-- dump date   	20140619_104154
-- class       	Genbank::repeat_region
-- table       	repeat_region_note
-- id	note
281310000001	tetranucleotide repeat in frame near start of NTHI0365; NTHIpnote0004
281310000002	tetranucleotide repeat in frame near start of NTHI0472; NTHIpnote0005
281310000003	tetranucleotide repeat in frame in NTHI0512; NTHIpnote0006
281310000004	tetranucleotide repeat in frame near start of NTHI0585; NTHIpnote0007
281310000005	tetranucleotide repeat in frame in NTHI0677; NTHIpnote0008
281310000006	tetranucleotide repeat in NTHI0736 induces frame shift and early termination; NTHIpnote0010
281310000007	tetranucleotide repeat in frame near start of NTHI0782; NTHIpnote0011
281310000008	tetranucleotide repeat in NTHI0840 induces frame shift and early termination; NTHIpnote0012
281310000009	tetranucleotide repeat in NTHI0910 induces frame shift and early termination; NTHIpnote0015
281310000010	tetranucleotide repeat in frame near start of NTHI1034; NTHIpnote0016
281310000011	NTHIpnote0017; 9-nucleotide repeat between NTHI1449, NTHI1448
281310000012	heptanucleotide repeat in intergenic region before NTHI1450; NTHIpnote0018
281310000013	Contains two variant 27nt repeat sequences in frame in NTHI1489. Variations on the Amino-acid motif from this repeat continue outside this region; NTHIpnote0019; rpt_units: tacaggcgatcagtcggcagcgactaa; tacaggctatcggtcggtagcgactaa
281310000014	degenerate 27nt repeat in frame in NTHI1489; NTHIpnote0020
281310000015	Contains two variant 27nt repeat sequences in frame in NTHI1489. Variations on the Amino-acid motif from this repeat continue outside this region; NTHIpnote0021; rpt_units: tacaggcgatcagtcggcagcgactaa; tacaggctatcggtcggtagcgactaa
281310000016	degenerate 27nt repeat in frame in NTHI1489; NTHIpnote0022
281310000017	tetranucleotide repeat in frame near start of NHTI1597; NTHIpnote0023
281310000018	tetranucleotide repeat in frame near stop of NTHI1750; NTHIpnote0024
281310000019	tetranucleotide repeat in NTHI1769 induces frame shift and early termination; NTHIpnote0025
281310000020	heptanucleotide repeat in intergenic region before NTHI1983; NTHIpnote0026