-- dump date 20140619_151312 -- class Genbank::repeat_region -- table repeat_region_note -- id note 233413000001 REP'-1, len: 315 nt. Equivalent to REP', len: 315 nt, from Mycobacterium tuberculosis strain H37Rv, (100.0% identity in 315 nt overlap). Probable pseudogene fragment, len: 105 aa; similar to many Mycobacterium tuberculosis proteins inside REP13E12 elements eg. TR:Q50655 (EMBL:Z95390) MTCY13E12.20 (317 aa), FASTA scores; opt: 324 z-score: 432.5 E(): 6.8e-17, 43.4% identity in 99 aa overlap, but no possible startsite. 233413000002 REP-2, len: 1504 nt. Equivalent to REP, len: 1503 nt, from Mycobacterium tuberculosis strain H37Rv, (97.0% identity in 1504 nt overlap). REP251, member of REP13E12 family. 233413000003 15 bp perfect inverted repeat, IRR, ATTCGGTGTAAGTGG, flanking IS element IS1554. 233413000004 15 bp perfect inverted repeat, IRL, ATTCGGTGTAAGTGG, flanking IS element IS1554. 233413000005 49 bp imperfect inverted repeat, IRL, GGGTTCAGAGCTGTTGCGTGTTGAGTGTGTTTTAGTGTGCGTTAGTGTG, flanking IS element IS1535. 233413000006 17 bp perfect inverted repeat, IRL, GTTGAGTGTGTTTTAGT, flanking IS element IS1535. 233413000007 49 bp imperfect inverted repeat, IRR, CCGTTGAGTGTGTTTTAGTTGCACTCTCATGCGGCGTCCCCTTTGCGGG, flanking IS element IS1535. 233413000008 17 bp perfect inverted repeat, IRR, GTTGAGTGTGTTTTAGT, flanking IS element IS1535. 233413000009 15 bp perfect inverted repeat, IRL, TCGCGTGATCCTTCG, flanking IS element IS1081. 233413000010 15 bp perfect inverted repeat, IRR, TCGCGTGATCCTTCG, flanking IS element IS1081. 233413000011 REP-3, len: 1356 nt. Equivalent to REP, len: 1325 nt, from Mycobacterium tuberculosis strain H37RV, (99.9% identity in 1325 nt overlap). REP22G8, member of REP13E12 family. 233413000012 REP-4, len: 1362 nt. Equivalent to REP, len: 1362 nt, from Mycobacterium tuberculosis strain H37Rv, (96.4% identity in 1362 nt overlap). REP165, member of REP13E12 family. 233413000013 4 bp direct repeat, CTAG, generated by IS element on insertion. Proposed by Mariani et al. 1993. J. Gen. Microbiol. 139:1767-1772. Note that as the motif is palindromic it could be part of the inverted repeat itself. 233413000014 17 bp imperfect inverted repeat, IRL, GGCGTGTCTCCCAAATT, flanking IS element. Proposed by Mariani et al. 1993. J. Gen. Microbiol. 139: 1767-1772. 233413000015 17 bp imperfect inverted repeat, IRR, GGCGTGTCTCCCAATTT, flanking IS element. Proposed by Mariani et al. 1993. J. Gen. Microbiol. 139: 1767-1772. 233413000016 4 bp direct repeat, CTAG, generated by IS element on insertion. Proposed by Mariani et al. 1993. J. Gen. Microbiol. 139 :1767-1772. Note that as motif palindromic could be part of inverted repeat itself. 233413000017 8 bp direct repeat, TGACACCA, flanking IS element IS1081. 233413000018 15 bp perfect inverted repeat, IRR, TCGCGTGATCCTTCG, flanking IS element IS1081. 233413000019 15 bp perfect inverted repeat, IRL, TCGCGTGATCCTTCG, flanking IS element IS1081. 233413000020 8 bp direct repeat, TGACACCA, flanking IS element IS1081. 233413000021 20 bp imperfect inverted repeat, IRR, AGCAGACGCAAAAGCCCCCA, flanking IS element IS1557. 233413000022 20 bp imperfect inverted repeat, IRL, AGCAGACGCGAAAGCCCCCA, flanking IS element IS1557. 233413000023 REP-5, len: 1363 nt. Equivalent to REP, len: 1298 nt, from Mycobacterium tuberculosis strain H37Rv, (96.6% identity in 1363 nt overlap). REP336, member of REP13E12 family. 233413000024 REP-6, len: 1379 nt. Equivalent to REP, len: 1362 nt, from Mycobacterium tuberculosis strain H37RV, (65.3% identity in 1364 nt overlap). REPI125, member of REP13E12 family. 233413000025 14 bp imperfect inverted repeat, IRR, ATCACCCCGCAAAG, flanking IS element ISB9'. 233413000026 14 bp imperfect inverted repeat, IRL, ATCACCCCGGCAAG, flanking IS element ISB9'. 233413000027 REP-7, len: 1362 nt. Equivalent to REP, len: 1362 nt, from Mycobacterium tuberculosis strain H37Rv, (99.9% identity in 1362 nt overlap). REP09F9, member of the REP13E12 family. 233413000028 13 bp imperfect inverted repeat, IRR, GCAGTCGTAAAAG, flanking IS element IS1558. 233413000029 13 bp imperfect inverted repeat, IRL, GCAGTCGCAAAAG, flanking IS element IS1558. 233413000030 15 bp perfect inverted repeat, IRR, TCGCGTGATCCTTCG, flanking IS element IS1081. 233413000031 15 bp perfect inverted repeat, IRL, TCGCGTGATCCTTCG, flanking IS element IS1081. 233413000032 15 bp perfect inverted repeat, IRL, TCGCGTGATCCTTCG, flanking IS element IS1081. 233413000033 4404 bp DR, direct repeat region composed of 42 repeat_units of 36 bases pairs, one of them has been interrupted by the insertion of an IS6110 elements. 233413000034 direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 233413000035 direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 233413000036 direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 233413000037 direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 233413000038 direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 233413000039 direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 233413000040 direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 233413000041 direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 233413000042 direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 233413000043 direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 233413000044 direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 233413000045 direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 233413000046 direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 233413000047 direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 233413000048 direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 233413000049 direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 233413000050 direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 233413000051 3' part direct repeat, CCCCGAGAGGGGACGGAAAC, of sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 233413000052 3 bp direct repeat, GGG, flanking IS element IS6110. 233413000053 28 bp perfect inverted repeat, IRR, TGAACCGCCCCGGCAATGTCCGGAGACTC, flanking IS element IS6110. 233413000054 28 bp perfect inverted repeat, IRL, TGAACCGCCCCGGCAATGTCCGGAGACTC, flanking IS element IS6110. 233413000055 3 bp direct repeat, GGG, flanking IS element IS6110. 233413000056 5' part direct repeat, GTCGTCAGACCCAAAA, of sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 233413000057 direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 233413000058 direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 233413000059 direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 233413000060 direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 233413000061 direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 233413000062 direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 233413000063 direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 233413000064 direct repeat, 32 out of 36 bp identical to sequence CGGATCAGACCCAAAACCCCGAGAGGGGACGGAAAC 233413000065 direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 233413000066 direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 233413000067 direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 233413000068 direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 233413000069 direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 233413000070 direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 233413000071 direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 233413000072 direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 233413000073 direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 233413000074 direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 233413000075 direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 233413000076 direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 233413000077 direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 233413000078 direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 233413000079 direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 233413000080 direct repeat, 36 out of 36 bp identical to sequence GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC 233413000081 5 bp direct repeat, CCGTT, flanking IS element IS1533. 233413000082 54 bp imperfect inverted repeat, IRL, TGTCGACGGCACGTGAAAACTGACCCCGGCGCGGCACCCGAATTTTGACCCCCT, flanking IS element IS1533. 233413000083 54 bp imperfect inverted repeat, IRR, TGTCAACGGCACCCGAAAACTGACCCCCTGACGGCATCTGAAAATTGACCCCCT, flanking IS element IS1533. 233413000084 5 bp direct repeat, CCGTT, flanking IS element IS1533. 233413000085 6 bp perfect inverted repeat, IRR, TGAGTG, flanking IS element IS1538. 233413000086 6 bp perfect inverted repeat, IRL, TGAGTG, flanking IS element IS1538. 233413000087 8 bp direct repeat, CCAGTCGC, flanking IS element IS1081. 233413000088 15 bp perfect inverted repeat, IRR, TCGCGTGATCCTTCG, flanking IS element IS1081. 233413000089 15 bp perfect inverted repeat, IRL, TCGCGTGATCCTTCG, flanking IS element IS1081. 233413000090 8 bp direct repeat, CCAGTCGC, flanking IS element IS1081. 233413000091 8 bp direct repeat, AGGAGGAG, flanking IS element IS1081. 233413000092 15 bp perfect inverted repeat, IRL, TCGCGTGATCCTTCG, flanking IS element IS1081. 233413000093 15 bp perfect inverted repeat, IRR, TCGCGTGATCCTTCG, flanking IS element IS1081. 233413000094 8 bp direct repeat, AGGAGGAG, flanking IS element IS1081. 233413000095 63 bp imperfect inverted repeat, IRR, TGTCAGCGGCAACCGAAAACTGATCAGGTGTCGGCAAGGTGGTTTCTAGGCGGTGTCG C AACA, flanking IS element IS1603. 233413000096 63 bp imperfect inverted repeat, IRL, TGTCGGCGGCAACTGAATACTGACCAGAGCGCGGCAAGGTGGGTTCTAGTCAACGTCG C AACA, flanking IS element IS1603. 233413000097 2 bp direct repeat, GT, flanking IS element IS1560. 233413000098 25 bp inverted repeat, IRL, TAATTACTAGGACCTGAAAAAGTCG, flanking IS element IS1560. 233413000099 25 bp inverted repeat, IRR, TAATTACTAAGACCTGAAAAAGTCG, flanking IS element IS1560. 233413000100 2 bp direct repeat, GT, flanking IS element IS1560. 233413000101 REP-8, len: 1393 nt. Equivalent to REP, len: 1372 nt, from Mycobacterium tuberculosis strain H37Rv, (98.8% identity in 1368 nt overlap). REP13E12, 1371 bp repeat, copies in Mycobacterium tuberculosis cosmids; cY336 from: 14471 to: 15821 (approx. 100% identity); cY251 from: 11693 to: 13109 (approx. 100% identity); cI65 from: 14515 to: 15905 (approx 75% identity); cI125 from: 27240 to: 28597 (approx. 65% Identity); cY22G8 from: 13352 to 14689 (approx. 65% identity); and cY9F9 from: 9019 to: 10451 (approx. 65% identity); also nearly identical to EM_BA :MB35021 U35021 Mycobacterium bovis BCG DNA flanking deletion region 3 from: 56 to: 1466. 233413000102 49 bp imperfect inverted repeat, IRL, CGGCAACTGAATACTGACCAGAGCGCGGCAACTGAAAATTGACCAGCTT, flanking IS element IS1534. 233413000103 49 bp imperfect inverted repeat, IRR, CGGCAACCGAAAACTGATCAGGTGTCGGCAATCGAAAATTGACCAGCTT, flanking IS element IS1534. 233413000104 13 bp imperfect inverted repeat, IRR, GAGTTCGTCGGTG, flanking IS element IS1553. 233413000105 13 bp imperfect inverted repeat, IRL, GAGATCGTCGGTG, flanking IS element IS1553. 233413000106 27 bp imperfect inverted repeat, IRL, CGAGCAGACGTAAAAGCCCCCAATTCG, flanking IS element IS1557'. 233413000107 27 bp imperfect inverted repeat, IRR, CGAGCAGACGTAAAAGCCCCCATTTCG, flanking IS element IS1557'.