-- dump date 20140619_080620 -- class Genbank::repeat_region -- table repeat_region_note -- id note 216592000001 IS1397 216592000002 IS1 216592000003 (gaggtaagacaa)3 216592000004 rep22 216592000005 IS_H 216592000006 IS_H 216592000007 Palindromic repeat found by REPuter: tttcgatagtgtgagtattgaatgatttccagcc 216592000008 IS1397 216592000009 IS_H 216592000010 IS_H 216592000011 IS1 216592000012 15mer direct repeat flanking prophage 216592000013 15mer direct repeat flanking prophage 216592000014 Forward repeat found by REPuter: cttcacatcgccgcttcatt 216592000015 Forward repeat found by REPuter: cttcacatcgccgcttcatt 216592000016 IS1397 216592000017 Imperfect repeat flanking prophage 216592000018 rep9 216592000019 rep7 216592000020 rep23 216592000021 rep18 216592000022 phage_rep 216592000023 phage_internal 216592000024 phage_rep 216592000025 rep3 216592000026 Palindromic repeat found by REPuter: gcaagaacgtgctgcggttgg 216592000027 Imperfect repeat flanking prophage 216592000028 15mer direct repeat flanking prophage 216592000029 phage_rep_extended2 216592000030 phage_internal 216592000031 phage_rep 216592000032 phage_rep_extended 216592000033 15mer direct repeat flanking prophage 216592000034 IS1 216592000035 IS1397 216592000036 rep22 216592000037 IS_H 216592000038 gadA 216592000039 Palindromic repeat found by REPuter: tttcgatagtgtgagtattgaatgatttccagcc 216592000040 Palindromic repeat found by REPuter: gcaagaacgtgctgcggttgg 216592000041 rep3 216592000042 phage_rep 216592000043 rep7 216592000044 rep9 216592000045 23mer direct repeat flanking genomic island 216592000046 23mer direct repeat flanking genomic island 216592000047 31mer direct repeat flanking prophage, partial tRNA 216592000048 phage_rep 216592000049 phage_internal 216592000050 rep27 216592000051 rep18 216592000052 rep23 216592000053 rep23 216592000054 rep7 216592000055 rep9 216592000056 31mer direct repeat flanking prophage, partial tRNA 216592000057 rep2a 216592000058 rep2b 216592000059 rep2c 216592000060 rep1 216592000061 rep6 216592000062 rep5 216592000063 rep4 216592000064 rep27 216592000065 IS1 216592000066 IS1397 216592000067 CRISPR 216592000068 possible CRISPR 216592000069 (caccgctaaaacggcattta)3 216592000070 rep26 216592000071 17mer direct repeat flanking GI 216592000072 rep14 216592000073 rep13 216592000074 rep17 216592000075 rep12 216592000076 IS600 216592000077 IS30 216592000078 IS600 216592000079 rep5 216592000080 rep4 216592000081 rep11 216592000082 17mer direct repeat flanking GI 216592000083 tufA 216592000084 gadA 216592000085 (gttggttca)3 216592000086 (tgaaccaac)3 216592000087 23mer direct repeat flanking island 216592000088 23mer direct repeat flanking island, partial tRNA 216592000089 IS1 216592000090 IS element flanking integron? 216592000091 IS1R 216592000092 30mer inverted repeat flanking transposon 216592000093 5 bp duplicated upon insertion of Integron 216592000094 25 bp terminal imperfect IRi of Integron; 5' end 216592000095 25 bp terminal imperfect IRt of Integron 216592000096 5 bp duplicated upon insertion of Integron 216592000097 30mer inverted repeat flanking transposon 216592000098 IS element flanking integron? 216592000099 IS1R 216592000100 (ggtgcaggtgca)4 216592000101 IS1397 216592000102 tufA 216592000103 rep26 216592000104 rep11 216592000105 rep11 216592000106 rep4 216592000107 rep5 216592000108 rep6 216592000109 rep1 216592000110 rep2a 216592000111 rep12 216592000112 rep28 216592000113 rep28 216592000114 rep13 216592000115 rep14 216592000116 IS629 216592000117 IS629 216592000118 rep15 216592000119 rep15 216592000120 rep16 216592000121 rep19 216592000122 IS629 216592000123 rep17 216592000124 IS30 216592000125 rep17_alt 216592000126 IS1 216592000127 rep26 216592000128 14mer direct repeat flanking misc. island, partial tRNA 216592000129 rep24 216592000130 IS2 216592000131 IS66 family element 216592000132 rep25 216592000133 rep15 216592000134 62mer direct repeat 216592000135 IS100 216592000136 IS600 216592000137 IS600 216592000138 82mer direct repeat 216592000139 rep20 216592000140 rep17 216592000141 IS1 216592000142 IS629 216592000143 rep19 216592000144 82mer direct repeat 216592000145 62mer direct repeat 216592000146 rep2a 216592000147 rep2b 216592000148 rep2c 216592000149 rep1 216592000150 rep6 216592000151 rep5 216592000152 rep4 216592000153 rep24 216592000154 14mer direct repeat flanking misc. island, partial tRNA 216592000155 IS1 216592000156 IS1 216592000157 hit to IS1414 288..1314 score: 5048 percent id: 99.12; IS911 element 216592000158 hit to IS1414 2..219 score: 1008 percent id: 95.89; IS911 element 216592000159 hit to IS911 241..1250 score: 4550 percent id: 94.89; IS911 element 216592000160 hit to IS911 1..337 score: 1676 percent id: 99.70; IS911 element 216592000161 hit to IS1F 1..768 score: 3183 percent id: 90.49; IS911 element 216592000162 (ctgttgtgg)22 216592000163 (agcagt)6 216592000164 (agcaggagcagg)4 216592000165 hit to IS3411 69..1310 score: 5994 percent id: 98.07; IS911 element 216592000166 hit to IS1203 1..1310 score: 6091 percent id: 96.11; IS911 element