640
759913006422	Dipeptidase [Amino acid transport and metabolism]; Region: PepD; COG4690
759913006423	MutT homolog-1 (MTH1) is a member of the Nudix hydrolase superfamily. MTH1, the mammalian counterpart of MutT, hydrolyzes oxidized purine nucleoside triphosphates, such as 8-oxo-dGTP and 2-hydroxy-ATP, to monophosphates, thereby preventing the...; Region: MTH1; cd03427
759913006424	putative active site [active]
759913006425	nucleotide binding site [chemical binding]; other site
759913006426	nudix motif; other site
759913006427	putative metal binding site [ion binding]; other site
759913006428	chaperonin GroEL; Reviewed; Region: groEL; PRK12849
759913006429	GroEL_like type I chaperonin. Chaperonins are involved in productive folding of proteins. They share a common general morphology, a double toroid of 2 stacked rings, each composed of 7-9 subunits. The symmetry of type I is seven-fold and they are found...; Region: GroEL; cd03344
759913006430	ring oligomerisation interface [polypeptide binding]; other site
759913006431	ATP/Mg binding site [chemical binding]; other site
759913006432	stacking interactions; other site
759913006433	hinge regions; other site
759913006434	Chaperonin 10 Kd subunit (cpn10 or GroES); Cpn10 cooperates with chaperonin 60 (cpn60 or GroEL), an ATPase, to assist the folding and assembly of proteins and is found in eubacterial cytosol, as well as in the matrix of mitochondria and chloroplasts. It...; Region: cpn10; cd00320
759913006435	oligomerisation interface [polypeptide binding]; other site
759913006436	mobile loop; other site
759913006437	roof hairpin; other site
759913006438	ATP-binding subunits of Clp protease and DnaK/DnaJ chaperones [Posttranslational modification, protein turnover, chaperones]; Region: clpA; COG0542
759913006439	Clp amino terminal domain; Region: Clp_N; pfam02861
759913006440	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
759913006441	Walker A motif; other site
759913006442	ATP binding site [chemical binding]; other site
759913006443	Walker B motif; other site
759913006444	arginine finger; other site
759913006445	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
759913006446	Walker A motif; other site
759913006447	ATP binding site [chemical binding]; other site
759913006448	Walker B motif; other site
759913006449	C-terminal, D2-small domain, of ClpB protein; Region: ClpB_D2-small; pfam10431
759913006450	Transcriptional repressor of class III stress genes [Transcription]; Region: CtsR; COG4463
759913006451	Cold-Shock Protein (CSP) contains an S1-like cold-shock domain (CSD) that is found in eukaryotes, prokaryotes, and archaea.  CSP's include the major cold-shock proteins CspA and CspB in bacteria and the eukaryotic gene regulatory factor Y-box...; Region: CSP_CDS; cd04458
759913006452	DNA-binding site [nucleotide binding]; DNA binding site
759913006453	RNA-binding motif; other site
759913006454	Amidohydrolase; Region: Amidohydro_2; pfam04909
759913006455	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3666
759913006456	Transposase DDE domain; Region: DDE_Tnp_1; pfam01609
759913006457	Transposase DDE domain; Region: DDE_Tnp_1_6; pfam13751
759913006458	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3666
759913006459	HD domain; Region: HD_4; pfam13328
759913006460	NAD+--asparagine ADP-ribosyltransferase [Signal transduction mechanisms]; Region: COG5585
759913006461	Phage Mu protein F like protein; Region: Phage_Mu_F; cl10072
759913006462	RelA- and SpoT-like ppGpp Synthetases and Hydrolases, catalytic domain; Region: Rel-Spo_like; cl11966
759913006463	metal binding triad [ion binding]; metal-binding site
759913006464	DNA breaking-rejoining enzymes, C-terminal catalytic domain. The DNA breaking-rejoining enzyme superfamily includes type IB topoisomerases and tyrosine recombinases that share the same fold in their catalytic domain containing six conserved active site...; Region: DNA_BRE_C; cl00213
759913006465	DNA binding site [nucleotide binding]
759913006466	active site
759913006467	Int/Topo IB signature motif; other site
759913006468	peroxiredoxin; Region: AhpC; TIGR03137
759913006469	Peroxiredoxin (PRX) family, Typical 2-Cys PRX subfamily; PRXs are thiol-specific antioxidant (TSA) proteins, which confer a protective role in cells through its peroxidase activity by reducing hydrogen peroxide, peroxynitrite, and organic hydroperoxides; Region: PRX_Typ2cys; cd03015
759913006470	dimer interface [polypeptide binding]; other site
759913006471	decamer (pentamer of dimers) interface [polypeptide binding]; other site
759913006472	catalytic triad [active]
759913006473	peroxidatic and resolving cysteines [active]
759913006474	alkyl hydroperoxide reductase subunit F; Provisional; Region: PRK15317
759913006475	Alkyl hydroperoxide reductase F subunit (AhpF) N-terminal domain (NTD) family, N-terminal TRX-fold subdomain; AhpF is a homodimeric flavoenzyme which catalyzes the NADH-dependent reduction of the peroxiredoxin AhpC, which in turn catalyzes the reduction...; Region: AhpF_NTD_N; cd02974
759913006476	catalytic residue [active]
759913006477	TRX-GRX-like family, Alkyl hydroperoxide reductase F subunit (AhpF) N-terminal domain (NTD) subfamily, C-terminal TRX-fold subdomain; AhpF is a homodimeric flavoenzyme which catalyzes the NADH-dependent reduction of the peroxiredoxin AhpC, which then...; Region: AhpF_NTD_C; cd03026
759913006478	catalytic residues [active]
759913006479	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
759913006480	imidazolonepropionase; Validated; Region: PRK09356
759913006481	Imidazolonepropionase/imidazolone-5-propionate hydrolase (Imidazolone-5PH) catalyzes the third step in the histidine degradation pathway, the hydrolysis of (S)-3-(5-oxo-4,5-dihydro-3H-imidazol-4-yl)propanoate to N-formimidoyl-L-glutamate. In bacteria; Region: Imidazolone-5PH; cd01296
759913006482	active site
759913006483	urocanate hydratase; Provisional; Region: PRK05414
759913006484	Glutamate formiminotransferase [Amino acid transport and metabolism]; Region: COG3643
759913006485	Formiminotransferase domain, N-terminal subdomain; Region: FTCD_N; pfam07837
759913006486	Formiminotransferase domain; Region: FTCD; pfam02971
759913006487	Methenyl tetrahydrofolate cyclohydrolase [Amino acid transport and metabolism]; Region: COG3404
759913006488	formate--tetrahydrofolate ligase; Provisional; Region: PRK13505
759913006489	Formyltetrahydrofolate synthetase (FTHFS) catalyzes the ATP-dependent activation of formate ion via its addition to the N10 position of tetrahydrofolate. FTHFS is a highly expressed key enzyme in both the Wood-Ljungdahl pathway of autotrophic CO2...; Region: FTHFS; cd00477
759913006490	Potassium binding sites [ion binding]; other site
759913006491	Cesium cation binding sites [ion binding]; other site
759913006492	HutD; Region: HutD; cl01532
759913006493	amino acid transporter; Region: 2A0306; TIGR00909
759913006494	Phenylalanine ammonia-lyase (PAL) and histidine ammonia-lyase (HAL); Region: PAL-HAL; cd00332
759913006495	active sites [active]
759913006496	tetramer interface [polypeptide binding]; other site
759913006497	formimidoylglutamase; Provisional; Region: PRK13775
759913006498	Formimidoylglutamase or HutE; Region: Formimidoylglutamase; cd09988
759913006499	putative active site [active]
759913006500	putative metal binding site [ion binding]; other site
759913006501	DNA-binding transcriptional activator of the SARP family [Signal transduction mechanisms]; Region: DnrI; COG3629
759913006502	Predicted ATPase [General function prediction only]; Region: COG3899
759913006503	AAA ATPase domain; Region: AAA_16; pfam13191
759913006504	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cl02429
759913006505	binding surface
759913006506	TPR motif; other site
759913006507	Ribosomal protein S2 (RPS2), involved in formation of the translation initiation complex, where it might contact the messenger RNA and several components of the ribosome. It has been shown that in Escherichia coli RPS2 is essential for the binding of...; Region: RPS2; cd01425
759913006508	rRNA interaction site [nucleotide binding]; other site
759913006509	S8 interaction site; other site
759913006510	putative laminin-1 binding site; other site
759913006511	elongation factor Ts; Provisional; Region: tsf; PRK09377
759913006512	UBA/TS-N domain; Region: UBA; pfam00627
759913006513	Elongation factor TS; Region: EF_TS; pfam00889
759913006514	Elongation factor TS; Region: EF_TS; pfam00889
759913006515	Predicted metalloendopeptidase [Posttranslational modification, protein turnover, chaperones]; Region: PepO; COG3590
759913006516	Peptidase family M13 includes neprilysin, endothelin-converting enzyme I; Region: M13; cd08662
759913006517	active site
759913006518	Zn binding site [ion binding]; other site
759913006519	alpha,alpha-phosphotrehalase; Region: trehalose_treC; TIGR02403
759913006520	Alpha amylase catalytic domain found in Sucrose isomerases, oligo-1,6-glucosidase (also called isomaltase; sucrase-isomaltase; alpha-limit dextrinase), dextran glucosidase (also called glucan 1,6-alpha-glucosidase), and related proteins; Region: AmyAc_SI_OligoGlu_DGase; cd11333
759913006521	Ca binding site [ion binding]; other site
759913006522	active site
759913006523	catalytic site [active]
759913006524	Domain of unknown function (DUF3459); Region: DUF3459; pfam11941
759913006525	PTS system, trehalose-specific IIBC component; Region: PTS-IIBC-Tre; TIGR01992
759913006526	PTS_IIB, PTS system, glucose/sucrose specific IIB subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This family...; Region: PTS_IIB_glc; cd00212
759913006527	active site turn [active]
759913006528	phosphorylation site [posttranslational modification]
759913006529	Phosphotransferase system IIC components, glucose/maltose/N-acetylglucosamine-specific [Carbohydrate transport and metabolism]; Region: PtsG; COG1263
759913006530	Phosphotransferase system IIA components [Carbohydrate transport and metabolism]; Region: NagE; COG2190
759913006531	HPr interaction site; other site
759913006532	glycerol kinase (GK) interaction site [polypeptide binding]; other site
759913006533	active site
759913006534	phosphorylation site [posttranslational modification]
759913006535	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
759913006536	DNA-binding site [nucleotide binding]; DNA binding site
759913006537	trehalose operon repressor, B. subtilis-type; Region: trehalos_R_Bsub; TIGR02404
759913006538	UTRA domain; Region: UTRA; pfam07702
759913006539	HxlR-like helix-turn-helix; Region: HxlR; pfam01638
759913006540	Predicted transcriptional regulators [Transcription]; Region: COG1733
759913006541	This conserved domain belongs to a superfamily including the bleomycin resistance protein, glyoxalase I, and type I ring-cleaving dioxygenases; Region: Glo_EDI_BRP_like_12; cd07255
759913006542	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
759913006543	putative metal binding site [ion binding]; other site
759913006544	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3022
759913006545	anaerobic ribonucleoside-triphosphate reductase activating protein; Region: NrdG; TIGR02491
759913006546	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
759913006547	FeS/SAM binding site; other site
759913006548	Acetyltransferase (GNAT) domain; Region: Acetyltransf_3; pfam13302
759913006549	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
759913006550	Coenzyme A binding pocket [chemical binding]; other site
759913006551	Predicted dehydrogenases and related proteins [General function prediction only]; Region: MviM; COG0673
759913006552	Oxidoreductase family, NAD-binding Rossmann fold; Region: GFO_IDH_MocA; pfam01408
759913006553	anaerobic ribonucleoside triphosphate reductase; Provisional; Region: PRK09263
759913006554	ATP cone domain; Region: ATP-cone; pfam03477
759913006555	Class III ribonucleotide reductase; Region: RNR_III; cd01675
759913006556	effector binding site; other site
759913006557	active site
759913006558	Zn binding site [ion binding]; other site
759913006559	glycine loop; other site
759913006560	Predicted membrane protein (DUF2079); Region: DUF2079; pfam09852
759913006561	hypothetical protein; Provisional; Region: PRK13678
759913006562	Holliday junction resolvase-like protein; Reviewed; Region: PRK00109
759913006563	hypothetical protein; Provisional; Region: PRK05473
759913006564	Arsenate Reductase (ArsC) family, Spx subfamily; Spx is a unique RNA polymerase (RNAP)-binding protein present in bacilli and some mollicutes. It inhibits transcription by binding to the C-terminal domain of the alpha subunit of RNAP, disrupting complex...; Region: ArsC_Spx; cd03032
759913006565	ArsC family; Region: ArsC; pfam03960
759913006566	putative catalytic residues [active]
759913006567	thiol/disulfide switch; other site
759913006568	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3666
759913006569	Transposase DDE domain; Region: DDE_Tnp_1; pfam01609
759913006570	Transposase DDE domain; Region: DDE_Tnp_1_6; pfam13751
759913006571	recombinase A; Provisional; Region: recA; PRK09354
759913006572	RecA is a  bacterial enzyme which has roles in homologous recombination, DNA repair, and the induction of the SOS response.  RecA couples ATP hydrolysis to DNA strand exchange; Region: recA; cd00983
759913006573	hexamer interface [polypeptide binding]; other site
759913006574	Walker A motif; other site
759913006575	ATP binding site [chemical binding]; other site
759913006576	Walker B motif; other site
759913006577	competence damage-inducible protein A; Provisional; Region: PRK00549
759913006578	Competence-damaged protein. CinA is the first gene in the competence- inducible (cin) operon and is thought to be specifically required at some stage in the process of transformation. This domain is closely related to a domain, found in a variety of...; Region: cinA; cd00885
759913006579	putative MPT binding site; other site
759913006580	Uncharacterized protein (competence- and mitomycin-induced) [General function prediction only]; Region: CinA; COG1546
759913006581	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
759913006582	This domain superfamily is found in a variety of structurally related metalloproteins, including the type I extradiol dioxygenases, glyoxalase I and a group of antibiotic resistance proteins; Region: Glo_EDI_BRP_like; cd06587
759913006583	active site
759913006584	Methyladenine glycosylase; Region: Adenine_glyco; pfam03352
759913006585	Holliday junction DNA helicase RuvA; Reviewed; Region: ruvA; PRK00116
759913006586	RuvA N terminal domain; Region: RuvA_N; pfam01330
759913006587	RuvA, C-terminal domain; Region: RuvA_C; pfam07499
759913006588	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
759913006589	Major Facilitator Superfamily; Region: MFS_1; pfam07690
759913006590	putative substrate translocation pore; other site
759913006591	DNA mismatch repair protein; Reviewed; Region: mutL; PRK00095
759913006592	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
759913006593	ATP binding site [chemical binding]; other site
759913006594	Mg2+ binding site [ion binding]; other site
759913006595	G-X-G motif; other site
759913006596	MutL_Trans: transducer domain, having a ribosomal S5 domain 2-like fold, conserved in the C-terminal domain of DNA mismatch repair (MutL/MLH1/PMS2) family. This transducer domain is homologous to the second domain of the DNA gyrase B subunit, which is...; Region: MutL_Trans; cd00782
759913006597	ATP binding site [chemical binding]; other site
759913006598	MutL C terminal dimerisation domain; Region: MutL_C; pfam08676
759913006599	DNA mismatch repair protein MutS; Provisional; Region: PRK05399
759913006600	MutS domain I; Region: MutS_I; pfam01624
759913006601	MutS domain II; Region: MutS_II; pfam05188
759913006602	MutS domain III; Region: MutS_III; pfam05192
759913006603	ATP-binding cassette domain of MutS1 homolog; Region: ABC_MutS1; cd03284
759913006604	Walker A/P-loop; other site
759913006605	ATP binding site [chemical binding]; other site
759913006606	Q-loop/lid; other site
759913006607	ABC transporter signature motif; other site
759913006608	Walker B; other site
759913006609	D-loop; other site
759913006610	H-loop/switch region; other site
759913006611	Protein of unknown function (DUF964); Region: DUF964; cl01483
759913006612	Arginine repressor, DNA binding domain; Region: Arg_repressor; pfam01316
759913006613	arginine repressor; Region: argR_whole; TIGR01529
759913006614	Arginine repressor, C-terminal domain; Region: Arg_repressor_C; pfam02863
759913006615	arginyl-tRNA synthetase; Reviewed; Region: PRK12451
759913006616	Arginyl tRNA synthetase N terminal dom; Region: Arg_tRNA_synt_N; smart01016
759913006617	catalytic core domain of arginyl-tRNA synthetases; Region: ArgRS_core; cd00671
759913006618	active site
759913006619	HIGH motif; other site
759913006620	KMSK motif region; other site
759913006621	Anticodon-binding domain of arginyl tRNA synthetases; Region: Anticodon_Ia_Arg; cd07956
759913006622	tRNA binding surface [nucleotide binding]; other site
759913006623	anticodon binding site; other site
759913006624	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
759913006625	ABC-type cobalt transport system, ATPase component [Inorganic ion transport and metabolism]; Region: CbiO; COG1122
759913006626	ABC-type cobalt transport system, ATPase component [Inorganic ion transport and metabolism]; Region: CbiO; COG1122
759913006627	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
759913006628	ABC transporter; Region: ABC_tran_2; pfam12848
759913006629	Uncharacterized conserved protein [Function unknown]; Region: COG1284
759913006630	Uncharacterized BCR, YitT family COG1284; Region: DUF161; pfam02588
759913006631	Uncharacterized BCR, YitT family COG1284; Region: DUF161; pfam02588
759913006632	Uncharacterized protein conserved in bacteria (DUF2179); Region: DUF2179; pfam10035
759913006633	Uncharacterized conserved protein [Function unknown]; Region: COG1284
759913006634	Uncharacterized BCR, YitT family COG1284; Region: DUF161; pfam02588
759913006635	Uncharacterized protein conserved in bacteria (DUF2179); Region: DUF2179; pfam10035
759913006636	Uncharacterized conserved protein [Function unknown]; Region: COG1284
759913006637	Uncharacterized BCR, YitT family COG1284; Region: DUF161; pfam02588
759913006638	Uncharacterized BCR, YitT family COG1284; Region: DUF161; pfam02588
759913006639	Uncharacterized protein conserved in bacteria (DUF2179); Region: DUF2179; pfam10035
759913006640	aspartyl-tRNA synthetase; Validated; Region: aspS; PRK00476
759913006641	EcAspRS_like_N: N-terminal, anticodon recognition domain of the type found in Escherichia coli aspartyl-tRNA synthetase (AspRS), the human mitochondrial (mt) AspRS-2, the discriminating (D) Thermus thermophilus AspRS-1, and the nondiscriminating (ND)...; Region: EcAspRS_like_N; cd04317
759913006642	dimer interface [polypeptide binding]; other site
759913006643	anticodon binding site; other site
759913006644	Asp tRNA synthetase (aspRS) class II core domain. Class II assignment is based upon its structure and the presence of three characteristic sequence motifs. AspRS is a homodimer, which attaches a specific amino acid to the 3' OH group of ribose of...; Region: AspRS_core; cd00777
759913006645	homodimer interface [polypeptide binding]; other site
759913006646	motif 1; other site
759913006647	active site
759913006648	motif 2; other site
759913006649	GAD domain; Region: GAD; pfam02938
759913006650	Asp tRNA synthetase (aspRS) class II core domain. Class II assignment is based upon its structure and the presence of three characteristic sequence motifs. AspRS is a homodimer, which attaches a specific amino acid to the 3' OH group of ribose of...; Region: AspRS_core; cd00777
759913006651	motif 3; other site
759913006652	histidyl-tRNA synthetase; Reviewed; Region: hisS; PRK00037
759913006653	Class II Histidinyl-tRNA synthetase (HisRS)-like catalytic core domain. HisRS is a homodimer. It is responsible for the attachment of histidine to the 3' OH group of ribose of the appropriate tRNA. This domain is primarily responsible for...; Region: HisRS-like_core; cd00773
759913006654	dimer interface [polypeptide binding]; other site
759913006655	motif 1; other site
759913006656	active site
759913006657	motif 2; other site
759913006658	HisRS Histidyl-anticodon binding domain. HisRS belongs to class II aminoacyl-tRNA synthetases (aaRS). This alignment contains the anticodon binding domain, which is responsible for specificity in tRNA-binding, so that the activated amino acid is...; Region: HisRS_anticodon; cd00859
759913006659	anticodon binding site; other site
759913006660	50S ribosomal protein L32; Validated; Region: rpmF; PRK01110
759913006661	50S ribosomal protein L33; Validated; Region: rpmG; PRK00595
759913006662	Predicted permease, cadmium resistance protein [Inorganic ion transport and metabolism]; Region: CadD; COG4300
759913006663	Cadmium resistance transporter; Region: Cad; pfam03596
759913006664	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
759913006665	putative DNA binding site [nucleotide binding]; other site
759913006666	putative Zn2+ binding site [ion binding]; other site
759913006667	FtsK/SpoIIIE family; Region: FtsK_SpoIIIE; pfam01580
759913006668	AAA domain; Region: AAA_22; pfam13401
759913006669	Predicted membrane protein [Function unknown]; Region: COG2035
759913006670	Coenzyme A pyrophosphatase (CoAse), a member of the Nudix hydrolase superfamily, functions to catalyze the elimination of oxidized inactive CoA, which can inhibit CoA-utilizing enzymes. The need of CoAses mainly arises under conditions of oxidative...; Region: CoAse; cd03426
759913006671	putative active site [active]
759913006672	putative CoA binding site [chemical binding]; other site
759913006673	nudix motif; other site
759913006674	metal binding site [ion binding]; metal-binding site
759913006675	Predicted transcriptional regulators [Transcription]; Region: COG1695
759913006676	Transcriptional regulator PadR-like family; Region: PadR; pfam03551
759913006677	Predicted membrane protein [Function unknown]; Region: COG4709
759913006678	Domain of unknown function (DUF4097); Region: DUF4097; pfam13349
759913006679	Predicted membrane protein [Function unknown]; Region: COG1511
759913006680	YhgE/Pip N-terminal domain; Region: pip_yhgE_Nterm; TIGR03061
759913006681	YhgE/Pip C-terminal domain; Region: pip_yhgE_Cterm; TIGR03062
759913006682	probable dihydroxyacetone kinase regulator; Region: DHAK_reg; TIGR02366
759913006683	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
759913006684	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG3666
759913006685	Transposase DDE domain; Region: DDE_Tnp_1; pfam01609
759913006686	Transposase DDE domain; Region: DDE_Tnp_1_6; pfam13751
759913006687	Cytotoxic translational repressor of toxin-antitoxin stability system [Translation, ribosomal structure and biogenesis / Cell division and chromosome partitioning]; Region: RelE; COG2026
759913006688	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cl17257
759913006689	DNA binding residues [nucleotide binding]
759913006690	Terminase small subunit; Region: Terminase_2; cl01513
759913006691	nitrogenase reductase-like protein; Reviewed; Region: PRK13230
759913006692	Prophage antirepressor [Transcription]; Region: COG3617
759913006693	BRO family, N-terminal domain; Region: Bro-N; smart01040
759913006694	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cl17200
759913006695	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
759913006696	non-specific DNA binding site [nucleotide binding]; other site
759913006697	salt bridge; other site
759913006698	sequence-specific DNA binding site [nucleotide binding]; other site
759913006699	Domain of unknown function (DUF4352); Region: DUF4352; pfam11611
759913006700	Integrase [DNA replication, recombination, and repair]; Region: XerC; COG0582
759913006701	phiLC3 phage and phage-related integrases, site-specific recombinases, DNA breaking-rejoining enzymes, C-terminal catalytic domain. This CD includes various bacterial (mainly gram positive) and phage integrases, including those similar to Lactococcus...; Region: INT_phiLC3_C; cd01189
759913006702	Int/Topo IB signature motif; other site
759913006703	30S ribosomal protein S4; Validated; Region: rpsD; PRK05327
759913006704	Ribosomal protein S4/S9 N-terminal domain; Region: Ribosomal_S4; pfam00163
759913006705	S4/Hsp/ tRNA synthetase RNA-binding domain; The domain surface is populated by conserved, charged residues that define a likely RNA-binding site;  Found in stress proteins, ribosomal proteins and tRNA synthetases; This may imply a hitherto unrecognized...; Region: S4; cd00165
759913006706	RNA binding surface [nucleotide binding]; other site
759913006707	DDE_Tnp_1-associated; Region: DDE_Tnp_1_assoc; pfam13808
759913006708	Transposase DDE domain; Region: DDE_Tnp_1; pfam01609
759913006709	Transposase [DNA replication, recombination, and repair]; Region: COG5433
759913006710	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
759913006711	non-specific DNA binding site [nucleotide binding]; other site
759913006712	salt bridge; other site
759913006713	sequence-specific DNA binding site [nucleotide binding]; other site
759913006714	Uncharacterized protein conserved in bacteria [Function unknown]; Region: Veg; COG4466
759913006715	replicative DNA helicase; Provisional; Region: PRK05748
759913006716	DnaB-like helicase N terminal domain; Region: DnaB; pfam00772
759913006717	DnaB helicase C terminal domain. The hexameric helicase DnaB unwinds the DNA duplex at the  chromosome replication fork. Although the mechanism by which DnaB both couples ATP hydrolysis to translocation along DNA and denatures the duplex is unknown, a...; Region: DnaB_C; cd00984
759913006718	Walker A motif; other site
759913006719	ATP binding site [chemical binding]; other site
759913006720	Walker B motif; other site
759913006721	DNA binding loops [nucleotide binding]
759913006722	50S ribosomal protein L9; Reviewed; Region: rplI; PRK00137
759913006723	Ribosomal protein L9, N-terminal domain; Region: Ribosomal_L9_N; pfam01281
759913006724	Ribosomal protein L9, C-terminal domain; Region: Ribosomal_L9_C; pfam03948
759913006725	Predicted signaling protein consisting of a modified GGDEF domain and a DHH domain [Signal transduction mechanisms]; Region: COG3887
759913006726	DHH family; Region: DHH; pfam01368
759913006727	DHHA1 domain; Region: DHHA1; pfam02272
759913006728	tRNA uridine 5-carboxymethylaminomethyl modification enzyme GidA; Validated; Region: PRK05192
759913006729	tRNA:m(5)U-54 methyltransferase; Region: gid_trmFO; TIGR00137
759913006730	GidA associated domain 3; Region: GIDA_assoc_3; pfam13932
759913006731	Nudix hydrolase is a superfamily of enzymes found in all three kingdoms of life, and it catalyzes the hydrolysis of NUcleoside DIphosphates linked to other moieties, X. Enzymes belonging to this superfamily require a divalent cation, such as Mg2+ or Mn2+...; Region: Nudix_Hydrolase; cl00447
759913006732	nudix motif; other site
759913006733	MarC family integral membrane protein; Region: MarC; pfam01914
759913006734	Predicted tRNA(5-methylaminomethyl-2-thiouridylate) methyltransferase, contains the PP-loop ATPase domain [Translation, ribosomal structure and biogenesis]; Region: TrmU; COG0482
759913006735	tRNA methyl transferase. This family represents tRNA(5-methylaminomethyl-2-thiouridine)-methyltransferase which is involved in the biosynthesis of the modified nucleoside 5-methylaminomethyl-2-thiouridine present in the wobble position of some tRNAs; Region: tRNA_Me_trans; cd01998
759913006736	L-serine dehydratase, iron-sulfur-dependent, beta subunit; Region: sda_beta; TIGR00719
759913006737	Serine dehydratase beta chain; Region: SDH_beta; pfam03315
759913006738	C-terminal ACT domain of the L-serine dehydratase (LSD), iron-sulfur-dependent, beta subunit; Region: ACT_LSD; cd04903
759913006739	putative L-serine binding site [chemical binding]; other site
759913006740	Serine dehydratase alpha chain; Region: SDH_alpha; cl12120
759913006741	L-serine deaminase [Amino acid transport and metabolism]; Region: SdaA; COG1760
759913006742	Predicted phosphatases [General function prediction only]; Region: Gph; COG0546
759913006743	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
759913006744	active site
759913006745	motif I; other site
759913006746	motif II; other site
759913006747	ABC-type cobalt transport system, permease component CbiQ and related transporters [Inorganic ion transport and metabolism]; Region: CbiQ; COG0619
759913006748	cobalt transporter ATP-binding subunit; Provisional; Region: cbiO; PRK13649
759913006749	First domain of the ATP-binding cassette component of cobalt transport system; Region: ABC_cobalt_CbiO_domain1; cd03225
759913006750	Walker A/P-loop; other site
759913006751	ATP binding site [chemical binding]; other site
759913006752	Q-loop/lid; other site
759913006753	ABC transporter signature motif; other site
759913006754	Walker B; other site
759913006755	D-loop; other site
759913006756	H-loop/switch region; other site
759913006757	cobalt transporter ATP-binding subunit; Provisional; Region: cbiO; PRK13650
759913006758	First domain of the ATP-binding cassette component of cobalt transport system; Region: ABC_cobalt_CbiO_domain1; cd03225
759913006759	Walker A/P-loop; other site
759913006760	ATP binding site [chemical binding]; other site
759913006761	Q-loop/lid; other site
759913006762	ABC transporter signature motif; other site
759913006763	Walker B; other site
759913006764	D-loop; other site
759913006765	H-loop/switch region; other site
759913006766	CDP-alcohol phosphatidyltransferase; Region: CDP-OH_P_transf; cl00453
759913006767	Predicted transcriptional regulator contains Xre-like HTH domain [Function unknown]; Region: COG1426
759913006768	Helix-turn-helix domain; Region: HTH_25; pfam13413
759913006769	Predicted Zn-dependent peptidases [General function prediction only]; Region: PqqL; COG0612
759913006770	Insulinase (Peptidase family M16); Region: Peptidase_M16; pfam00675
759913006771	Peptidase M16 inactive domain; Region: Peptidase_M16_C; pfam05193
759913006772	Predicted Zn-dependent peptidases [General function prediction only]; Region: PqqL; COG0612
759913006773	Peptidase M16 inactive domain; Region: Peptidase_M16_C; pfam05193
759913006774	S4-like RNA binding protein [Replication, recombination, and repair]; Region: COG2501
759913006775	recombination protein F; Reviewed; Region: recF; PRK00064
759913006776	ATP-binding cassette domain of RecF; Region: ABC_RecF; cd03242
759913006777	Walker A/P-loop; other site
759913006778	ATP binding site [chemical binding]; other site
759913006779	Q-loop/lid; other site
759913006780	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
759913006781	ABC transporter signature motif; other site
759913006782	Walker B; other site
759913006783	D-loop; other site
759913006784	H-loop/switch region; other site
759913006785	Putative glucose uptake permease [Carbohydrate transport and metabolism]; Region: GlcU; COG4975
759913006786	inosine 5'-monophosphate dehydrogenase; Reviewed; Region: PRK05567
759913006787	TIM barrel proteins share a structurally conserved phosphate binding motif and in general share an eight beta/alpha closed barrel structure. Specific for this family is the conserved phosphate binding site at the edges of strands 7 and 8. The phosphate...; Region: TIM_phosphate_binding; cl17186
759913006788	This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domains in the inosine 5' monophosphate dehydrogenase (IMPDH) protein.  IMPDH is an essential enzyme that catalyzes the first step unique to GTP synthesis, playing a...; Region: CBS_pair_IMPDH; cd04601
759913006789	IMPDH: The catalytic domain of the inosine monophosphate dehydrogenase. IMPDH catalyzes the NAD-dependent oxidation of inosine 5'-monophosphate (IMP) to xanthosine 5' monophosphate (XMP). It is a rate-limiting step in the de novo synthesis of...; Region: IMPDH; cd00381
759913006790	active site
759913006791	tryptophanyl-tRNA synthetase II; Reviewed; Region: PRK12282
759913006792	catalytic core domain of tryptophanyl-tRNA synthetase; Region: TrpRS_core; cd00806
759913006793	active site
759913006794	HIGH motif; other site
759913006795	dimer interface [polypeptide binding]; other site
759913006796	KMSKS motif; other site
759913006797	Uncharacterized conserved protein [Function unknown]; Region: COG1284
759913006798	Uncharacterized BCR, YitT family COG1284; Region: DUF161; pfam02588
759913006799	Uncharacterized BCR, YitT family COG1284; Region: DUF161; pfam02588
759913006800	Uncharacterized protein conserved in bacteria (DUF2179); Region: DUF2179; pfam10035
759913006801	ABC transporter ATP-binding protein; Provisional; Region: PRK15064
759913006802	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
759913006803	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
759913006804	ABC transporter; Region: ABC_tran_2; pfam12848
759913006805	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
759913006806	Predicted membrane protein [Function unknown]; Region: COG4485
759913006807	Transposase and inactivated derivatives, IS30 family [DNA replication, recombination, and repair]; Region: Tra8; COG2826
759913006808	Helix-turn-helix domain; Region: HTH_38; pfam13936
759913006809	Integrase core domain; Region: rve; pfam00665
759913006810	rRNA large subunit methyltransferase; Provisional; Region: PRK00103
759913006811	Trypsin-like peptidase domain; Region: Trypsin_2; pfam13365
759913006812	PDZ domain of tryspin-like serine proteases, such as DegP/HtrA, which are oligomeric proteins involved in heat-shock response, chaperone function, and apoptosis. May be responsible for substrate recognition and/or binding, as most PDZ domains bind...; Region: PDZ_serine_protease; cd00987
759913006813	protein binding site [polypeptide binding]; other site
759913006814	Stage 0 sporulation protein J (antagonist of Soj) containing ParB-like nuclease domain [Transcription]; Region: Spo0J; COG1475
759913006815	ParB-like nuclease domain; Region: ParBc; pfam02195
759913006816	Sugar-specific transcriptional regulator TrmB; Region: TrmB; cl17775