-- dump date 20140619_151646 -- class Genbank::repeat_region -- table repeat_region_note -- id note 1048245000001 101 bp Mycobacterial Interspersed Repetitive Unit,Class I. See Supply et al. (1997) Molecular Microbiology 26, 991-1003 1048245000002 putative REP'-1 pseudogene fragment 1048245000003 REP-2, len: 1503 bp. REP251, member of REP13E12 family 1048245000004 101 bp Mycobacterial Interspersed Repetitive Unit,class III 1048245000005 3 copies of a 10 bp near-perfect direct repeat,ATTACTACCTATTACTACGTATTACTATCT 1048245000006 77 bp Mycobacterial Interspersed Repetitive Unit,Class I. See citation below 1048245000007 51 bp Mycobacterial Interspersed Repetitive Unit,Class II 1048245000008 58 bp Mycobacterial Interspersed Repetitive Unit,Class III 1048245000009 74 bp imperfect direct repeat 2, 64/73 bp identical to first copy at 706790..706863, CACAGCGGACACCACAAAGCCCGCCGCTGCCACCGGATCGTCGGAACGAAAATAGTC GTACCCGTGAGCCTCGC 1048245000010 74 bp imperfect direct repeat 1, 64/73 bp identical to second copy at 703912..703985, CACATCGGACACGACGAAACCCGCCGCTGCCACCGGATCGTCGGAGCGGAAGTAGTC GTACCCGTCGGCCTCGC 1048245000011 123 bp imperfect direct repeat 1, 92/103 bp identical to second copy at 701247..701369, AGCCTCGGCTGGCCGCGGCATAAGGTGGCCACCGTGGCCGAAGCGTTCGATGCGACC CAAGCCGTGGCGAGAATCCTGGCCGAACATGGCCCATTGAGCGAGGACGACATCGCA CGACGCCTGC 1048245000012 79 bp imperfect direct repeat 1, 73/78 bp identical to second copy at 711624..711702, TAGGGTTCGGCGTTGTGACGGCGCCGACGCGGTGGACCCTGGCCGACGGACGTGAGC TGCTGTTCTTTTCGCTGCCCGG 1048245000013 79 bp imperfect direct repeat 2, 73/78 bp identical to first copy at 709585..709663, TAGGGTTCTGCGTTGTGACGGCGCCGACGCGGTGGACCCTGGCCGATGGCCGTGACC TGCTGTTCTTTTCGCTGCCCGG 1048245000014 101 bp Mycobacterial Interspersed Repetitive Unit,Class I 1048245000015 53 bp Mycobacterial Interspersed Repetitive Unit,Class II 1048245000016 53 bp Mycobacterial Interspersed Repetitive Unit,Class II 1048245000017 55 bp Mycobacterial Interspersed Repetitive Unit,Class II 1048245000018 51 bp Mycobacterial Interspersed Repetitive Unit,Class II 1048245000019 REP-3, len: 1325 bp. REP22G8, member of REP13E12 family 1048245000020 REP-4, len: 1348 bp. REP165, member of REP13E12 family 1048245000021 43 bp Mycobacterial Interspersed Repetitive Unit,Class III 1048245000022 52 bp Mycobacterial Interspersed Repetitive Unit,Class III 1048245000023 53 bp Mycobacterial Interspersed Repetitive Unit,Class II 1048245000024 51 bp Mycobacterial Interspersed Repetitive Unit,Class II 1048245000025 53 bp Mycobacterial Interspersed Repetitive Unit,Class II 1048245000026 1260 bp imperfect direct repeat 2, first copy at 1637133..1638392 1048245000027 1260 bp imperfect direct repeat 1, second copy at 1633531..1634790 1048245000028 REP-5, len: 1298 bp. REP336, member of REP13E12 family 1048245000029 56 bp direct repeat 1, AGTCGGGTGACGATGCGGGCCGGTGTGGTCCGAGGAGGAGCCCGACAATTTAAGCT 1048245000030 56 bp direct repeat 2, AGTCGGGTGACGATGCGGGCCGGTGTGGTCCGAGGAGGAGCCCGACAATTTAAGCT 1048245000031 REP-6, len: 1372 bp. REPI125, member of REP13E12 family 1048245000032 53 bp Mycobacterial Interspersed Repetitive Unit,Class II 1048245000033 53 bp Mycobacterial Interspersed Repetitive Unit,Class II 1048245000034 78 bp imperfect direct repeat 5, CGGCGCCTTCAGCCTGCCCGGGTTGACGTTGCCGTCGTTGAACATCCCGGCCGCCACC ACACCAGCCAACATCACCGT 1048245000035 78 bp imperfect direct repeat 6, CGGCGCCTTCAGCCTGCCCGGGTTGACGTTGCCGTCGTTGAACATCCCGGCCGCCACC ACACCCGCCAACATCACCGT 1048245000036 78 bp imperfect direct repeat 2, CGGCGCCTTCAGCCTGCCCGGGTTGACGTTGCCGTCGTTGAACATCCCGGCCGCCACC ACACCAGCCAACATCACCGT 1048245000037 78 bp imperfect direct repeat 1, TCCCGCCTTCAGTCTGCCGGCAATAACGCTGCCGTCGCTGAACATCCCGGCCGCCACC ACACCGGCCAACATCACCGT 1048245000038 69 bp imperfect direct repeat 1, TCGGTCCGATTGTGGTGCCGGATATTACTATTCCTGGTATTCCGTTGAGCCTGAACGC GCTGGGTGGTG 1048245000039 REP-7, len: 1362 bp. REP09F9, member of the REP13E12 family 1048245000040 79 bp Mycobacterial Interspersed Repetitive Unit,Class I 1048245000041 58 bp Mycobacterial Interspersed Repetitive Unit,Class II I. Overlaps Rv2195 suggesting alternative GTG start at 2458 468 may be used 1048245000042 58 bp inverted repeat near 3'end of MTCY427.28 1048245000043 53 bp inverted repeat between 3' ends of MTCY427.29 and MT CY427.31c 1048245000044 53 bp Mycobacterial Interspersed Repetitive Unit,Class II 1048245000045 50 bp Mycobacterial Interspersed Repetitive Unit,Class II 1048245000046 77 bp Mycobacterial Interspersed Repetitive Unit,Class I 1048245000047 300 bp direct repeat copy 1 1048245000048 300 bp direct repeat copy 2 1048245000049 248 bp direct repeat 2 1048245000050 258 bp direct repeat 2 1048245000051 51 bp Mycobacterial Interspersed Repetitive Unit,Class I 1048245000052 62 bp Mycobacterial Interspersed Repetitive Unit,Class III 1048245000053 (43 bp) part of 51 bp direct repeat,GTGTCGACCCGCTGCGCCCGGCTTCGCCGTGCTTGCGATCGCC 1048245000054 55 bp Mycobacterial Interspersed Repetitive Unit,Class III 1048245000055 101 bp Mycobacterial Interspersed Repetitive Unit,Class III 1048245000056 98 bp Mycobacterial Interspersed Repetitive Unit,Class III 1048245000057 77 bp Mycobacterial Interspersed Repetitive Unit,Class I 1048245000058 53 bp Mycobacterial Interspersed Repetitive Unit,Class II 1048245000059 110 bp Mycobacterial Interspersed Repetitive Unit,Class III 1048245000060 207 bp imperfect direct repeat 1, 199/207 bp identical to second copy at 3769514..3769720 1048245000061 109 bp imperfect direct repeat 1, 95/109 bp identical to second copy at 3769754..3769862 1048245000062 98 bp imperfect direct repeat 1, 82/98 bp identical to the second copy at 3770994..3771091 1048245000063 IS1608', len: 489 bp. Insertion sequence IS1608' 1048245000064 IS1561', len: 738 bp. Insertion sequence IS1561' 1048245000065 207 bp imperfect direct repeat 2, 199/207 bp identical to first copy at 3743198..3743404 1048245000066 109 bp imperfect direct repeat 2, 95/109 bp identical to first copy at 3743402..3743510 1048245000067 98 bp imperfect direct repeat 2, 82/98 bp identical to the first copy at 3743508..3743605 1048245000068 REP-8, len: 1372 bp. REP13E12, copies in Mycobacterium tuberculosis cosmids: cY336 from 14471 to 15821 (approx. 100% identity); cY251 from 11693 to 13109 (approx. 100% identity); cI65 from 14515 to 15905 (approx 75% identity); cI125 from 27240 to 28597 (approx. 65% Identity); cY22G8 from 13352 to 14689 (approx. 65% identity); and cY9F9 from 9019 to 10451 (approx. 65% identity); also nearly identical to EM_BA :MB35021 U35021 Mycobacterium bovis BCG DNA flanking deletion region 3 from 56 to 1466 1048245000069 500 bp perfect direct repeat 1; second copy at 3945098..3945597 1048245000070 58 bp Mycobacterial Interspersed Repetitive Unit,Class III 1048245000071 111 bp direct repeat unit 4, GTGGCGACCCGCTGCACCCGGCTCTGGGGTGATTGCCTGGCTCCTCCTCGGCCCGTTT TGCGGGCCGCATTGTCGCCAGGCGCGGGGTTTGCGATCGCCACGGGGCTGATG 1048245000072 111 bp direct repeat unit 5, GTGGCGACCCGCTGCACCCGGCTCTGGGGTGATTGCCTGGCTCCTCCTCGGCCCGTTT TGCGGGCCGCATTGTCGCCAGGCGCGGGGTTTGCGATCGCCACGGGGCTGATG 1048245000073 (24 bp) part of 111 bp direct repeat unit 6,GTGGCGACCCGCTGCACCCGGCTC 1048245000074 125 bp Mycobacterial Interspersed Repetitive Unit,Class III 1048245000075 51 bp imperfect direct repeat 3,GAACCGGCCCCACCCAAACCACCCACACCTCCGATGCCCATCGCCGGACCT