-- dump date   	20140618_211949
-- class       	Genbank::misc_feature
-- table       	misc_feature_note
-- id	note
261594000001	Nuclease-related domain; Region: NERD; pfam08378
261594000002	N-terminal domain of reverse transcriptase; Region: RVT_N; pfam13655
261594000003	Retron-type reverse transcriptase [DNA replication, recombination, and repair]; Region: COG3344
261594000004	RT_G2_intron: Reverse transcriptases (RTs) with group II intron origin. RT transcribes DNA using RNA as template. Proteins in this subfamily are found in bacterial and mitochondrial group II introns. Their most probable ancestor was a retrotransposable...; Region: RT_G2_intron; cd01651
261594000005	putative active site [active]
261594000006	putative NTP binding site [chemical binding]; other site
261594000007	putative nucleic acid binding site [nucleotide binding]; other site
261594000008	Group II intron, maturase-specific domain; Region: GIIM; pfam08388
261594000009	HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cd00085
261594000010	active site
261594000011	Superfamily II DNA/RNA helicases, SNF2 family [Transcription / DNA replication, recombination, and repair]; Region: HepA; COG0553
261594000012	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594000013	S-adenosylmethionine binding site [chemical binding]; other site
261594000014	Sir2-like: Prokaryotic group of uncharacterized Sir2-like proteins which lack certain key catalytic residues and conserved zinc binding cysteines; and are members of the SIR2 superfamily of proteins, silent information regulator 2 (Sir2) enzymes which...; Region: SIR2-like; cd01406
261594000015	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
261594000016	non-specific DNA binding site [nucleotide binding]; other site
261594000017	sequence-specific DNA binding site [nucleotide binding]; other site
261594000018	salt bridge; other site
261594000019	Phage integrase, N-terminal SAM-like domain; Region: Phage_integr_N2; pfam13495
261594000020	DNA breaking-rejoining enzymes, intergrase/recombinases, C-terminal catalytic domain. The tyrosine recombinase/integrase family share the same catalytic domain containing six conserved active site residues. The best-studied members of this diverse family...; Region: INT_REC_C; cd01182
261594000021	active site
261594000022	catalytic residues [active]
261594000023	DNA binding site [nucleotide binding]
261594000024	Int/Topo IB signature motif; other site
261594000025	HEPN domain; Region: HEPN; pfam05168
261594000026	RT_G2_intron: Reverse transcriptases (RTs) with group II intron origin. RT transcribes DNA using RNA as template. Proteins in this subfamily are found in bacterial and mitochondrial group II introns. Their most probable ancestor was a retrotransposable...; Region: RT_G2_intron; cd01651
261594000027	Reverse transcriptase (RNA-dependent DNA polymerase); Region: RVT_1; pfam00078
261594000028	putative active site [active]
261594000029	putative NTP binding site [chemical binding]; other site
261594000030	putative nucleic acid binding site [nucleotide binding]; other site
261594000031	HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cd00085
261594000032	active site
261594000033	Nucleotidyltransferase (NT) domain of Staphylococcus aureus kanamycin nucleotidyltransferase, and similar proteins; Region: NT_KNTase_like; cd05403
261594000034	active site
261594000035	NTP binding site [chemical binding]; other site
261594000036	metal binding triad [ion binding]; metal-binding site
261594000037	antibiotic binding site [chemical binding]; other site
261594000038	Divergent AAA domain; Region: AAA_4; pfam04326
261594000039	30S ribosomal protein S1; Provisional; Region: rpsA; PRK13806
261594000040	RelA- and SpoT-like ppGpp Synthetases and Hydrolases, catalytic domain; Region: Rel-Spo_like; cl11966
261594000041	metal binding triad [ion binding]; metal-binding site
261594000042	Domain of unknown function (DUF4111); Region: DUF4111; pfam13427
261594000043	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
261594000044	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
261594000045	Abi-like protein; Region: Abi_2; pfam07751
261594000046	putative acetyltransferase; Provisional; Region: PRK03624
261594000047	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594000048	Coenzyme A binding pocket [chemical binding]; other site
261594000049	Transposase DDE domain; Region: DDE_Tnp_1; pfam01609
261594000050	Transposase DDE domain; Region: DDE_Tnp_1; pfam01609
261594000051	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
261594000052	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
261594000053	non-specific DNA binding site [nucleotide binding]; other site
261594000054	salt bridge; other site
261594000055	sequence-specific DNA binding site [nucleotide binding]; other site
261594000056	Domain of unknown function (DUF373); Region: DUF373; cl12079
261594000057	AAA-like domain; Region: AAA_10; pfam12846
261594000058	TraM recognition site of TraD and TraG; Region: TraG-D_C; cl17375
261594000059	Ftsk gamma domain; Region: Ftsk_gamma; pfam09397
261594000060	Replication-relaxation; Region: Replic_Relax; pfam13814
261594000061	Tubulin/FtsZ: Family includes tubulin alpha-, beta-, gamma-, delta-, and epsilon-tubulins as well as FtsZ, all of which are involved in polymer formation. Tubulin is the major component of microtubules, but also exists as a heterodimer and as a curved...; Region: Tubulin_FtsZ; cl10017
261594000062	Helix-Turn-Helix DNA binding domain of transcription regulators from the MerR superfamily; Region: HTH_MerR-SF; cl02600
261594000063	DNA binding residues [nucleotide binding]
261594000064	Domain of unknown function (DUF4320); Region: DUF4320; pfam14208
261594000065	S-layer homology domain; Region: SLH; pfam00395
261594000066	S-layer homology domain; Region: SLH; pfam00395
261594000067	S-layer homology domain; Region: SLH; pfam00395
261594000068	AAA domain; Region: AAA_31; pfam13614
261594000069	The Fer4_NifH superfamily contains a variety of proteins which share a common ATP-binding domain. Functionally, proteins in this superfamily use the energy from hydrolysis of NTP to transfer electron or ion; Region: Fer4_NifH; cl17203
261594000070	Flp pilus assembly protein, ATPase CpaF [Intracellular trafficking and secretion]; Region: CpaF; COG4962
261594000071	RecA-like NTPases. This family includes the NTP binding domain of F1 and V1 H+ATPases, DnaB and related helicases as well as bacterial RecA and related eukaryotic and archaeal recombinases. This group also includes bacterial conjugation proteins and...; Region: RecA-like_NTPases; cl17233
261594000072	Walker A motif; other site
261594000073	ATP binding site [chemical binding]; other site
261594000074	Walker B motif; other site
261594000075	WxL domain surface cell wall-binding; Region: WxL; pfam13731
261594000076	Bacterial protein of unknown function (DUF916); Region: DUF916; pfam06030
261594000077	Protein of unknown function C-terminal (DUF3324); Region: DUF3324; pfam11797
261594000078	Topoisomerase-primase domain. This is a nucleotidyl transferase/hydrolase domain found in type IA, type IIA and type IIB topoisomerases, bacterial DnaG-type primases, small primase-like proteins from bacteria and archaea, OLD family nucleases from...; Region: TOPRIM; cd00188
261594000079	active site
261594000080	metal binding site [ion binding]; metal-binding site
261594000081	PD-(D/E)XK nuclease family transposase; Region: PDDEXK_2; pfam12784
261594000082	conserved hypothetical protein (putative transposase or invertase); Region: T_den_put_tspse; TIGR01784
261594000083	Lysophospholipid acyltransferases (LPLATs) of glycerophospholipid biosynthesis; Region: LPLAT; cl17185
261594000084	PrgI family protein; Region: PrgI; pfam12666
261594000085	AAA-like domain; Region: AAA_10; pfam12846
261594000086	Uncharacterized protein conserved in bacteria (DUF2325); Region: DUF2325; pfam10087
261594000087	CAAX protease self-immunity; Region: Abi; pfam02517
261594000088	Predicted membrane protein [Function unknown]; Region: COG2311
261594000089	Protein of unknown function (DUF418); Region: DUF418; cl12135
261594000090	Protein of unknown function (DUF418); Region: DUF418; pfam04235
261594000091	TRX family; composed of two groups: Group I, which includes proteins that exclusively encode a TRX domain; and Group II, which are composed of fusion proteins of TRX and additional domains. Group I TRX is a small ancient protein that alter the redox...; Region: TRX_family; cd02947
261594000092	catalytic residues [active]
261594000093	NEAr Transport domain, a component of cell surface proteins; Region: NEAT; cd06920
261594000094	heme-binding site [chemical binding]; other site
261594000095	S-layer homology domain; Region: SLH; pfam00395
261594000096	S-layer homology domain; Region: SLH; pfam00395
261594000097	S-layer homology domain; Region: SLH; pfam00395
261594000098	Acetokinase family; Region: Acetate_kinase; cl17229
261594000099	PAP2_like_3 proteins. PAP2 is a super-family of phosphatases and haloperoxidases. This subgroup, which is specific to bacteria and archaea, lacks functional characterization and may act as a membrane-associated lipid phosphatase; Region: PAP2_like_3; cd03393
261594000100	active site
261594000101	Membrane-associated phospholipid phosphatase [Lipid metabolism]; Region: PgpB; COG0671
261594000102	Prokaryotic UGPase catalyses the synthesis of UDP-glucose; Region: UGPase_prokaryotic; cd02541
261594000103	dTDP-glucose pyrophosphorylase [Cell envelope biogenesis, outer membrane]; Region: RfbA; COG1209
261594000104	active site
261594000105	tetramer interface; other site
261594000106	Predicted UDP-glucose 6-dehydrogenase [Cell envelope biogenesis, outer membrane]; Region: Ugd; COG1004
261594000107	UDP-glucose/GDP-mannose dehydrogenase family, central domain; Region: UDPG_MGDP_dh; pfam00984
261594000108	UDP binding domain; Region: UDPG_MGDP_dh_C; smart00984
261594000109	Anthrax toxin lethal factor, N- and C-terminal domain; Region: ATLF; pfam07737
261594000110	Anthrax toxin LF subunit; Region: Anthrax_toxA; pfam03497
261594000111	Glycerol-3-phosphate acyltransferase; Region: G3P_acyltransf; cl00410
261594000112	HTH domain; Region: HTH_11; cl17392
261594000113	Mga helix-turn-helix domain; Region: Mga; pfam05043
261594000114	PRD domain; Region: PRD; pfam00874
261594000115	PRD domain; Region: PRD; pfam00874
261594000116	PTS_IIB_bgl_like: the PTS (phosphotransferase system) IIB domain of a family of sensory systems composed of a membrane-bound sugar-sensor (similar to BglF) and a transcription antiterminator (similar to BglG) which regulate expression of genes involved...; Region: PTS_IIB_bgl_like; cd05568
261594000117	Histidine kinase N terminal; Region: HisK_N; pfam09385
261594000118	Domain of unknown function (DUF4158); Region: DUF4158; pfam13700
261594000119	Tn3 transposase DDE domain; Region: DDE_Tnp_Tn3; pfam01526
261594000120	Site-specific recombinases, DNA invertase Pin homologs [DNA replication, recombination, and repair]; Region: PinR; COG1961
261594000121	Serine Recombinase (SR) family, Resolvase and Invertase subfamily, catalytic domain; members contain a C-terminal DNA binding domain. Serine recombinases catalyze site-specific recombination of DNA molecules by a concerted, four-strand cleavage and...; Region: SR_ResInv; cd03768
261594000122	catalytic residues [active]
261594000123	catalytic nucleophile [active]
261594000124	Presynaptic Site I dimer interface [polypeptide binding]; other site
261594000125	Synaptic Antiparallel dimer interface [polypeptide binding]; other site
261594000126	Synaptic Flat tetramer interface [polypeptide binding]; other site
261594000127	Synaptic Site I dimer interface [polypeptide binding]; other site
261594000128	DNA binding site [nucleotide binding]
261594000129	spore germination protein (amino acid permease); Region: 2A0309; TIGR00912
261594000130	Bacillus/Clostridium GerA spore germination protein; Region: GerA; pfam03323
261594000131	germination protein, Ger(x)C family; Region: spore_ger_x_C; TIGR02887
261594000132	Spore germination B3/ GerAC like, C-terminal; Region: Spore_GerAC; pfam05504
261594000133	PA14 domain; Region: PA14; pfam07691
261594000134	Clostridial binary toxin B/anthrax toxin PA; Region: Binary_toxB; pfam03495
261594000135	Animal heme peroxidases and related proteins; Region: An_peroxidase_like; cl14561
261594000136	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
261594000137	dimerization interface [polypeptide binding]; other site
261594000138	putative DNA binding site [nucleotide binding]; other site
261594000139	putative Zn2+ binding site [ion binding]; other site
261594000140	Anthrax toxin lethal factor, N- and C-terminal domain; Region: ATLF; pfam07737
261594000141	Protein of unknown function (DUF3106); Region: DUF3106; pfam11304
261594000142	Anthrax toxin lethal factor, middle domain; Region: Anthrax-tox_M; pfam09156
261594000143	VIP2; A family of actin-ADP-ribosylating toxin. A member of the Bacillus-prodiced vegetative insecticidal proteins (VIPs) possesses high specificity against the major insect pest, corn rootworms, and belongs to a classs of binary toxins and regulators of...; Region: VIP2; cl00173
261594000144	active site
261594000145	conformational flexibility of ligand binding pocket; other site
261594000146	ADP-ribosylating toxin turn-turn motif; other site
261594000147	Anthrax toxin lethal factor, N- and C-terminal domain; Region: ATLF; pfam07737
261594000148	Integrase [DNA replication, recombination, and repair]; Region: XerC; COG0582
261594000149	DNA breaking-rejoining enzymes, C-terminal catalytic domain. The DNA breaking-rejoining enzyme superfamily includes type IB topoisomerases and tyrosine recombinases that share the same fold in their catalytic domain containing six conserved active site...; Region: DNA_BRE_C; cl00213
261594000150	active site
261594000151	Int/Topo IB signature motif; other site
261594000152	DNA binding site [nucleotide binding]
261594000153	Helix-turn-helix domain; Region: HTH_17; pfam12728
261594000154	WXG100 family type VII secretion target; Region: WXG100_ESAT6; TIGR03930
261594000155	DNase/tRNase domain of colicin-like bacteriocin; Region: Colicin-DNase; pfam12639
261594000156	SMI1 / KNR4 family (SUKH-1); Region: SMI1_KNR4; pfam09346
261594000157	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG2963
261594000158	Homeodomain-like domain; Region: HTH_23; cl17451
261594000159	Homeodomain-like domain; Region: HTH_23; cl17451
261594000160	YodA lipocalin-like domain; Region: YodA; pfam09223
261594000161	Nucleotidyltransferase (NT) domain of RelA- and SpoT-like ppGpp synthetases and hydrolases; Region: NT_Rel-Spo_like; cd05399
261594000162	synthetase active site [active]
261594000163	NTP binding site [chemical binding]; other site
261594000164	metal binding site [ion binding]; metal-binding site
261594000165	site-specific tyrosine recombinase XerS; Reviewed; Region: xerS; PRK05084
261594000166	DNA breaking-rejoining enzymes, C-terminal catalytic domain. The DNA breaking-rejoining enzyme superfamily includes type IB topoisomerases and tyrosine recombinases that share the same fold in their catalytic domain containing six conserved active site...; Region: DNA_BRE_C; cl00213
261594000167	active site
261594000168	DNA binding site [nucleotide binding]
261594000169	Int/Topo IB signature motif; other site
261594000170	ATPases associated with a variety of cellular activities; Region: AAA; smart00382
261594000171	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cl17189
261594000172	Walker A motif; other site
261594000173	ATP binding site [chemical binding]; other site
261594000174	Walker B motif; other site
261594000175	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cl02429
261594000176	TPR motif; other site
261594000177	binding surface
261594000178	Tetratricopeptide repeat; Region: TPR_12; pfam13424
261594000179	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cd00189
261594000180	TPR motif; other site
261594000181	binding surface
261594000182	bacterial Hfq-like; Region: Hfq; cd01716
261594000183	hexamer interface [polypeptide binding]; other site
261594000184	Sm1 motif; other site
261594000185	RNA binding site [nucleotide binding]; other site
261594000186	Sm2 motif; other site
261594000187	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
261594000188	dimerization interface [polypeptide binding]; other site
261594000189	putative DNA binding site [nucleotide binding]; other site
261594000190	putative Zn2+ binding site [ion binding]; other site
261594000191	Disulfide bond formation protein DsbB; Region: DsbB; cl00649
261594000192	Staphylococcal nuclease homologues; Region: SNc; smart00318
261594000193	Catalytic site; other site
261594000194	Staphylococcal nuclease homologue; Region: SNase; pfam00565
261594000195	TOPRIM_TopoIA_TopoIII: The topoisomerase-primase (TORPIM) domain found in members of the type IA family of DNA topoisomerases (Topo IA) similar to topoisomerase III. Type IA DNA topoisomerases remove (relax) negative supercoils in the DNA by: cleaving...; Region: TOPRIM_TopoIA_TopoIII; cd03362
261594000196	DNA topoisomerase III; Provisional; Region: PRK07726
261594000197	active site
261594000198	putative metal-binding site [ion binding]; other site
261594000199	putative interdomain interaction site [polypeptide binding]; other site
261594000200	putative nucleotide binding site [chemical binding]; other site
261594000201	DNA Topoisomerase, subtype IA; DNA-binding, ATP-binding and catalytic domain of bacterial DNA topoisomerases I and III, and eukaryotic DNA topoisomerase III and eubacterial and archael reverse gyrases. Topoisomerases clevage single or double stranded DNA...; Region: TOP1Ac; cd00186
261594000202	domain I; other site
261594000203	DNA binding groove [nucleotide binding]
261594000204	phosphate binding site [ion binding]; other site
261594000205	domain II; other site
261594000206	domain III; other site
261594000207	nucleotide binding site [chemical binding]; other site
261594000208	catalytic site [active]
261594000209	domain IV; other site
261594000210	Topoisomerase DNA binding C4 zinc finger; Region: zf-C4_Topoisom; pfam01396
261594000211	Zn-finger domain associated with topoisomerase type I [DNA replication, recombination, and repair]; Region: TopA; COG0551
261594000212	C-terminal repeat of topoisomerase; Region: Toprim_Crpt; pfam13342
261594000213	C-terminal repeat of topoisomerase; Region: Toprim_Crpt; pfam13342
261594000214	C-terminal repeat of topoisomerase; Region: Toprim_Crpt; pfam13342
261594000215	transposase, IS605 OrfB family, central region; Region: tspaseT_teng_C; TIGR01766
261594000216	Putative transposase DNA-binding domain; Region: OrfB_Zn_ribbon; pfam07282
261594000217	Lysozyme-like; Region: Lysozyme_like; pfam13702
261594000218	Cell wall-associated hydrolases (invasion-associated proteins) [Cell envelope biogenesis, outer membrane]; Region: Spr; COG0791
261594000219	NlpC/P60 family; Region: NLPC_P60; pfam00877
261594000220	AAA-like domain; Region: AAA_10; pfam12846
261594000221	Predicted RNA-binding protein homologous to eukaryotic snRNP [Transcription]; Region: COG1293
261594000222	Type IV secretory pathway, VirB11 components, and related ATPases involved in archaeal flagella biosynthesis [Cell motility and secretion / Intracellular trafficking and secretion]; Region: VirB11; COG0630
261594000223	RecA-like NTPases. This family includes the NTP binding domain of F1 and V1 H+ATPases, DnaB and related helicases as well as bacterial RecA and related eukaryotic and archaeal recombinases. This group also includes bacterial conjugation proteins and...; Region: RecA-like_NTPases; cl17233
261594000224	Walker A motif; other site
261594000225	ATP binding site [chemical binding]; other site
261594000226	Walker B motif; other site
261594000227	Protein-interacting Bro1-like domain of mammalian Alix and related domains; Region: BRO1_Alix_like; cl14649
261594000228	Primase C terminal 1 (PriCT-1); Region: PriCT_1; pfam08708
261594000229	ATPases involved in chromosome partitioning [Cell division and chromosome partitioning]; Region: Soj; COG1192
261594000230	ParA and ParB of Caulobacter crescentus belong to a conserved family of bacterial proteins implicated in chromosome segregation. ParB binds to DNA sequences adjacent to the origin of replication and localizes to opposite cell poles shortly following the...; Region: ParA; cd02042
261594000231	P-loop; other site
261594000232	Magnesium ion binding site [ion binding]; other site
261594000233	ParA and ParB of Caulobacter crescentus belong to a conserved family of bacterial proteins implicated in chromosome segregation. ParB binds to DNA sequences adjacent to the origin of replication and localizes to opposite cell poles shortly following the...; Region: ParA; cd02042
261594000234	Magnesium ion binding site [ion binding]; other site
261594000235	S-layer homology domain; Region: SLH; pfam00395
261594000236	S-layer homology domain; Region: SLH; pfam00395
261594000237	S-layer homology domain; Region: SLH; pfam00395
261594000238	N-acetylmuramoyl-L-alanine amidase or MurNAc-LAA (also known as peptidoglycan aminohydrolase, NAMLA amidase, NAMLAA, Amidase 3, and peptidoglycan amidase; EC 3.5.1.28) is an autolysin that hydrolyzes the amide bond between N-acetylmuramoyl and L-amino...; Region: MurNAc-LAA; cd02696
261594000239	active site
261594000240	metal binding site [ion binding]; metal-binding site
261594000241	N-acetylmuramoyl-L-alanine amidase [Cell envelope biogenesis, outer membrane]; Region: AmiC; COG0860
261594000242	Putative heavy-metal-binding; Region: YbjQ_1; cl00426
261594000243	CAAX protease self-immunity; Region: Abi; pfam02517
261594000244	Uncharacterized conserved protein [Function unknown]; Region: COG1683
261594000245	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
261594000246	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
261594000247	M protein trans-acting positive regulator (MGA) HTH domain; Region: HTH_Mga; pfam08280
261594000248	Transcriptional antiterminator [Transcription]; Region: BglG; COG3711
261594000249	Mga helix-turn-helix domain; Region: Mga; pfam05043
261594000250	PTS_IIB_bgl_like: the PTS (phosphotransferase system) IIB domain of a family of sensory systems composed of a membrane-bound sugar-sensor (similar to BglF) and a transcription antiterminator (similar to BglG) which regulate expression of genes involved...; Region: PTS_IIB_bgl_like; cd05568
261594000251	active site
261594000252	P-loop; other site
261594000253	phosphorylation site [posttranslational modification]
261594000254	Protein of unknown function (DUF1093); Region: DUF1093; pfam06486
261594000255	Gamma-glutamyltransferase [Amino acid transport and metabolism]; Region: Ggt; cl08040
261594000256	Gamma-glutamyltranspeptidase; Region: G_glu_transpept; pfam01019
261594000257	Bacterial capsule synthesis protein PGA_cap; Region: PGA_cap; smart00854
261594000258	CapA and related proteins, metallophosphatase domain; Region: MPP_CapA; cd07381
261594000259	putative active site [active]
261594000260	putative metal binding site [ion binding]; other site
261594000261	poly-gamma-glutamate biosynthesis protein PgsC/CapC; Region: poly_gGlu_PgsC; TIGR04011
261594000262	poly-gamma-glutamate synthase PgsB/CapB; Region: poly_gGlu_PgsB; TIGR04012
261594000263	Mur ligase middle domain; Region: Mur_ligase_M; pfam08245
261594000264	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
261594000265	dimerization interface [polypeptide binding]; other site
261594000266	putative DNA binding site [nucleotide binding]; other site
261594000267	putative Zn2+ binding site [ion binding]; other site
261594000268	signal peptidase I, bacterial type; Region: sigpep_I_bact; TIGR02227
261594000269	The S26 Type I signal peptidase (SPase; LepB; leader peptidase B; leader peptidase I; EC 3.4.21.89) family members are essential membrane-bound serine proteases that function to cleave the amino-terminal signal peptide extension from proteins that are...; Region: S26_SPase_I; cd06530
261594000270	Catalytic site [active]
261594000271	Histidine kinase N terminal; Region: HisK_N; pfam09385
261594000272	The Resistance to Homoserine/Threonine (RhtB) Family protein; Region: 2A76; TIGR00949
261594000273	M protein trans-acting positive regulator (MGA) HTH domain; Region: HTH_Mga; pfam08280
261594000274	Transcriptional antiterminator [Transcription]; Region: BglG; COG3711
261594000275	Mga helix-turn-helix domain; Region: Mga; pfam05043
261594000276	CAAX protease self-immunity; Region: Abi; pfam02517
261594000277	ABC-type oligopeptide transport system, periplasmic component [Amino acid transport and metabolism]; Region: OppA; COG4166
261594000278	The substrate-binding component of an ABC-type oligopetide import system contains the type 2 periplasmic binding fold; Region: PBP2_OppA; cd08504
261594000279	peptide binding site [polypeptide binding]; other site
261594000280	Helix-Turn-Helix DNA binding domain of transcription regulators from the MerR superfamily; Region: HTH_MerR-SF; cl02600
261594000281	MerR HTH family regulatory protein; Region: MerR_1; pfam13411
261594000282	DNA binding residues [nucleotide binding]
261594000283	DNA polymerase IV; Reviewed; Region: PRK03103
261594000284	umuC subunit of DNA Polymerase V; Region: PolY_Pol_V_umuC; cd01700
261594000285	active site
261594000286	DNA binding site [nucleotide binding]
261594000287	Domain of unknown function (DUF4113); Region: DUF4113; pfam13438
261594000288	YolD-like protein; Region: YolD; pfam08863
261594000289	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cl17220
261594000290	Sir2-like: Prokaryotic group of uncharacterized Sir2-like proteins which lack certain key catalytic residues and conserved zinc binding cysteines; and are members of the SIR2 superfamily of proteins, silent information regulator 2 (Sir2) enzymes which...; Region: SIR2-like; cd01406
261594000291	Phage integrase, N-terminal SAM-like domain; Region: Phage_integr_N2; pfam13495
261594000292	DNA breaking-rejoining enzymes, intergrase/recombinases, C-terminal catalytic domain. The tyrosine recombinase/integrase family share the same catalytic domain containing six conserved active site residues. The best-studied members of this diverse family...; Region: INT_REC_C; cd01182
261594000293	active site
261594000294	catalytic residues [active]
261594000295	DNA binding site [nucleotide binding]
261594000296	Int/Topo IB signature motif; other site
261594000297	CAAX protease self-immunity; Region: Abi; pfam02517
261594000298	Protein of unknown function (DUF3991); Region: DUF3991; pfam13154
261594000299	Toprim-like; Region: Toprim_2; pfam13155
261594000300	Predicted membrane-bound metal-dependent hydrolase (DUF457); Region: DUF457; pfam04307
261594000301	chromosomal replication initiation protein; Reviewed; Region: dnaA; PRK00149
261594000302	DnaA N-terminal domain; Region: DnaA_N; pfam11638
261594000303	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
261594000304	Walker A motif; other site
261594000305	ATP binding site [chemical binding]; other site
261594000306	Walker B motif; other site
261594000307	arginine finger; other site
261594000308	C-terminal domain of bacterial DnaA proteins. The DNA-binding C-terminal domain of DnaA contains a helix-turn-helix motif that specifically interacts with the DnaA box, a 9-mer motif that occurs repetitively in the replication origin oriC. Multiple...; Region: Bac_DnaA_C; cd06571
261594000309	DnaA box-binding interface [nucleotide binding]; other site
261594000310	DNA polymerase III subunit beta; Validated; Region: PRK05643
261594000311	Beta clamp domain.  The beta subunit (processivity factor) of DNA polymerase III holoenzyme, refered to as the beta clamp, forms a ring shaped dimer that encircles dsDNA (sliding clamp) in bacteria.  The beta-clamp is structurally similar to the trimeric...; Region: beta_clamp; cd00140
261594000312	putative DNA binding surface [nucleotide binding]; other site
261594000313	dimer interface [polypeptide binding]; other site
261594000314	beta-clamp/clamp loader binding surface; other site
261594000315	beta-clamp/translesion DNA polymerase binding surface; other site
261594000316	S4 domain protein YaaA; Region: YaaA_near_RecF; TIGR02988
261594000317	recombination protein F; Reviewed; Region: recF; PRK00064
261594000318	ATP-binding cassette domain of RecF; Region: ABC_RecF; cd03242
261594000319	Walker A/P-loop; other site
261594000320	ATP binding site [chemical binding]; other site
261594000321	Q-loop/lid; other site
261594000322	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
261594000323	ABC transporter signature motif; other site
261594000324	Walker B; other site
261594000325	D-loop; other site
261594000326	H-loop/switch region; other site
261594000327	DNA gyrase subunit B; Validated; Region: gyrB; PRK05644
261594000328	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594000329	Mg2+ binding site [ion binding]; other site
261594000330	G-X-G motif; other site
261594000331	TopoIIA_Trans_DNA_gyrase: Transducer domain, having a ribosomal S5 domain 2-like fold, of the type found in proteins of the type IIA family of DNA topoisomerases similar to the B subunits of E. coli DNA gyrase and E. coli Topoisomerase IV which are; Region: TopoII_Trans_DNA_gyrase; cd00822
261594000332	anchoring element; other site
261594000333	dimer interface [polypeptide binding]; other site
261594000334	ATP binding site [chemical binding]; other site
261594000335	TOPRIM_TopoIIA_GyrB: topoisomerase-primase (TOPRIM) nucleotidyl transferase/hydrolase domain of the type found in proteins of the type IIA family of DNA topoisomerases similar to the Escherichia coli GyrB subunit. TopoIIA enzymes cut both strands of the...; Region: TOPRIM_TopoIIA_GyrB; cd03366
261594000336	active site
261594000337	putative metal-binding site [ion binding]; other site
261594000338	DNA gyrase B subunit, carboxyl terminus; Region: DNA_gyraseB_C; pfam00986
261594000339	DNA gyrase subunit A; Validated; Region: PRK05560
261594000340	DNA Topoisomerase, subtype IIA; domain A'; bacterial DNA topoisomerase IV (C subunit, ParC), bacterial DNA gyrases (A subunit, GyrA),mammalian DNA toposiomerases II. DNA topoisomerases are essential enzymes that regulate the conformational changes...; Region: TOP4c; cd00187
261594000341	CAP-like domain; other site
261594000342	active site
261594000343	primary dimer interface [polypeptide binding]; other site
261594000344	DNA gyrase C-terminal domain, beta-propeller; Region: DNA_gyraseA_C; pfam03989
261594000345	DNA gyrase C-terminal domain, beta-propeller; Region: DNA_gyraseA_C; pfam03989
261594000346	DNA gyrase C-terminal domain, beta-propeller; Region: DNA_gyraseA_C; pfam03989
261594000347	DNA gyrase C-terminal domain, beta-propeller; Region: DNA_gyraseA_C; pfam03989
261594000348	DNA gyrase C-terminal domain, beta-propeller; Region: DNA_gyraseA_C; pfam03989
261594000349	DNA gyrase C-terminal domain, beta-propeller; Region: DNA_gyraseA_C; pfam03989
261594000350	inosine 5'-monophosphate dehydrogenase; Reviewed; Region: PRK05567
261594000351	TIM barrel proteins share a structurally conserved phosphate binding motif and in general share an eight beta/alpha closed barrel structure. Specific for this family is the conserved phosphate binding site at the edges of strands 7 and 8. The phosphate...; Region: TIM_phosphate_binding; cl17186
261594000352	This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domains in the inosine 5' monophosphate dehydrogenase (IMPDH) protein.  IMPDH is an essential enzyme that catalyzes the first step unique to GTP synthesis, playing a...; Region: CBS_pair_IMPDH; cd04601
261594000353	IMPDH: The catalytic domain of the inosine monophosphate dehydrogenase. IMPDH catalyzes the NAD-dependent oxidation of inosine 5'-monophosphate (IMP) to xanthosine 5' monophosphate (XMP). It is a rate-limiting step in the de novo synthesis of...; Region: IMPDH; cd00381
261594000354	active site
261594000355	D-alanyl-D-alanine carboxypeptidase [Cell envelope biogenesis, outer membrane]; Region: DacC; COG1686
261594000356	Beta-lactamase enzyme family; Region: Beta-lactamase2; cl17872
261594000357	Penicillin-binding protein 5, C-terminal domain; Region: PBP5_C; smart00936
261594000358	pyridoxal 5'-phosphate synthase, synthase subunit Pdx1; Region: TIGR00343
261594000359	PdxS is a subunit of the pyridoxal 5'-phosphate (PLP) synthase, an important enzyme in deoxyxylulose 5-phosphate (DXP)-independent pathway for de novo biosynthesis of PLP,  present in some eubacteria, in archaea, fungi, plants, plasmodia, and some...; Region: pdxS; cd04727
261594000360	active site
261594000361	multimer interface [polypeptide binding]; other site
261594000362	Glutamine Amidotransferase (GATase_I) involved in pyridoxine biosynthesis; Region: GATase1_PB; cd01749
261594000363	predicted active site [active]
261594000364	catalytic triad [active]
261594000365	seryl-tRNA synthetase; Provisional; Region: PRK05431
261594000366	Seryl-tRNA synthetase N-terminal domain; Region: Seryl_tRNA_N; pfam02403
261594000367	Seryl-tRNA synthetase (SerRS) class II core catalytic domain. SerRS is responsible for the attachment of serine to the 3' OH group of ribose of the appropriate tRNA. This domain It is primarily responsible for ATP-dependent formation of the enzyme...; Region: SerRS_core; cd00770
261594000368	dimer interface [polypeptide binding]; other site
261594000369	active site
261594000370	motif 1; other site
261594000371	motif 2; other site
261594000372	motif 3; other site
261594000373	Domain of unknown function (DUF3797); Region: DUF3797; pfam12677
261594000374	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
261594000375	RNA polymerase sigma factor, sigma-70 family; Region: sigma70-ECF; TIGR02937
261594000376	DNA binding residues [nucleotide binding]
261594000377	Deoxynucleoside kinases [Nucleotide transport and metabolism]; Region: COG1428
261594000378	Deoxyribonucleoside kinase (dNK) catalyzes the phosphorylation of deoxyribonucleosides to yield corresponding monophosphates (dNMPs). This family consists of various deoxynucleoside kinases including deoxyribo- cytidine (EC 2.7.1.74), guanosine (EC 2.7.1; Region: dNK; cd01673
261594000379	Substrate-binding site [chemical binding]; other site
261594000380	Substrate specificity [chemical binding]; other site
261594000381	Deoxynucleoside kinases [Nucleotide transport and metabolism]; Region: COG1428
261594000382	Deoxyribonucleoside kinase (dNK) catalyzes the phosphorylation of deoxyribonucleosides to yield corresponding monophosphates (dNMPs). This family consists of various deoxynucleoside kinases including deoxyribo- cytidine (EC 2.7.1.74), guanosine (EC 2.7.1; Region: dNK; cd01673
261594000383	Substrate-binding site [chemical binding]; other site
261594000384	Substrate specificity [chemical binding]; other site
261594000385	Isochorismatase family; Region: Isochorismatase; pfam00857
261594000386	Cysteine hydrolases; This family contains amidohydrolases, like CSHase (N-carbamoylsarcosine amidohydrolase), involved in creatine metabolism and nicotinamidase, converting nicotinamide to nicotinic acid and ammonia in the pyridine nucleotide cycle. It...; Region: cysteine_hydrolases; cd00431
261594000387	catalytic triad [active]
261594000388	conserved cis-peptide bond; other site
261594000389	Nucleoside deaminases include adenosine, guanine and cytosine deaminases. These enzymes are Zn dependent and catalyze the deamination of nucleosides. The zinc ion in the active site plays a central role in the proposed catalytic mechanism, activating a...; Region: nucleoside_deaminase; cd01285
261594000390	nucleoside/Zn binding site; other site
261594000391	dimer interface [polypeptide binding]; other site
261594000392	catalytic motif [active]
261594000393	DNA polymerase III subunits gamma and tau; Validated; Region: PRK05563
261594000394	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
261594000395	Walker A motif; other site
261594000396	ATP binding site [chemical binding]; other site
261594000397	Walker B motif; other site
261594000398	arginine finger; other site
261594000399	DNA polymerase III subunits gamma and tau domain III; Region: DNA_pol3_gamma3; pfam12169
261594000400	hypothetical protein; Validated; Region: PRK00153
261594000401	recombination protein RecR; Reviewed; Region: recR; PRK00076
261594000402	RecR protein; Region: RecR; pfam02132
261594000403	TOPRIM_recR: topoisomerase-primase (TOPRIM) nucleotidyl transferase/hydrolase domain of the type found in Escherichia coli RecR.  RecR participates in the RecFOR pathway of homologous recombinational repair in prokaryotes. This pathway provides a...; Region: TOPRIM_recR; cd01025
261594000404	putative active site [active]
261594000405	putative metal-binding site [ion binding]; other site
261594000406	tetramer interface [polypeptide binding]; other site
261594000407	Protein of unknown function (DUF2508); Region: DUF2508; pfam10704
261594000408	pro-sigmaK processing inhibitor BofA; Region: spore_BofA; TIGR02862
261594000409	Inhibitor of sigma-G Gin; Region: Gin; pfam10764
261594000410	Arginine/lysine/ornithine decarboxylases [Amino acid transport and metabolism]; Region: LdcC; COG1982
261594000411	Ornithine decarboxylase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD corresponds to ornithine decarboxylase (ODC), arginine decarboxylase (ADC) and lysine...; Region: Orn_deC_like; cd00615
261594000412	homodimer interface [polypeptide binding]; other site
261594000413	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594000414	catalytic residue [active]
261594000415	Orn/Lys/Arg decarboxylase, C-terminal domain; Region: OKR_DC_1_C; pfam03711
261594000416	thymidylate kinase; Validated; Region: tmk; PRK00698
261594000417	Thymidine monophosphate kinase (TMPK), also known as thymidylate kinase, catalyzes the phosphorylation of thymidine monophosphate (TMP) to thymidine diphosphate (TDP) utilizing ATP as its preferred phophoryl donor. TMPK represents the rate-limiting step...; Region: TMPK; cd01672
261594000418	TMP-binding site; other site
261594000419	ATP-binding site [chemical binding]; other site
261594000420	DNA polymerase III subunit delta'; Validated; Region: PRK08058
261594000421	DNA polymerase III subunit delta'; Validated; Region: PRK08485
261594000422	Uncharacterized homolog of PSP1 [Function unknown]; Region: COG1774
261594000423	DNA replication intiation control protein YabA; Reviewed; Region: PRK13169
261594000424	Predicted O-methyltransferase [General function prediction only]; Region: COG4123
261594000425	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594000426	S-adenosylmethionine binding site [chemical binding]; other site
261594000427	The GIY-YIG domain of uncharacterized protein family UPF0213 related to structure-specific endonuclease SLX1; Region: GIY-YIG_UPF0213; cd10456
261594000428	GIY-YIG motif/motif A; other site
261594000429	putative active site [active]
261594000430	putative metal binding site [ion binding]; other site
261594000431	Predicted methyltransferases [General function prediction only]; Region: COG0313
261594000432	Ribosomal RNA small subunit methyltransferase I, also known as rRNA (cytidine-2'-O-)-methyltransferase RsmI; Region: RsmI; cd11648
261594000433	putative SAM binding site [chemical binding]; other site
261594000434	putative homodimer interface [polypeptide binding]; other site
261594000435	Regulators of stationary/sporulation gene expression [Transcription]; Region: AbrB; COG2002
261594000436	SpoVT / AbrB like domain; Region: SpoVT_AbrB; smart00966
261594000437	methionyl-tRNA synthetase; Reviewed; Region: PRK12267
261594000438	catalytic core domain of methioninyl-tRNA synthetases; Region: MetRS_core; cd00814
261594000439	active site
261594000440	HIGH motif; other site
261594000441	KMSKS motif; other site
261594000442	Anticodon-binding domain of methionyl tRNA synthetases; Region: Anticodon_Ia_Met; cd07957
261594000443	tRNA binding surface [nucleotide binding]; other site
261594000444	anticodon binding site; other site
261594000445	tRNA-binding-domain-containing Escherichia coli methionyl-tRNA synthetase (EcMetRS)-like proteins.  This family includes EcMetRS and Aquifex aeolicus Trbp111 (AaTrbp111). This domain has general tRNA binding properties.  MetRS aminoacylates methionine...; Region: tRNA_bind_EcMetRS_like; cd02800
261594000446	dimer interface [polypeptide binding]; other site
261594000447	putative tRNA-binding site [nucleotide binding]; other site
261594000448	Predicted metal-dependent hydrolases with the TIM-barrel fold [General function prediction only]; Region: COG1099
261594000449	TatD like proteins;  E.coli TatD is a cytoplasmic protein, shown to have magnesium dependent DNase activity; Region: TatD_DNAse; cd01310
261594000450	active site
261594000451	ribonuclease M5; Region: 5S_RNA_mat_M5; TIGR00334
261594000452	TOPRIM_ RNase M5_like: The topoisomerase-primase (TOPRIM) nucleotidyl transferase/hydrolase domain found in Ribonuclease M5: (RNase M5) and other small primase-like proteins from bacteria and archaea.  RNase M5 catalyzes the maturation of 5S rRNA in low...; Region: TOPRIM_RNase_M5_like; cd01027
261594000453	putative active site [active]
261594000454	putative metal binding site [ion binding]; other site
261594000455	Domain of unknown function (DUF4093); Region: DUF4093; pfam13331
261594000456	16S ribosomal RNA methyltransferase KsgA/Dim1 family protein; Reviewed; Region: ksgA; PRK00274
261594000457	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594000458	S-adenosylmethionine binding site [chemical binding]; other site
261594000459	sporulation peptidase YabG; Region: spore_yabG; TIGR02855
261594000460	Protein of unknown function (DUF1021); Region: DUF1021; pfam06257
261594000461	Small, acid-soluble spore proteins, alpha/beta type; Region: SASP; pfam00269
261594000462	4-diphosphocytidyl-2-C-methyl-D-erythritol kinase; Provisional; Region: ipk; PRK00128
261594000463	GHMP kinases N terminal domain; Region: GHMP_kinases_N; pfam00288
261594000464	GHMP kinases C terminal; Region: GHMP_kinases_C; pfam08544
261594000465	pur operon repressor; Provisional; Region: PRK09213
261594000466	Bacterial purine repressor, N-terminal; Region: PuR_N; pfam09182
261594000467	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
261594000468	active site
261594000469	YjgF, YER057c, and UK114 belong to a large family of proteins present in bacteria, archaea, and eukaryotes with no definitive function. The conserved domain is similar in structure to chorismate mutase but there is no sequence similarity and no...; Region: YjgF_YER057c_UK114_family; cd00448
261594000470	homotrimer interaction site [polypeptide binding]; other site
261594000471	putative active site [active]
261594000472	regulatory protein SpoVG; Reviewed; Region: PRK13259
261594000473	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase; Provisional; Region: glmU; PRK14354
261594000474	N-terminal domain of bacterial GlmU; Region: GT2_GlmU_N_bac; cd02540
261594000475	Substrate binding site; other site
261594000476	Mg++ binding site; other site
261594000477	N-acetyl-glucosamine-1-phosphate uridyltransferase (GlmU), C-terminal left-handed beta-helix (LbH) acetyltransferase domain: GlmU is also known as UDP-N-acetylglucosamine pyrophosphorylase. It is a bifunctional bacterial enzyme that catalyzes two...; Region: LbH_GlmU_C; cd03353
261594000478	active site
261594000479	substrate binding site [chemical binding]; other site
261594000480	CoA binding site [chemical binding]; other site
261594000481	ribose-phosphate pyrophosphokinase; Provisional; Region: PRK01259
261594000482	N-terminal domain of ribose phosphate pyrophosphokinase; Region: Pribosyltran_N; pfam13793
261594000483	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
261594000484	active site
261594000485	Peptidyl-tRNA hydrolase (PTH) is a monomeric protein that cleaves the ester bond linking the nascent peptide and tRNA when peptidyl-tRNA is released prematurely from the ribosome. This ensures the recycling of peptidyl-tRNAs into tRNAs produced through...; Region: PTH; cd00462
261594000486	putative active site [active]
261594000487	catalytic residue [active]
261594000488	Protein of unknown function (DUF2757); Region: DUF2757; pfam10955
261594000489	Transcription-repair coupling factor (superfamily II helicase) [DNA replication, recombination, and repair / Transcription]; Region: Mfd; COG1197
261594000490	CarD-like/TRCF domain; Region: CarD_TRCF; smart01058
261594000491	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
261594000492	ATP binding site [chemical binding]; other site
261594000493	putative Mg++ binding site [ion binding]; other site
261594000494	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
261594000495	nucleotide binding region [chemical binding]; other site
261594000496	ATP-binding site [chemical binding]; other site
261594000497	TRCF domain; Region: TRCF; pfam03461
261594000498	stage V sporulation protein T; Region: spore_V_T; TIGR02851
261594000499	Antidote-toxin recognition MazE; Region: Antitoxin-MazE; pfam04014
261594000500	Stage V sporulation protein B, also known as Stage III sporulation protein F, and related proteins; Region: MATE_SpoVB_like; cd13124
261594000501	Protein containing tetrapyrrole methyltransferase domain and MazG-like (predicted pyrophosphatase) domain [General function prediction only]; Region: COG3956
261594000502	N-terminal S-AdoMet dependent methylase domain of Bacillus subtilis YabN and related proteins; Region: YabN_N; cd11723
261594000503	putative SAM binding site [chemical binding]; other site
261594000504	putative homodimer interface [polypeptide binding]; other site
261594000505	Nucleoside Triphosphate Pyrophosphohydrolase (EC 3.6.1.8) N-terminal tandem-domain of MazG proteins from Escherichia coli and bacterial homologs; Region: NTP-PPase_MazG_Nterm; cd11528
261594000506	homodimer interface [polypeptide binding]; other site
261594000507	metal binding site [ion binding]; metal-binding site
261594000508	Nucleoside Triphosphate Pyrophosphohydrolase (EC 3.6.1.8) C-terminal tandem-domain of MazG proteins from Escherichia coli and bacterial homologs' Region: NTP-PPase_MazG_Cterm; cd11529
261594000509	homodimer interface [polypeptide binding]; other site
261594000510	active site
261594000511	putative chemical substrate binding site [chemical binding]; other site
261594000512	metal binding site [ion binding]; metal-binding site
261594000513	S4/Hsp/ tRNA synthetase RNA-binding domain; The domain surface is populated by conserved, charged residues that define a likely RNA-binding site;  Found in stress proteins, ribosomal proteins and tRNA synthetases; This may imply a hitherto unrecognized...; Region: S4; cd00165
261594000514	RNA binding surface [nucleotide binding]; other site
261594000515	sporulation protein YabP; Region: spore_yabP; TIGR02892
261594000516	spore cortex biosynthesis protein YabQ; Region: spore_yabQ; TIGR02893
261594000517	Septum formation initiator [Cell division and chromosome partitioning]; Region: COG2919
261594000518	Septum formation initiator; Region: DivIC; pfam04977
261594000519	hypothetical protein; Provisional; Region: PRK08582
261594000520	S1_RPS1_repeat_hs4: Ribosomal protein S1 (RPS1) domain. RPS1 is a component of the small ribosomal subunit thought to be involved in the recognition and binding of mRNA's during translation initiation. The bacterial RPS1 domain architecture consists...; Region: S1_RPS1_repeat_hs4; cd05692
261594000521	RNA binding site [nucleotide binding]; other site
261594000522	stage II sporulation protein E; Region: spore_II_E; TIGR02865
261594000523	Stage II sporulation protein E (SpoIIE); Region: SpoIIE; pfam07228
261594000524	tRNA(Ile)-lysidine synthase MesJ [Cell cycle control, cell division, chromosome partitioning]; Region: MesJ; COG0037
261594000525	N-terminal domain of predicted ATPase of the PP-loop faimly implicated in cell cycle control [Cell division and chromosome partitioning]. This is a subfamily of Adenine nucleotide alpha hydrolases superfamily.Adeninosine nucleotide alpha hydrolases...; Region: PP-ATPase; cd01992
261594000526	Ligand Binding Site [chemical binding]; other site
261594000527	TilS substrate binding domain; Region: TilS; pfam09179
261594000528	TilS substrate C-terminal domain; Region: TilS_C; smart00977
261594000529	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
261594000530	active site
261594000531	FtsH Extracellular; Region: FtsH_ext; pfam06480
261594000532	ATP-dependent metalloprotease FtsH; Region: FtsH_fam; TIGR01241
261594000533	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
261594000534	Walker A motif; other site
261594000535	ATP binding site [chemical binding]; other site
261594000536	Walker B motif; other site
261594000537	arginine finger; other site
261594000538	Peptidase family M41; Region: Peptidase_M41; pfam01434
261594000539	pantothenate kinase; Reviewed; Region: PRK13318
261594000540	Hsp33-like chaperonin; Reviewed; Region: hslO; PRK00114
261594000541	Heat shock protein 33 (Hsp33):  Cytosolic protein that acts as a molecular chaperone under oxidative conditions.  In normal (reducing) cytosolic conditions, four conserved Cys residues are coordinated by a Zn ion. Under oxidative stress (such as heat...; Region: Hsp33; cd00498
261594000542	dimerization interface [polypeptide binding]; other site
261594000543	domain crossover interface; other site
261594000544	redox-dependent activation switch; other site
261594000545	Cysteine synthase [Amino acid transport and metabolism]; Region: CysK; COG0031
261594000546	CBS_like: This subgroup includes Cystathionine beta-synthase (CBS) and Cysteine synthase. CBS is a unique heme-containing enzyme that catalyzes a pyridoxal 5'-phosphate (PLP)-dependent condensation of serine and homocysteine to give cystathionine; Region: CBS_like; cd01561
261594000547	dimer interface [polypeptide binding]; other site
261594000548	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594000549	catalytic residue [active]
261594000550	Anthranilate/para-aminobenzoate synthases component I [Amino acid transport and metabolism / Coenzyme metabolism]; Region: TrpE; COG0147
261594000551	Anthranilate synthase component I, N terminal region; Region: Anth_synt_I_N; pfam04715
261594000552	chorismate binding enzyme; Region: Chorismate_bind; pfam00425
261594000553	para-aminobenzoate synthase component II; Provisional; Region: PRK08857
261594000554	Type 1 glutamine amidotransferase (GATase1) domain found in Anthranilate synthase; Region: GATase1_Anthranilate_Synthase; cd01743
261594000555	glutamine binding [chemical binding]; other site
261594000556	catalytic triad [active]
261594000557	Branched-chain amino acid aminotransferase/4-amino-4-deoxychorismate lyase [Amino acid transport and metabolism / Coenzyme metabolism]; Region: IlvE; COG0115
261594000558	PyridoxaL 5'-Phosphate Dependent Enzymes class IV (PLPDE_IV). This D-amino acid superfamily, one of five classes of PLPDE, consists of branched-chain amino acid aminotransferases (BCAT), D-amino acid transferases (DAAT), and...; Region: PLPDE_IV; cd00449
261594000559	homodimer interface [polypeptide binding]; other site
261594000560	substrate-cofactor binding pocket; other site
261594000561	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594000562	catalytic residue [active]
261594000563	DHPS subgroup of Pterin binding enzymes. DHPS (dihydropteroate synthase), a functional homodimer, catalyzes the condensation of p-aminobenzoic acid (pABA) in the de novo biosynthesis of folate, which is an essential cofactor in both nucleic acid and...; Region: DHPS; cd00739
261594000564	dihydropteroate synthase; Region: DHPS; TIGR01496
261594000565	substrate binding pocket [chemical binding]; other site
261594000566	dimer interface [polypeptide binding]; other site
261594000567	inhibitor binding site; inhibition site
261594000568	Dihydroneopterin aldolase (DHNA) and 7,8-dihydroneopterin triphosphate epimerase domain (DHNTPE); these enzymes have been designated folB and folX, respectively. Folate derivatives are essential cofactors in the biosynthesis of purines, pyrimidines, and...; Region: DHNA_DHNTPE; cd00534
261594000569	homooctamer interface [polypeptide binding]; other site
261594000570	active site
261594000571	7,8-dihydro-6-hydroxymethylpterin-pyrophosphokinase (HPPK). Folate derivatives are essential cofactors in the biosynthesis of purines, pyrimidines, and amino acids as well as formyl-tRNA. Mammalian cells are able to utilize pre-formed folates after...; Region: HPPK; cd00483
261594000572	catalytic center binding site [active]
261594000573	ATP binding site [chemical binding]; other site
261594000574	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
261594000575	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
261594000576	non-specific DNA binding site [nucleotide binding]; other site
261594000577	salt bridge; other site
261594000578	sequence-specific DNA binding site [nucleotide binding]; other site
261594000579	putative TIM-barrel protein, nifR3 family; Region: nifR3_yhdG; TIGR00737
261594000580	Dihydrouridine synthase-like (DUS-like) FMN-binding domain. Members of this family catalyze the reduction of the 5,6-double bond of a uridine residue on tRNA. Dihydrouridine modification of tRNA is widely observed in prokaryotes and eukaryotes, and also...; Region: DUS_like_FMN; cd02801
261594000581	FMN binding site [chemical binding]; other site
261594000582	active site
261594000583	catalytic residues [active]
261594000584	substrate binding site [chemical binding]; other site
261594000585	lysyl-tRNA synthetase; Reviewed; Region: lysS; PRK00484
261594000586	LysRS_N: N-terminal, anticodon recognition domain of lysyl-tRNA synthetases (LysRS). These enzymes are homodimeric class 2b aminoacyl-tRNA synthetases (aaRSs). This domain is a beta-barrel domain (OB fold) involved in binding the tRNA anticodon stem-loop; Region: LysRS_N; cd04322
261594000587	dimer interface [polypeptide binding]; other site
261594000588	putative anticodon binding site; other site
261594000589	Lys_tRNA synthetase (LysRS) class II core domain. Class II LysRS is a dimer which attaches a lysine to the 3' OH group of ribose of the appropriate tRNA. Its assignment to class II aaRS is based upon its structure and the presence of three...; Region: LysRS_core; cd00775
261594000590	motif 1; other site
261594000591	active site
261594000592	motif 2; other site
261594000593	motif 3; other site
261594000594	Firmicute transcriptional repressor of class III stress genes (CtsR); Region: CtsR; pfam05848
261594000595	Modulator of heat shock repressor CtsR, McsA [Signal transduction    mechanisms]; Region: COG3880
261594000596	UvrB/uvrC motif; Region: UVR; pfam02151
261594000597	ATP:guanido phosphotransferase; Provisional; Region: PRK01059
261594000598	Phosphagen (guanidino) kinases found in bacteria; Region: bacterial_phosphagen_kinase; cd07930
261594000599	ADP binding site [chemical binding]; other site
261594000600	phosphagen binding site; other site
261594000601	substrate specificity loop; other site
261594000602	ATP-binding subunits of Clp protease and DnaK/DnaJ chaperones [Posttranslational modification, protein turnover, chaperones]; Region: clpA; COG0542
261594000603	Clp amino terminal domain; Region: Clp_N; pfam02861
261594000604	Clp amino terminal domain; Region: Clp_N; pfam02861
261594000605	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
261594000606	Walker A motif; other site
261594000607	ATP binding site [chemical binding]; other site
261594000608	Walker B motif; other site
261594000609	arginine finger; other site
261594000610	UvrB/uvrC motif; Region: UVR; pfam02151
261594000611	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
261594000612	Walker A motif; other site
261594000613	ATP binding site [chemical binding]; other site
261594000614	Walker B motif; other site
261594000615	C-terminal, D2-small domain, of ClpB protein; Region: ClpB_D2-small; smart01086
261594000616	DNA repair protein RadA; Provisional; Region: PRK11823
261594000617	Sms (bacterial radA) DNA repair protein. This protein is not related to archael radA any more than is to other RecA-like NTPases. Sms has a role in recombination and recombinational repair and is responsible for the stabilization or processing of...; Region: Sms; cd01121
261594000618	Walker A motif/ATP binding site; other site
261594000619	ATP binding site [chemical binding]; other site
261594000620	Walker B motif; other site
261594000621	Subunit ChlI of Mg-chelatase; Region: ChlI; pfam13541
261594000622	DNA integrity scanning protein DisA; Provisional; Region: PRK13482
261594000623	DisA bacterial checkpoint controller nucleotide-binding; Region: DisA_N; pfam02457
261594000624	DisA bacterial checkpoint controller linker region; Region: DisA-linker; pfam10635
261594000625	Integral membrane protein (PIN domain superfamily) [General function prediction only]; Region: COG4956
261594000626	PIN domain of Thermus Thermophilus Hb8, uncharacterized Bacillus subtilis YacL, and other bacterial homologs; Region: PIN_YacL; cd09877
261594000627	putative active site [active]
261594000628	CDP-ME synthetase is involved in mevalonate-independent isoprenoid production; Region: CDP-ME_synthetase; cd02516
261594000629	substrate binding site; other site
261594000630	dimer interface; other site
261594000631	MECDP_synthase (2-C-methyl-D-erythritol-2,4-cyclodiphosphate synthase), encoded by the ispF gene, catalyzes the formation of 2-C-methyl-D-erythritol 2,4-cyclodiphosphate (MEC) in the non-mevalonate deoxyxylulose (DOXP) pathway for isoprenoid biosynthesis; Region: MECDP_synthase; cd00554
261594000632	homotrimer interaction site [polypeptide binding]; other site
261594000633	zinc binding site [ion binding]; other site
261594000634	CDP-binding sites; other site
261594000635	glutamyl-tRNA synthetase; Reviewed; Region: gltX; PRK01406
261594000636	catalytic core domain of discriminating glutamyl-tRNA synthetase; Region: GluRS_core; cd00808
261594000637	active site
261594000638	HIGH motif; other site
261594000639	catalytic core domain of discriminating glutamyl-tRNA synthetase; Region: GluRS_core; cd00808
261594000640	active site
261594000641	KMSKS motif; other site
261594000642	serine O-acetyltransferase; Region: cysE; TIGR01172
261594000643	Serine acetyltransferase, N-terminal; Region: SATase_N; cl05762
261594000644	Serine acetyltransferase (SAT): SAT catalyzes the CoA-dependent acetylation of the side chain hydroxyl group of L-serine to form O-acetylserine, as the first step of a two-step biosynthetic pathway in bacteria and plants leading to the formation of...; Region: LbH_SAT; cd03354
261594000645	trimer interface [polypeptide binding]; other site
261594000646	active site
261594000647	substrate binding site [chemical binding]; other site
261594000648	CoA binding site [chemical binding]; other site
261594000649	cysteinyl-tRNA synthetase; Validated; Region: cysS; PRK00260
261594000650	catalytic core domain of cysteinyl tRNA synthetase; Region: CysRS_core; cd00672
261594000651	active site
261594000652	HIGH motif; other site
261594000653	catalytic core domain of cysteinyl tRNA synthetase; Region: CysRS_core; cd00672
261594000654	KMSKS motif; other site
261594000655	Anticodon-binding domain of class Ia aminoacyl tRNA synthetases and similar domains; Region: Anticodon_Ia_like; cl12020
261594000656	tRNA binding surface [nucleotide binding]; other site
261594000657	anticodon binding site; other site
261594000658	Ribonuclease III family protein [Replication, recombination, and    repair]; Region: COG1939
261594000659	active site
261594000660	metal binding site [ion binding]; metal-binding site
261594000661	dimerization interface [polypeptide binding]; other site
261594000662	rRNA methylase, putative, group 3; Region: rRNA_methyl_3; TIGR00186
261594000663	RNA 2'-O ribose methyltransferase substrate binding; Region: SpoU_sub_bind; pfam08032
261594000664	SpoU rRNA Methylase family; Region: SpoU_methylase; pfam00588
261594000665	YacP-like NYN domain; Region: NYN_YacP; pfam05991
261594000666	RNA polymerase sigma-H factor; Region: spore_sigH; TIGR02859
261594000667	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
261594000668	Sigma-70, region 4; Region: Sigma70_r4_2; pfam08281
261594000669	50S ribosomal protein L33; Validated; Region: rpmG; PRK00504
261594000670	preprotein translocase subunit SecE; Reviewed; Region: secE; PRK07597
261594000671	transcription antitermination protein NusG; Validated; Region: nusG; PRK05609
261594000672	Bacterial N-Utilization Substance G (NusG) N-terminal (NGN) domain, subgroup 1; Region: NGN_Bact_1; cd09891
261594000673	putative homodimer interface [polypeptide binding]; other site
261594000674	NusG contains an NGN domain at its N-terminus and KOW motif at its C-terminus; Region: KOW_NusG; cd06091
261594000675	heterodimer interface [polypeptide binding]; other site
261594000676	homodimer interface [polypeptide binding]; other site
261594000677	50S ribosomal protein L11; Validated; Region: rplK; PRK00140
261594000678	Ribosomal protein L11. Ribosomal protein L11, together with proteins L10 and L7/L12, and 23S rRNA, form the L7/L12 stalk on the surface of the large subunit of the ribosome. The homologous eukaryotic cytoplasmic protein is also called 60S ribosomal...; Region: Ribosomal_L11; cd00349
261594000679	23S rRNA interface [nucleotide binding]; other site
261594000680	L7/L12 interface [polypeptide binding]; other site
261594000681	putative thiostrepton binding site; other site
261594000682	L25 interface [polypeptide binding]; other site
261594000683	Ribosomal protein L1.  The L1 protein, located near the E-site of the ribosome, forms part of the L1 stalk along with 23S rRNA.  In bacteria and archaea, L1 functions both as a ribosomal protein that binds rRNA, and as a translation repressor that binds...; Region: Ribosomal_L1; cd00403
261594000684	mRNA/rRNA interface [nucleotide binding]; other site
261594000685	Ribosomal protein L10 family, L10 subfamily; composed of bacterial 50S ribosomal protein and eukaryotic mitochondrial 39S ribosomal protein, L10. L10 occupies the L7/L12 stalk of the ribosome. The N-terminal domain (NTD) of L10 interacts with L11 protein...; Region: Ribosomal_L10; cd05797
261594000686	23S rRNA interface [nucleotide binding]; other site
261594000687	Interface with L7/L12 ribosomal proteins [polypeptide binding]; other site
261594000688	Ribosomal protein L7/L12. Ribosomal protein L7/L12 refers to the large ribosomal subunit proteins L7 and L12, which are identical except that L7 is acetylated at the N terminus. It is a component of the L7/L12 stalk, which is located at the surface of...; Region: Ribosomal_L7_L12; cd00387
261594000689	core dimer interface [polypeptide binding]; other site
261594000690	peripheral dimer interface [polypeptide binding]; other site
261594000691	L10 interface [polypeptide binding]; other site
261594000692	L11 interface [polypeptide binding]; other site
261594000693	putative EF-Tu interaction site [polypeptide binding]; other site
261594000694	putative EF-G interaction site [polypeptide binding]; other site
261594000695	16S RNA G1207 methylase RsmC [Translation, ribosomal structure and biogenesis]; Region: RsmC; COG2813
261594000696	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594000697	S-adenosylmethionine binding site [chemical binding]; other site
261594000698	DNA-directed RNA polymerase, beta subunit/140 kD subunit [Transcription]; Region: RpoB; COG0085
261594000699	RNA polymerase beta subunit. RNA polymerases catalyse the DNA dependent polymerization of RNA. Prokaryotes contain a single RNA polymerase compared to three in eukaryotes (not including mitochondrial. and chloroplast polymerases). Each RNA polymerase...; Region: RNA_pol_B_RPB2; cl17585
261594000700	RNA polymerase Rpb2, domain 2; Region: RNA_pol_Rpb2_2; pfam04561
261594000701	RNA polymerase beta subunit. RNA polymerases catalyse the DNA dependent polymerization of RNA. Prokaryotes contain a single RNA polymerase compared to three in eukaryotes (not including mitochondrial. and chloroplast polymerases). Each RNA polymerase...; Region: RNA_pol_B_RPB2; cl17585
261594000702	RNA polymerase beta subunit external 1 domain; Region: RNA_pol_Rpb2_45; pfam10385
261594000703	RNA polymerase beta subunit. RNA polymerases catalyse the DNA dependent polymerization of RNA. Prokaryotes contain a single RNA polymerase compared to three in eukaryotes (not including mitochondrial. and chloroplast polymerases). Each RNA polymerase...; Region: RNA_pol_B_RPB2; cl17585
261594000704	RNA polymerase beta subunit. RNA polymerases catalyse the DNA dependent polymerization of RNA. Prokaryotes contain a single RNA polymerase compared to three in eukaryotes (not including mitochondrial. and chloroplast polymerases). Each RNA polymerase...; Region: RNA_pol_B_RPB2; cd00653
261594000705	RPB10 interaction site [polypeptide binding]; other site
261594000706	RPB1 interaction site [polypeptide binding]; other site
261594000707	RPB11 interaction site [polypeptide binding]; other site
261594000708	RPB3 interaction site [polypeptide binding]; other site
261594000709	RPB12 interaction site [polypeptide binding]; other site
261594000710	DNA-directed RNA polymerase subunit beta'; Provisional; Region: PRK00566
261594000711	RNA polymerase Rpb1, domain 1; Region: RNA_pol_Rpb1_1; pfam04997
261594000712	RNA polymerase I subunit A N-terminus; Region: RPOLA_N; smart00663
261594000713	RNA polymerase Rpb1, domain 3; Region: RNA_pol_Rpb1_3; pfam04983
261594000714	RNA polymerase Rpb1, domain 4; Region: RNA_pol_Rpb1_4; pfam05000
261594000715	Largest subunit (beta') of Bacterial DNA-dependent RNA polymerase (RNAP), C-terminal domain; Region: RNAP_beta'_C; cd02655
261594000716	Rpb1 (beta') - Rpb6 (omega) interaction site [polypeptide binding]; other site
261594000717	Rpb1 (beta') - Rpb2 (beta) interaction site [polypeptide binding]; other site
261594000718	G-loop; other site
261594000719	DNA binding site [nucleotide binding]
261594000720	hypothetical protein; Provisional; Region: PRK06683
261594000721	S12-like family, 30S ribosomal protein S12 subfamily; S12 is located at the interface of the large and small ribosomal subunits of prokaryotes, chloroplasts and mitochondria, where it plays an important role in both tRNA and ribosomal subunit...; Region: Ribosomal_S12; cd03368
261594000722	S17 interaction site [polypeptide binding]; other site
261594000723	S8 interaction site; other site
261594000724	16S rRNA interaction site [nucleotide binding]; other site
261594000725	streptomycin interaction site [chemical binding]; other site
261594000726	23S rRNA interaction site [nucleotide binding]; other site
261594000727	aminoacyl-tRNA interaction site (A-site) [nucleotide binding]; other site
261594000728	30S ribosomal protein S7; Validated; Region: PRK05302
261594000729	elongation factor G; Reviewed; Region: PRK00007
261594000730	Elongation factor G (EF-G) family involved in both the elongation and ribosome recycling phases of protein synthesis; Region: EF-G; cd01886
261594000731	G1 box; other site
261594000732	putative GEF interaction site [polypeptide binding]; other site
261594000733	GTP/Mg2+ binding site [chemical binding]; other site
261594000734	Switch I region; other site
261594000735	G2 box; other site
261594000736	G3 box; other site
261594000737	Switch II region; other site
261594000738	G4 box; other site
261594000739	G5 box; other site
261594000740	EFG_mtEFG_II: this subfamily represents the domain II of elongation factor G (EF-G) in bacteria and, the C-terminus of mitochondrial Elongation factor G1 (mtEFG1) and G2 (mtEFG2)_like proteins found in eukaryotes. During the process of peptide synthesis...; Region: EFG_mtEFG_II; cd04088
261594000741	EFG_mtEFG1_IV: domains similar to domain IV of the bacterial translational elongation factor (EF) EF-G. Included in this group is a domain of mitochondrial Elongation factor G1 (mtEFG1) proteins homologous to domain IV of EF-G. Eukaryotic cells harbor 2...; Region: EFG_mtEFG1_IV; cd01434
261594000742	EFG_mtEFG_C: domains similar to the C-terminal domain of the bacterial translational elongation factor (EF) EF-G.  Included in this group is the C-terminus of mitochondrial Elongation factor G1 (mtEFG1) and G2 (mtEFG2) proteins. Eukaryotic cells harbor 2...; Region: EFG_mtEFG_C; cd03713
261594000743	elongation factor Tu; Reviewed; Region: PRK00049
261594000744	Elongation Factor Tu (EF-Tu) GTP-binding proteins; Region: EF_Tu; cd01884
261594000745	G1 box; other site
261594000746	GEF interaction site [polypeptide binding]; other site
261594000747	GTP/Mg2+ binding site [chemical binding]; other site
261594000748	Switch I region; other site
261594000749	G2 box; other site
261594000750	G3 box; other site
261594000751	Switch II region; other site
261594000752	G4 box; other site
261594000753	G5 box; other site
261594000754	EFTU_II: Elongation factor Tu domain II. Elongation factors Tu (EF-Tu) are three-domain GTPases with an essential function in the elongation phase of mRNA translation. The GTPase center of EF-Tu is in the N-terminal domain (domain I), also known as the...; Region: EFTU_II; cd03697
261594000755	Domain III of elongation factor (EF) Tu. Ef-Tu consists of three structural domains, designated I, II and III. Domain III adopts a beta barrel structure. Domain III is involved in binding to both charged tRNA and binding to elongation factor Ts (EF-Ts); Region: EFTU_III; cd03707
261594000756	Antibiotic Binding Site [chemical binding]; other site
261594000757	30S ribosomal protein S10; Reviewed; Region: rpsJ; PRK00596
261594000758	50S ribosomal protein L3; Validated; Region: rplC; PRK00001
261594000759	50S ribosomal protein L4; Provisional; Region: rplD; PRK05319
261594000760	50S ribosomal protein L23; Reviewed; Region: rplW; PRK05738
261594000761	50S ribosomal protein L2; Validated; Region: rplB; PRK09374
261594000762	Ribosomal Proteins L2, RNA binding domain; Region: Ribosomal_L2; pfam00181
261594000763	Ribosomal Proteins L2, C-terminal domain; Region: Ribosomal_L2_C; pfam03947
261594000764	30S ribosomal protein S19; Reviewed; Region: rpsS; PRK00357
261594000765	Ribosomal protein L22/L17e.  L22 (L17 in eukaryotes) is a core protein of the large ribosomal subunit.  It is the only ribosomal protein that interacts with all six domains of 23S rRNA, and is one of the proteins important for directing the proper...; Region: Ribosomal_L22; cd00336
261594000766	putative translocon binding site; other site
261594000767	protein-rRNA interface [nucleotide binding]; other site
261594000768	30S ribosomal protein S3; Reviewed; Region: rpsC; PRK00310
261594000769	K homology RNA-binding (KH) domain of the prokaryotic 30S small ribosomal subunit protein S3. S3  is part of the head region of the 30S ribosomal subunit and is believed to interact with mRNA as it threads its way from the latch into the channel.  The KH...; Region: 30S_S3_KH; cd02412
261594000770	G-X-X-G motif; other site
261594000771	Ribosomal protein S3, C-terminal domain; Region: Ribosomal_S3_C; pfam00189
261594000772	Ribosomal_L16_L10e: L16 is an essential protein in the large ribosomal subunit of bacteria, mitochondria, and chloroplasts. Large subunits that lack L16 are defective in peptidyl transferase activity, peptidyl-tRNA hydrolysis activity, association with...; Region: Ribosomal_L16_L10e; cd01433
261594000773	23S rRNA interface [nucleotide binding]; other site
261594000774	5S rRNA interface [nucleotide binding]; other site
261594000775	putative antibiotic binding site [chemical binding]; other site
261594000776	L25 interface [polypeptide binding]; other site
261594000777	L27 interface [polypeptide binding]; other site
261594000778	Ribosomal L29 protein/HIP.  L29 is a protein of the large ribosomal Subunit. A homolog, called heparin/heparan sulfate interacting protein (HIP), has also been identified in mammals.  L29 is located on the surface of the large ribosomal subunit, where it...; Region: Ribosomal_L29_HIP; cd00427
261594000779	23S rRNA interface [nucleotide binding]; other site
261594000780	putative translocon interaction site; other site
261594000781	signal recognition particle (SRP54) interaction site; other site
261594000782	L23 interface [polypeptide binding]; other site
261594000783	trigger factor interaction site; other site
261594000784	30S ribosomal protein S17; Reviewed; Region: rpsQ; PRK05610
261594000785	50S ribosomal protein L14; Validated; Region: rplN; PRK05483
261594000786	50S ribosomal protein L24; Reviewed; Region: rplX; PRK00004
261594000787	KOW motif of Ribosomal Protein L26; Region: KOW_RPL26; cd06089
261594000788	RNA binding site [nucleotide binding]; other site
261594000789	50S ribosomal protein L5; Validated; Region: rplE; PRK00010
261594000790	Ribosomal protein L5; Region: Ribosomal_L5; pfam00281
261594000791	ribosomal L5P family C-terminus; Region: Ribosomal_L5_C; pfam00673
261594000792	30S ribosomal protein S14; Reviewed; Region: rpsN; PRK08061
261594000793	30S ribosomal protein S8; Validated; Region: rpsH; PRK00136
261594000794	50S ribosomal protein L6; Validated; Region: rplF; PRK05498
261594000795	Ribosomal protein L6; Region: Ribosomal_L6; pfam00347
261594000796	Ribosomal protein L6; Region: Ribosomal_L6; pfam00347
261594000797	Ribosomal L18/L5e:  L18 (L5e) is a ribosomal protein found in the central protuberance (CP) of the large subunit. L18 binds 5S rRNA and induces a conformational change that stimulates the binding of L5 to 5S rRNA. Association of 5S rRNA with 23S rRNA...; Region: Ribosomal_L18_L5e; cd00432
261594000798	5S rRNA interface [nucleotide binding]; other site
261594000799	L27 interface [polypeptide binding]; other site
261594000800	23S rRNA interface [nucleotide binding]; other site
261594000801	L5 interface [polypeptide binding]; other site
261594000802	30S ribosomal protein S5; Validated; Region: rpsE; PRK00550
261594000803	Ribosomal protein S5, N-terminal domain; Region: Ribosomal_S5; pfam00333
261594000804	Ribosomal protein S5, C-terminal domain; Region: Ribosomal_S5_C; pfam03719
261594000805	Ribosomal protein L30, which is found in eukaryotes and prokaryotes but not in archaea, is one of the smallest ribosomal proteins with a molecular mass of about 7kDa. L30 binds the 23SrRNA as well as the 5S rRNA and is one of five ribosomal proteins that...; Region: Ribosomal_L30; cd01658
261594000806	23S rRNA binding site [nucleotide binding]; other site
261594000807	50S ribosomal protein L15; Reviewed; Region: rplO; PRK05592
261594000808	preprotein translocase subunit SecY; Reviewed; Region: secY; PRK12907
261594000809	SecY translocase; Region: SecY; pfam00344
261594000810	adenylate kinase; Reviewed; Region: adk; PRK00279
261594000811	Adenylate kinase (ADK) catalyzes the reversible phosphoryl transfer from adenosine triphosphates (ATP) to adenosine monophosphates (AMP) and to yield adenosine diphosphates (ADP). This enzyme is required for the biosynthesis of ADP and is essential for...; Region: ADK; cd01428
261594000812	AMP-binding site [chemical binding]; other site
261594000813	ATP-AMP (Ap5A)-binding site [chemical binding]; other site
261594000814	Methionine Aminopeptidase 1. E.C. 3.4.11.18. Also known as methionyl aminopeptidase and Peptidase M. Catalyzes release of N-terminal amino acids, preferentially methionine, from peptides and arylamides; Region: MetAP1; cd01086
261594000815	active site
261594000816	S1_IF1: Translation Initiation Factor IF1, S1-like RNA-binding domain. IF1 contains an S1-like RNA-binding domain, which is found in a wide variety of RNA-associated proteins. Translation initiation includes a number of interrelated steps preceding the...; Region: S1_IF1; cd04451
261594000817	rRNA binding site [nucleotide binding]; other site
261594000818	predicted 30S ribosome binding site; other site
261594000819	50S ribosomal protein L36; Reviewed; Region: rpmJ; PRK00465
261594000820	30S ribosomal protein S13; Validated; Region: rpsM; PRK05179
261594000821	30S ribosomal protein S13; Region: bact_S13; TIGR03631
261594000822	30S ribosomal protein S11; Validated; Region: PRK05309
261594000823	DNA-directed RNA polymerase subunit alpha; Provisional; Region: PRK05182
261594000824	N-terminal domain of the Alpha subunit of Bacterial RNA polymerase; Region: RNAP_alpha_NTD; cd06928
261594000825	alphaNTD - beta interaction site [polypeptide binding]; other site
261594000826	alphaNTD homodimer interface [polypeptide binding]; other site
261594000827	alphaNTD - beta' interaction site [polypeptide binding]; other site
261594000828	Bacterial RNA polymerase, alpha chain C terminal domain; Region: RNA_pol_A_CTD; pfam03118
261594000829	50S ribosomal protein L17; Validated; Region: rplQ; PRK05591
261594000830	cobalt transporter ATP-binding subunit; Provisional; Region: cbiO; PRK13635
261594000831	First domain of the ATP-binding cassette component of cobalt transport system; Region: ABC_cobalt_CbiO_domain1; cd03225
261594000832	Walker A/P-loop; other site
261594000833	ATP binding site [chemical binding]; other site
261594000834	Q-loop/lid; other site
261594000835	ABC transporter signature motif; other site
261594000836	Walker B; other site
261594000837	D-loop; other site
261594000838	H-loop/switch region; other site
261594000839	cobalt transporter ATP-binding subunit; Provisional; Region: cbiO; PRK13634
261594000840	First domain of the ATP-binding cassette component of cobalt transport system; Region: ABC_cobalt_CbiO_domain1; cd03225
261594000841	Walker A/P-loop; other site
261594000842	ATP binding site [chemical binding]; other site
261594000843	Q-loop/lid; other site
261594000844	ABC transporter signature motif; other site
261594000845	Walker B; other site
261594000846	D-loop; other site
261594000847	H-loop/switch region; other site
261594000848	ABC-type cobalt transport system, permease component CbiQ and related transporters [Inorganic ion transport and metabolism]; Region: CbiQ; COG0619
261594000849	tRNA pseudouridine synthase A; Validated; Region: truA; PRK00021
261594000850	Eukaryotic and bacterial pseudouridine synthases similar to E.  coli TruA; Region: PseudoU_synth_EcTruA; cd02570
261594000851	dimerization interface 3.5A [polypeptide binding]; other site
261594000852	active site
261594000853	Ribosomal protein L13.  Protein L13, a large ribosomal subunit protein, is one of five proteins required for an early folding intermediate of 23S rRNA in the assembly of the large subunit. L13 is situated on the bottom of the large subunit, near the...; Region: Ribosomal_L13; cd00392
261594000854	23S rRNA interface [nucleotide binding]; other site
261594000855	L3 interface [polypeptide binding]; other site
261594000856	30S ribosomal protein S9; Reviewed; Region: rpsI; PRK00132
261594000857	Protein of unknown function (DUF2521); Region: DUF2521; pfam10730
261594000858	N-acetylmuramoyl-L-alanine amidase [Cell envelope biogenesis, outer membrane]; Region: AmiC; COG0860
261594000859	N-acetylmuramoyl-L-alanine amidase or MurNAc-LAA (also known as peptidoglycan aminohydrolase, NAMLA amidase, NAMLAA, Amidase 3, and peptidoglycan amidase; EC 3.5.1.28) is an autolysin that hydrolyzes the amide bond between N-acetylmuramoyl and L-amino...; Region: MurNAc-LAA; cd02696
261594000860	active site
261594000861	metal binding site [ion binding]; metal-binding site
261594000862	Domain of unknown function DUF59; Region: DUF59; pfam01883
261594000863	MRP (Multiple Resistance and pH adaptation) is a homologue of the Fer4_NifH superfamily. Like the other members of the superfamily, MRP contains a ATP-binding domain at the N-termini. It is found in bacteria as a membrane-spanning protein and functions...; Region: MRP-like; cd02037
261594000864	ATPases involved in chromosome partitioning [Cell division and chromosome partitioning]; Region: Mrp; COG0489
261594000865	KinB-signalling pathway activation in sporulation; Region: KbaA; pfam14089
261594000866	Predicted xylanase/chitin deacetylase [Carbohydrate transport and metabolism]; Region: CDA1; COG0726
261594000867	Putative catalytic NodB homology domain of Bacillus subtilis putative polysaccharide deacetylase PdaB, and its bacterial homologs; Region: CE4_BsPdaB_like; cd10949
261594000868	NodB motif; other site
261594000869	putative active site [active]
261594000870	putative catalytic site [active]
261594000871	Arginase family; Region: Arginase; cd09989
261594000872	agmatinase; Region: agmatinase; TIGR01230
261594000873	active site
261594000874	Mn binding site [ion binding]; other site
261594000875	oligomer interface [polypeptide binding]; other site
261594000876	Uncharacterized conserved protein [Function unknown]; Region: COG1624
261594000877	DisA bacterial checkpoint controller nucleotide-binding; Region: DisA_N; pfam02457
261594000878	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4856
261594000879	YbbR-like protein; Region: YbbR; pfam07949
261594000880	YbbR-like protein; Region: YbbR; pfam07949
261594000881	YbbR-like protein; Region: YbbR; pfam07949
261594000882	phosphoglucosamine mutase; Provisional; Region: glmM; PRK14316
261594000883	GlmM is a bacterial phosphoglucosamine mutase (PNGM) that belongs to the alpha-D-phosphohexomutase superfamily. It is required for the interconversion of glucosamine-6-phosphate and glucosamine-1-phosphate in the biosynthetic pathway of...; Region: GlmM; cd05802
261594000884	active site
261594000885	substrate binding site [chemical binding]; other site
261594000886	metal binding site [ion binding]; metal-binding site
261594000887	glucosamine--fructose-6-phosphate aminotransferase; Reviewed; Region: PRK00331
261594000888	Glutamine amidotransferases class-II (Gn-AT)_GFAT-type. This domain is found at the N-terminus of glucosamine-6P synthase (GlmS, or GFAT in humans).  The glutaminase domain catalyzes amide nitrogen transfer from glutamine to the appropriate substrate. In...; Region: GFAT; cd00714
261594000889	glutaminase active site [active]
261594000890	SIS (Sugar ISomerase) domain repeat 1 found in Glucosamine 6-phosphate synthase (GlmS) and Glucosamine-6-phosphate deaminase (GlmD). The SIS domain is found in many phosphosugar isomerases and phosphosugar binding proteins. GlmS contains a N-terminal...; Region: SIS_GlmS_GlmD_1; cd05008
261594000891	dimer interface [polypeptide binding]; other site
261594000892	active site
261594000893	SIS (Sugar ISomerase) domain repeat 2 found in Glucosamine 6-phosphate synthase (GlmS) and Glucosamine-6-phosphate deaminase (GlmD). The SIS domain is found in many phosphosugar isomerases and phosphosugar binding proteins. GlmS contains a N-terminal...; Region: SIS_GlmS_GlmD_2; cd05009
261594000894	dimer interface [polypeptide binding]; other site
261594000895	active site
261594000896	Alpha/beta hydrolase family; Region: Abhydrolase_6; pfam12697
261594000897	Transcriptional regulators [Transcription]; Region: GntR; COG1802
261594000898	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
261594000899	DNA-binding site [nucleotide binding]; DNA binding site
261594000900	FCD domain; Region: FCD; pfam07729
261594000901	fructuronate transporter; Provisional; Region: PRK10034; cl15264
261594000902	gluconate transporter; Region: gntP; TIGR00791
261594000903	6-phosphogluconate dehydrogenase-like protein; Reviewed; Region: PRK09599
261594000904	6-phosphogluconate dehydrogenase; Validated; Region: PRK09287
261594000905	6-phosphogluconate dehydrogenase, C-terminal domain; Region: 6PGD; pfam00393
261594000906	Dipeptidyl aminopeptidases/acylaminoacyl-peptidases [Amino acid transport and metabolism]; Region: DAP2; COG1506
261594000907	Prolyl oligopeptidase family; Region: Peptidase_S9; pfam00326
261594000908	Protein of unknown function (DUF4256); Region: DUF4256; pfam14066
261594000909	DoxX; Region: DoxX; cl17842
261594000910	Sigma factor regulator N-terminal; Region: Sigma_reg_N; pfam13800
261594000911	Sigma factor regulator C-terminal; Region: Sigma_reg_C; pfam13791
261594000912	RNA polymerase sigma factor, SigM family; Region: SigM_subfam; TIGR02950
261594000913	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
261594000914	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
261594000915	DNA binding residues [nucleotide binding]
261594000916	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
261594000917	ABC-ATPase subunit interface; other site
261594000918	DL-methionine transporter ATP-binding subunit; Provisional; Region: metN; PRK11153
261594000919	ATP-binding cassette domain of methionine transporter; Region: ABC_MetN_methionine_transporter; cd03258
261594000920	Walker A/P-loop; other site
261594000921	ATP binding site [chemical binding]; other site
261594000922	Q-loop/lid; other site
261594000923	ABC transporter signature motif; other site
261594000924	Walker B; other site
261594000925	D-loop; other site
261594000926	H-loop/switch region; other site
261594000927	Oligopeptide/dipeptide transporter, C-terminal region; Region: oligo_HPY; cl07097
261594000928	NIL domain; Region: NIL; pfam09383
261594000929	ABC-type metal ion transport system, periplasmic component/surface antigen [Inorganic ion transport and metabolism]; Region: NlpA; COG1464
261594000930	NLPA lipoprotein; Region: Lipoprotein_9; pfam03180
261594000931	NADPH:quinone reductase and related Zn-dependent oxidoreductases [Energy production and conversion / General function prediction only]; Region: Qor; COG0604
261594000932	Medium chain dehydrogenases/reductase (MDR)/zinc-dependent alcohol dehydrogenase-like family; Region: MDR1; cd08267
261594000933	putative NAD(P) binding site [chemical binding]; other site
261594000934	FAD/FMN-containing dehydrogenases [Energy production and conversion]; Region: GlcD; COG0277
261594000935	FAD binding domain; Region: FAD_binding_4; pfam01565
261594000936	Major Facilitator Superfamily; Region: MFS_1; pfam07690
261594000937	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594000938	putative substrate translocation pore; other site
261594000939	Domain of unknown function (DUF3981); Region: DUF3981; pfam13139
261594000940	drug resistance transporter, Bcr/CflA subfamily; Region: efflux_Bcr_CflA; TIGR00710
261594000941	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594000942	putative substrate translocation pore; other site
261594000943	Protein of unknown function (DUF3887); Region: DUF3887; pfam13026
261594000944	Protein of unknown function (DUF3951); Region: DUF3951; pfam13131
261594000945	ABC-type dipeptide/oligopeptide/nickel transport systems, permease components [Amino acid transport and metabolism / Inorganic ion transport and metabolism]; Region: DppB; COG0601
261594000946	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
261594000947	dimer interface [polypeptide binding]; other site
261594000948	conserved gate region; other site
261594000949	putative PBP binding loops; other site
261594000950	ABC-ATPase subunit interface; other site
261594000951	ABC-type dipeptide/oligopeptide/nickel transport systems, permease components [Amino acid transport and metabolism / Inorganic ion transport and metabolism]; Region: DppC; COG1173
261594000952	N-terminal TM domain of oligopeptide transport permease C; Region: OppC_N; pfam12911
261594000953	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
261594000954	dimer interface [polypeptide binding]; other site
261594000955	conserved gate region; other site
261594000956	putative PBP binding loops; other site
261594000957	ABC-ATPase subunit interface; other site
261594000958	ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component [Amino acid transport and metabolism / Inorganic ion transport and metabolism]; Region: DppD; COG0444
261594000959	ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257
261594000960	Walker A/P-loop; other site
261594000961	ATP binding site [chemical binding]; other site
261594000962	Q-loop/lid; other site
261594000963	ABC transporter signature motif; other site
261594000964	Walker B; other site
261594000965	D-loop; other site
261594000966	H-loop/switch region; other site
261594000967	Oligopeptide/dipeptide transporter, C-terminal region; Region: oligo_HPY; cl07097
261594000968	ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component [Amino acid transport and metabolism / Inorganic ion transport and metabolism]; Region: DppF; COG1124
261594000969	ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257
261594000970	Walker A/P-loop; other site
261594000971	ATP binding site [chemical binding]; other site
261594000972	Q-loop/lid; other site
261594000973	ABC transporter signature motif; other site
261594000974	Walker B; other site
261594000975	D-loop; other site
261594000976	H-loop/switch region; other site
261594000977	Oligopeptide/dipeptide transporter, C-terminal region; Region: oligo_HPY; pfam08352
261594000978	ABC-type oligopeptide transport system, periplasmic component [Amino acid transport and metabolism]; Region: OppA; COG4166
261594000979	The substrate-binding component of an ABC-type oligopetide import system contains the type 2 periplasmic binding fold; Region: PBP2_OppA; cd08504
261594000980	peptide binding site [polypeptide binding]; other site
261594000981	YusW-like protein; Region: YusW; pfam14039
261594000982	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
261594000983	helix_turn_helix, arabinose operon control protein; Region: HTH_ARAC; smart00342
261594000984	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
261594000985	ABC-type oligopeptide transport system, periplasmic component [Amino acid transport and metabolism]; Region: OppA; COG4166
261594000986	The substrate-binding component of an ABC-type oligopetide import system contains the type 2 periplasmic binding fold; Region: PBP2_OppA; cd08504
261594000987	peptide binding site [polypeptide binding]; other site
261594000988	ABC-type oligopeptide transport system, periplasmic component [Amino acid transport and metabolism]; Region: OppA; COG4166
261594000989	The substrate-binding component of an ABC-type oligopetide import system contains the type 2 periplasmic binding fold; Region: PBP2_OppA; cd08504
261594000990	peptide binding site [polypeptide binding]; other site
261594000991	Aldo-keto reductases (AKRs) are a superfamily of soluble NAD(P)(H) oxidoreductases whose chief purpose is to reduce aldehydes and ketones to primary and secondary alcohols. AKRs are present in all phyla and are of importance to both health and industrial...; Region: Aldo_ket_red; cd06660
261594000992	Aldo/keto reductase family; Region: Aldo_ket_red; pfam00248
261594000993	active site
261594000994	catalytic tetrad [active]
261594000995	Nicotinamide mononucleotide transporter; Region: NMN_transporter; pfam04973
261594000996	Putative glucose uptake permease [Carbohydrate transport and metabolism]; Region: GlcU; COG4975
261594000997	ABC-type sulfate transport system, permease component [Posttranslational modification, protein turnover, chaperones]; Region: CysU; COG0555
261594000998	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
261594000999	dimer interface [polypeptide binding]; other site
261594001000	putative PBP binding loops; other site
261594001001	ABC-ATPase subunit interface; other site
261594001002	DNA binding domain, excisionase family; Region: excise; TIGR01764
261594001003	PBP superfamily domain; Region: PBP_like; pfam12727
261594001004	Protein of unknown function (DUF3948); Region: DUF3948; pfam13134
261594001005	Transcriptional regulator [Transcription]; Region: LysR; COG0583
261594001006	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
261594001007	The C-terminal substrate binding domain of LysR-type transcriptional regulators, YofA and SoxR, contains the type 2 periplasmic binding fold; Region: PBP2_YofA_SoxR_like; cd08442
261594001008	putative dimerization interface [polypeptide binding]; other site
261594001009	Permeases of the drug/metabolite transporter (DMT) superfamily [Carbohydrate transport and metabolism / Amino acid transport and metabolism / General function prediction only]; Region: RhaT; COG0697
261594001010	EamA-like transporter family; Region: EamA; pfam00892
261594001011	YrzO-like protein; Region: YrzO; pfam14142
261594001012	1-acyl-sn-glycerol-3-phosphate acyltransferase [Lipid metabolism]; Region: PlsC; COG0204
261594001013	Lysophospholipid Acyltransferases (LPLATs) of Glycerophospholipid Biosynthesis: AGPAT-like; Region: LPLAT_AGPAT-like; cd07989
261594001014	putative acyl-acceptor binding pocket; other site
261594001015	Transcriptional regulators [Transcription]; Region: PurR; COG1609
261594001016	Helix-turn-helix (HTH) DNA binding domain of the LacI family of transcriptional regulators; Region: HTH_LacI; cd01392
261594001017	DNA binding site [nucleotide binding]
261594001018	domain linker motif; other site
261594001019	Ligand-binding domain of a novel transcription factor implicated in catabolite repression in Bacillus and Clostridium species; Region: PBP1_CcpB_like; cd06286
261594001020	putative ligand binding site [chemical binding]; other site
261594001021	putative dimerization interface [polypeptide binding]; other site
261594001022	Uncharacterized conserved protein [Function unknown]; Region: COG1284
261594001023	Uncharacterized BCR, YitT family COG1284; Region: DUF161; pfam02588
261594001024	Uncharacterized BCR, YitT family COG1284; Region: DUF161; pfam02588
261594001025	Uncharacterized protein conserved in bacteria (DUF2179); Region: DUF2179; pfam10035
261594001026	Protein of unknown function (DUF1093); Region: DUF1093; pfam06486
261594001027	TatD like proteins;  E.coli TatD is a cytoplasmic protein, shown to have magnesium dependent DNase activity; Region: TatD_DNAse; cd01310
261594001028	Predicted metal-dependent hydrolases with the TIM-barrel fold [General function prediction only]; Region: COG1099
261594001029	active site
261594001030	Uncharacterized protein conserved in bacteria (DUF2334); Region: DUF2334; pfam10096
261594001031	Catalytic NodB homology domain of the carbohydrate esterase 4 superfamily; Region: CE4_SF; cl15692
261594001032	C-type lysozyme (1, 4-beta-N-acetylmuramidase, LYZ) and alpha-lactalbumin (lactose synthase B protein, LA). They have a close evolutionary relationship and similar tertiary structure, however, functionally they are quite different. Lysozymes have...; Region: LYZ1; cl17441
261594001033	lysozyme catalytic site [active]
261594001034	HIT family: HIT (Histidine triad) proteins, named for a motif related to the sequence HxHxH/Qxx (x, a hydrophobic amino acid), are a superfamily of nucleotide hydrolases and transferases, which act on the alpha-phosphate of ribonucleotides. On the basis...; Region: HIT_like; cl00228
261594001035	nucleotide binding site/active site [active]
261594001036	HIT family signature motif; other site
261594001037	catalytic residue [active]
261594001038	ATPase components of ABC transporters with duplicated ATPase domains [General function prediction only]; Region: Uup; COG0488
261594001039	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
261594001040	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
261594001041	ABC transporter; Region: ABC_tran_2; pfam12848
261594001042	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
261594001043	ABC-type dipeptide transport system, periplasmic component [Amino acid transport and metabolism]; Region: DdpA; COG0747
261594001044	The substrate-binding domain of an ABC-type nickel/oligopeptide-like import system contains the type 2 periplasmic binding fold; Region: PBP2_NikA_DppA_OppA_like; cd00995
261594001045	ABC-type dipeptide/oligopeptide/nickel transport systems, permease components [Amino acid transport and metabolism / Inorganic ion transport and metabolism]; Region: DppB; COG0601
261594001046	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
261594001047	dimer interface [polypeptide binding]; other site
261594001048	conserved gate region; other site
261594001049	putative PBP binding loops; other site
261594001050	ABC-ATPase subunit interface; other site
261594001051	ABC-type dipeptide/oligopeptide/nickel transport systems, permease components [Amino acid transport and metabolism / Inorganic ion transport and metabolism]; Region: DppC; COG1173
261594001052	N-terminal TM domain of oligopeptide transport permease C; Region: OppC_N; pfam12911
261594001053	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
261594001054	dimer interface [polypeptide binding]; other site
261594001055	conserved gate region; other site
261594001056	putative PBP binding loops; other site
261594001057	ABC-ATPase subunit interface; other site
261594001058	ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component [Amino acid transport and metabolism / Inorganic ion transport and metabolism]; Region: DppD; COG0444
261594001059	ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257
261594001060	Walker A/P-loop; other site
261594001061	ATP binding site [chemical binding]; other site
261594001062	Q-loop/lid; other site
261594001063	ABC transporter signature motif; other site
261594001064	Walker B; other site
261594001065	D-loop; other site
261594001066	H-loop/switch region; other site
261594001067	oligopeptide/dipeptide ABC transporter, ATP-binding protein, C-terminal domain; Region: oligo_HPY; TIGR01727
261594001068	ABC-type oligopeptide transport system, ATPase component [Amino acid transport and metabolism]; Region: AppF; COG4608
261594001069	ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257
261594001070	Walker A/P-loop; other site
261594001071	ATP binding site [chemical binding]; other site
261594001072	Q-loop/lid; other site
261594001073	ABC transporter signature motif; other site
261594001074	Walker B; other site
261594001075	D-loop; other site
261594001076	H-loop/switch region; other site
261594001077	oligopeptide/dipeptide ABC transporter, ATP-binding protein, C-terminal domain; Region: oligo_HPY; TIGR01727
261594001078	Protein of unknown function (DUF3948); Region: DUF3948; pfam13134
261594001079	Protein of unknown function (DUF3948); Region: DUF3948; pfam13134
261594001080	4-hydroxyphenylpyruvate dioxygenase; Region: 4HPPD; TIGR01263
261594001081	N-terminal domain of 4-hydroxyphenylpyruvate dioxygenase (HPPD) and hydroxymandelate Synthase (HmaS); Region: HPPD_N_like; cd08342
261594001082	dimer interface [polypeptide binding]; other site
261594001083	C-terminal domain of 4-hydroxyphenylpyruvate dioxygenase (HppD) and hydroxymandelate Synthase (HmaS); Region: HPPD_C_like; cd07250
261594001084	active site
261594001085	Fe binding site [ion binding]; other site
261594001086	2-keto-4-pentenoate hydratase/2-oxohepta-3-ene-1,7-dioic acid hydratase (catechol pathway) [Secondary metabolites biosynthesis, transport, and catabolism]; Region: MhpD; COG0179
261594001087	Fumarylacetoacetate (FAA) hydrolase family; Region: FAA_hydrolase; pfam01557
261594001088	homogentisate 1,2-dioxygenase; Region: HgmA; cl17306
261594001089	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594001090	Major Facilitator Superfamily; Region: MFS_1; pfam07690
261594001091	putative substrate translocation pore; other site
261594001092	UDP-N-acetylmuramyl pentapeptide synthase [Cell envelope biogenesis, outer membrane]; Region: MurF; COG0770
261594001093	Mur ligase family, catalytic domain; Region: Mur_ligase; pfam01225
261594001094	Mur ligase middle domain; Region: Mur_ligase_M; pfam08245
261594001095	Mur ligase family, glutamate ligase domain; Region: Mur_ligase_C; pfam02875
261594001096	helicase 45; Provisional; Region: PTZ00424
261594001097	DEAD-box helicases. A diverse family of proteins involved in ATP-dependent RNA unwinding, needed in a variety of cellular processes including splicing, ribosome biogenesis and RNA degradation. The name derives from the sequence of the Walker  B motif; Region: DEADc; cd00268
261594001098	ATP binding site [chemical binding]; other site
261594001099	Mg++ binding site [ion binding]; other site
261594001100	motif III; other site
261594001101	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
261594001102	nucleotide binding region [chemical binding]; other site
261594001103	ATP-binding site [chemical binding]; other site
261594001104	putative UV damage endonuclease; Provisional; Region: uvsE; PRK02308
261594001105	Rhomboid family; Region: Rhomboid; pfam01694
261594001106	4'-phosphopantetheinyl transferase; Provisional; Region: acpS; PRK00070
261594001107	Outer membrane lipoprotein-sorting protein [Cell envelope biogenesis, outer membrane]; Region: LolA; COG2834
261594001108	Domain of unknown function (DUF4367); Region: DUF4367; pfam14285
261594001109	Type III Pyridoxal 5-phosphate (PLP)-Dependent Enzyme Alanine Racemase; Region: PLPDE_III_AR; cd00430
261594001110	alanine racemase; Reviewed; Region: alr; PRK00053
261594001111	active site
261594001112	pyridoxal 5'-phosphate (PLP) binding site [chemical binding]; other site
261594001113	dimer interface [polypeptide binding]; other site
261594001114	substrate binding site [chemical binding]; other site
261594001115	catalytic residues [active]
261594001116	Predicted transcriptional regulators containing the CopG/Arc/MetJ DNA-binding domain and a metal-binding domain [Transcription]; Region: NikR; COG0864
261594001117	PemK-like protein; Region: PemK; pfam02452
261594001118	Transcriptional accessory protein [Transcription]; Region: Tex; COG2183
261594001119	Tex-like protein N-terminal domain; Region: Tex_N; pfam09371
261594001120	Likely ribonuclease with RNase H fold; Region: YqgFc; smart00732
261594001121	S1_Tex: The C-terminal S1 domain of a transcription accessory factor called Tex, which has been characterized in Bordetella pertussis and Pseudomonas aeruginosa. The tex gene is essential in Bortella pertusis and is named for its role in toxin expression; Region: S1_Tex; cd05685
261594001122	RNA binding site [nucleotide binding]; other site
261594001123	hypothetical protein; Provisional; Region: PRK04351
261594001124	SprT homologues; Region: SprT; cl01182
261594001125	Predicted ATPase or kinase [General function prediction only]; Region: COG0802
261594001126	Glycoprotease family; Region: Peptidase_M22; pfam00814
261594001127	tRNA threonylcarbamoyl adenosine modification protein YeaZ; Region: T6A_YeaZ; TIGR03725
261594001128	ribosomal-protein-alanine acetyltransferase; Region: rimI; TIGR01575
261594001129	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594001130	Coenzyme A binding pocket [chemical binding]; other site
261594001131	UGMP family protein; Validated; Region: PRK09604
261594001132	tRNA threonylcarbamoyl adenosine modification protein YeaZ; Region: T6A_YeaZ; TIGR03725
261594001133	Nucleotide-Binding Domain of the sugar kinase/HSP70/actin superfamily; Region: NBD_sugar-kinase_HSP70_actin; cl17037
261594001134	ATPase components of ABC transporters with duplicated ATPase domains [General function prediction only]; Region: Uup; COG0488
261594001135	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
261594001136	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
261594001137	ABC transporter; Region: ABC_tran_2; pfam12848
261594001138	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
261594001139	redox-sensing transcriptional repressor Rex; Provisional; Region: PRK05472
261594001140	Putative DNA-binding protein N-terminus; Region: Put_DNA-bind_N; pfam06971
261594001141	CoA binding domain; Region: CoA_binding; pfam02629
261594001142	Domain of unknown function (DUF4305); Region: DUF4305; pfam14146
261594001143	CAAX protease self-immunity; Region: Abi; pfam02517
261594001144	Chaperonin 10 Kd subunit (cpn10 or GroES); Cpn10 cooperates with chaperonin 60 (cpn60 or GroEL), an ATPase, to assist the folding and assembly of proteins and is found in eubacterial cytosol, as well as in the matrix of mitochondria and chloroplasts. It...; Region: cpn10; cd00320
261594001145	oligomerisation interface [polypeptide binding]; other site
261594001146	mobile loop; other site
261594001147	roof hairpin; other site
261594001148	chaperonin GroEL; Reviewed; Region: groEL; PRK12849
261594001149	GroEL_like type I chaperonin. Chaperonins are involved in productive folding of proteins. They share a common general morphology, a double toroid of 2 stacked rings, each composed of 7-9 subunits. The symmetry of type I is seven-fold and they are found...; Region: GroEL; cd03344
261594001150	ring oligomerisation interface [polypeptide binding]; other site
261594001151	ATP/Mg binding site [chemical binding]; other site
261594001152	stacking interactions; other site
261594001153	hinge regions; other site
261594001154	GMP synthase; Reviewed; Region: guaA; PRK00074
261594001155	Type 1 glutamine amidotransferase (GATase1) domain found in GMP synthetase; Region: GATase1_GMP_Synthase; cd01742
261594001156	AMP/PPi binding site [chemical binding]; other site
261594001157	candidate oxyanion hole; other site
261594001158	catalytic triad [active]
261594001159	potential glutamine specificity residues [chemical binding]; other site
261594001160	The C-terminal domain of GMP synthetase. It contains two subdomains; the ATP pyrophosphatase domain which closes to the N-termial and the dimerization domain at C-terminal end. The ATP-PPase is a twisted, five-stranded parallel beta-sheet sandwiched...; Region: GMP_synthase_C; cd01997
261594001161	ATP Binding subdomain [chemical binding]; other site
261594001162	Ligand Binding sites [chemical binding]; other site
261594001163	Dimerization subdomain; other site
261594001164	Xanthine/uracil/vitamin C permease [Nucleotide transport and    metabolism]; Region: COG2252
261594001165	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
261594001166	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594001167	active site
261594001168	phosphorylation site [posttranslational modification]
261594001169	intermolecular recognition site; other site
261594001170	dimerization interface [polypeptide binding]; other site
261594001171	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
261594001172	DNA binding site [nucleotide binding]
261594001173	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
261594001174	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
261594001175	dimerization interface [polypeptide binding]; other site
261594001176	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
261594001177	dimer interface [polypeptide binding]; other site
261594001178	phosphorylation site [posttranslational modification]
261594001179	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594001180	ATP binding site [chemical binding]; other site
261594001181	Mg2+ binding site [ion binding]; other site
261594001182	G-X-G motif; other site
261594001183	Glycosyl hydrolase family 99-like domain of WbsX-like glycosyltransferases; Region: Glyco_tran_WbsX; cd11579
261594001184	putative ligand binding site [chemical binding]; other site
261594001185	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594001186	S-adenosylmethionine binding site [chemical binding]; other site
261594001187	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594001188	S-adenosylmethionine binding site [chemical binding]; other site
261594001189	Sulfotransferase family; Region: Sulfotransfer_2; pfam03567
261594001190	Methyltransferase domain; Region: Methyltransf_23; pfam13489
261594001191	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594001192	S-adenosylmethionine binding site [chemical binding]; other site
261594001193	undecaprenyl pyrophosphate phosphatase; Reviewed; Region: PRK00281
261594001194	ABC-2 family transporter protein; Region: ABC2_membrane_4; pfam12730
261594001195	ABC-type multidrug transport system, ATPase component [Defense mechanisms]; Region: CcmA; COG1131
261594001196	ATP-binding cassette domain of the bacitracin-resistance transporter; Region: ABC_BcrA_bacitracin_resist; cd03268
261594001197	Walker A/P-loop; other site
261594001198	ATP binding site [chemical binding]; other site
261594001199	Q-loop/lid; other site
261594001200	ABC transporter signature motif; other site
261594001201	Walker B; other site
261594001202	D-loop; other site
261594001203	H-loop/switch region; other site
261594001204	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
261594001205	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
261594001206	dimer interface [polypeptide binding]; other site
261594001207	phosphorylation site [posttranslational modification]
261594001208	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594001209	ATP binding site [chemical binding]; other site
261594001210	Mg2+ binding site [ion binding]; other site
261594001211	G-X-G motif; other site
261594001212	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
261594001213	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594001214	active site
261594001215	phosphorylation site [posttranslational modification]
261594001216	intermolecular recognition site; other site
261594001217	dimerization interface [polypeptide binding]; other site
261594001218	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
261594001219	DNA binding site [nucleotide binding]
261594001220	Phosphoribosylcarboxyaminoimidazole (NCAIR) mutase [Nucleotide transport and metabolism]; Region: PurE; COG0041
261594001221	Formate/glycerate dehydrogenases, D-specific 2-hydroxy acid dehydrogenases and related dehydrogenases; Region: FDH_GDH_like; cl17240
261594001222	phosphoribosylaminoimidazole carboxylase ATPase subunit; Reviewed; Region: PRK06019
261594001223	NAD binding site [chemical binding]; other site
261594001224	ATP-grasp domain; Region: ATP-grasp; pfam02222
261594001225	adenylosuccinate lyase; Provisional; Region: PRK07492
261594001226	Adenylsuccinate lyase (ASL)_subgroup 1; Region: Adenylsuccinate_lyase_1; cd01360
261594001227	tetramer interface [polypeptide binding]; other site
261594001228	active site
261594001229	phosphoribosylaminoimidazole-succinocarboxamide synthase; Reviewed; Region: PRK09362
261594001230	bacterial and archaeal 5-aminoimidazole-4-(N-succinylcarboxamide) ribonucleotide (SAICAR) synthase; Region: SAICAR_synt_PurC; cd01415
261594001231	ATP binding site [chemical binding]; other site
261594001232	active site
261594001233	substrate binding site [chemical binding]; other site
261594001234	phosphoribosylformylglycinamidine synthase subunit PurS; Reviewed; Region: PRK05974
261594001235	phosphoribosylformylglycinamidine synthase I; Provisional; Region: PRK03619
261594001236	Type 1 glutamine amidotransferase (GATase1)-like domain found in Formylglycinamide ribonucleotide amidotransferase; Region: GATase1_FGAR_AT; cd01740
261594001237	putative active site [active]
261594001238	catalytic triad [active]
261594001239	phosphoribosylformylglycinamidine synthase II; Provisional; Region: PRK01213
261594001240	PurL subunit of the formylglycinamide ribonucleotide amidotransferase (FGAR-AT), first repeat. FGAR-AT catalyzes the ATP-dependent conversion of formylglycinamide ribonucleotide (FGAR) and glutamine to formylglycinamidine ribonucleotide (FGAM), ADP; Region: PurL_repeat1; cd02203
261594001241	dimerization interface [polypeptide binding]; other site
261594001242	ATP binding site [chemical binding]; other site
261594001243	PurL subunit of the formylglycinamide ribonucleotide amidotransferase (FGAR-AT), second repeat. FGAR-AT catalyzes the ATP-dependent conversion of formylglycinamide ribonucleotide (FGAR) and glutamine to formylglycinamidine ribonucleotide (FGAM), ADP; Region: PurL_repeat2; cd02204
261594001244	dimerization interface [polypeptide binding]; other site
261594001245	ATP binding site [chemical binding]; other site
261594001246	amidophosphoribosyltransferase; Provisional; Region: PRK06781
261594001247	Glutamine amidotransferases class-II (GN-AT)_GPAT- type. This domain is found at the N-terminus of  glutamine phosphoribosylpyrophosphate (Prpp) amidotransferase (GPATase) . The glutaminase domain catalyzes amide nitrogen transfer from glutamine to the...; Region: GPATase_N; cd00715
261594001248	active site
261594001249	tetramer interface [polypeptide binding]; other site
261594001250	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
261594001251	active site
261594001252	phosphoribosylaminoimidazole synthetase; Provisional; Region: PRK05385
261594001253	PurM (Aminoimidazole Ribonucleotide [AIR] synthetase), one of eleven enzymes required for purine biosynthesis, catalyzes the conversion of formylglycinamide ribonucleotide (FGAM) and ATP to AIR, ADP, and Pi, the fifth step in de novo purine biosynthesis; Region: PurM; cd02196
261594001254	dimerization interface [polypeptide binding]; other site
261594001255	putative ATP binding site [chemical binding]; other site
261594001256	phosphoribosylglycinamide formyltransferase; Reviewed; Region: purN; PRK05647
261594001257	Phosphoribosylglycinamide formyltransferase (GAR transformylase, GART); Region: FMT_core_GART; cd08645
261594001258	active site
261594001259	substrate binding site [chemical binding]; other site
261594001260	cosubstrate binding site; other site
261594001261	catalytic site [active]
261594001262	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase; Provisional; Region: purH; PRK00881
261594001263	Inosine monophosphate cyclohydrolase domain. This is the N-terminal domain in the purine biosynthesis pathway protein ATIC (purH). The bifunctional ATIC protein contains a C-terminal  ATIC formylase domain that formylates...; Region: IMPCH; cd01421
261594001264	purine monophosphate binding site [chemical binding]; other site
261594001265	dimer interface [polypeptide binding]; other site
261594001266	putative catalytic residues [active]
261594001267	AICARFT/IMPCHase bienzyme; Region: AICARFT_IMPCHas; smart00798
261594001268	AICARFT/IMPCHase bienzyme; Region: AICARFT_IMPCHas; cl03362
261594001269	phosphoribosylamine--glycine ligase; Provisional; Region: PRK00885
261594001270	Phosphoribosylglycinamide synthetase, N domain; Region: GARS_N; pfam02844
261594001271	Phosphoribosylglycinamide synthetase, ATP-grasp (A) domain; Region: GARS_A; pfam01071
261594001272	Phosphoribosylglycinamide synthetase, C domain; Region: GARS_C; pfam02843
261594001273	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4877
261594001274	A subgroup of the band 7 domain of flotillin (reggie) like proteins. This subgroup contains proteins similar to stomatin, prohibitin, flotillin, HlfK/C and podicin.  Many of these band 7 domain-containing proteins are lipid raft-associated.  Individual...; Region: Band_7_2; cd03402
261594001275	Membrane protease subunits, stomatin/prohibitin homologs [Posttranslational modification, protein turnover, chaperones]; Region: HflC; COG0330
261594001276	Protein of unknown function (DUF2892); Region: DUF2892; pfam11127
261594001277	PcrB family; Region: PcrB; pfam01884
261594001278	PcrB_like proteins. One member of this family, a protein from Archaeoglobus fulgidus, has been characterized as a (S)-3-O-geranylgeranylglyceryl phosphate synthase (AfGGGPS). AfGGGPS catalyzes the formation of an ether linkage between...; Region: PcrB_like; cd02812
261594001279	substrate binding site [chemical binding]; other site
261594001280	putative active site [active]
261594001281	dimer interface [polypeptide binding]; other site
261594001282	ATP-dependent DNA helicase PcrA; Region: pcrA; TIGR01073
261594001283	Part of AAA domain; Region: AAA_19; pfam13245
261594001284	Family description; Region: UvrD_C_2; pfam13538
261594001285	NAD-dependent DNA ligase LigA; Validated; Region: ligA; PRK07956
261594001286	NAD+ dependent DNA ligase adenylation domain. DNA ligases catalyze the crucial step of joining the breaks in duplex DNA during DNA replication, repair and recombination, utilizing either ATP or NAD(+) as a cofactor, but using the same basic reaction...; Region: LIGANc; cd00114
261594001287	nucleotide binding pocket [chemical binding]; other site
261594001288	K-X-D-G motif; other site
261594001289	catalytic site [active]
261594001290	NAD-dependent DNA ligase OB-fold domain; Region: DNA_ligase_OB; pfam03120
261594001291	endonuclease III; includes endonuclease III (DNA-(apurinic or apyrimidinic site) lyase), alkylbase DNA glycosidases (Alka-family) and other DNA glycosidases; Region: ENDO3c; cl14786
261594001292	Breast Cancer Suppressor Protein (BRCA1), carboxy-terminal domain. The BRCT domain is found within many DNA damage repair and cell cycle checkpoint proteins. The unique diversity of this domain superfamily allows BRCT modules to interact forming homo...; Region: BRCT; cd00027
261594001293	Dimer interface [polypeptide binding]; other site
261594001294	N-terminal repeat domain of CamS sex pheromone cAM373 precursor; Region: CamS_repeat_1; cd13441
261594001295	putative dimer interface [polypeptide binding]; other site
261594001296	CamS sex pheromone cAM373 precursor; Region: CamS; pfam07537
261594001297	C-terminal repeat domain of CamS sex pheromone cAM373 precursor; Region: CamS_repeat_2; cd13440
261594001298	putative dimer interface [polypeptide binding]; other site
261594001299	hypothetical protein; Provisional; Region: PRK10621
261594001300	Sulfite exporter TauE/SafE; Region: TauE; pfam01925
261594001301	1-pyrroline-5-carboxylate dehydrogenase; Provisional; Region: PRK03137
261594001302	Delta(1)-pyrroline-5-carboxylate dehydrogenase, RocA; Region: ALDH_PutA-P5CDH-RocA; cd07124
261594001303	Glutamate binding site [chemical binding]; other site
261594001304	homodimer interface [polypeptide binding]; other site
261594001305	NAD binding site [chemical binding]; other site
261594001306	catalytic residues [active]
261594001307	Isochorismatase family; Region: Isochorismatase; pfam00857
261594001308	Nicotinamidase_ related amidohydrolases.  Cysteine hydrolases of unknown function that share the catalytic triad with other amidohydrolases, like nicotinamidase, which converts nicotinamide to nicotinic acid and ammonia; Region: nicotinamidase_related; cd01014
261594001309	catalytic triad [active]
261594001310	conserved cis-peptide bond; other site
261594001311	DL-methionine transporter ATP-binding subunit; Provisional; Region: metN; PRK11153
261594001312	ATP-binding cassette domain of methionine transporter; Region: ABC_MetN_methionine_transporter; cd03258
261594001313	Walker A/P-loop; other site
261594001314	ATP binding site [chemical binding]; other site
261594001315	Q-loop/lid; other site
261594001316	ABC transporter signature motif; other site
261594001317	Walker B; other site
261594001318	D-loop; other site
261594001319	H-loop/switch region; other site
261594001320	NIL domain; Region: NIL; pfam09383
261594001321	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
261594001322	dimer interface [polypeptide binding]; other site
261594001323	conserved gate region; other site
261594001324	ABC-ATPase subunit interface; other site
261594001325	ABC-type metal ion transport system, periplasmic component/surface antigen [Inorganic ion transport and metabolism]; Region: NlpA; COG1464
261594001326	NLPA lipoprotein; Region: Lipoprotein_9; pfam03180
261594001327	Protein of unknown function with HXXEE motif; Region: HXXEE; pfam13787
261594001328	Protein of unknown function (DUF3926); Region: DUF3926; pfam13080
261594001329	helix_turn_helix multiple antibiotic resistance protein; Region: HTH_MARR; smart00347
261594001330	MarR family; Region: MarR; pfam01047
261594001331	MarR family; Region: MarR_2; cl17246
261594001332	aspartyl/glutamyl-tRNA amidotransferase subunit C; Reviewed; Region: gatC; PRK00034
261594001333	Asp-tRNAAsn/Glu-tRNAGln amidotransferase A subunit and related amidases [Translation, ribosomal structure and biogenesis]; Region: GatA; COG0154
261594001334	aspartyl/glutamyl-tRNA amidotransferase subunit A; Reviewed; Region: gatA; PRK00012
261594001335	aspartyl/glutamyl-tRNA amidotransferase subunit B; Validated; Region: gatB; PRK05477
261594001336	GatB/GatE catalytic domain; Region: GatB_N; pfam02934
261594001337	GatB domain; Region: GatB_Yqey; pfam02637
261594001338	putative lipid kinase; Reviewed; Region: PRK13337
261594001339	Diacylglycerol kinase catalytic domain; Region: DAGK_cat; pfam00781
261594001340	Predicted phosphatases [General function prediction only]; Region: Gph; COG0546
261594001341	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
261594001342	motif II; other site
261594001343	4-aminobutyrate aminotransferase; Reviewed; Region: PRK06918
261594001344	Acetyl ornithine aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to ornithine aminotransferase, acetylornithine aminotransferase; Region: OAT_like; cd00610
261594001345	inhibitor-cofactor binding pocket; inhibition site
261594001346	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594001347	catalytic residue [active]
261594001348	PAS domain; Region: PAS_9; pfam13426
261594001349	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
261594001350	putative active site [active]
261594001351	heme pocket [chemical binding]; other site
261594001352	Response regulator containing CheY-like receiver, AAA-type ATPase, and DNA-binding domains [Signal transduction mechanisms]; Region: AtoC; COG2204
261594001353	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
261594001354	Walker A motif; other site
261594001355	ATP binding site [chemical binding]; other site
261594001356	Walker B motif; other site
261594001357	arginine finger; other site
261594001358	succinic semialdehyde dehydrogenase; Region: PLN02278
261594001359	Mitochondrial succinate-semialdehyde dehydrogenase and ALDH family members 5A1 and 5F1-like; Region: ALDH_F5_SSADH_GabD; cd07103
261594001360	tetramerization interface [polypeptide binding]; other site
261594001361	NAD(P) binding site [chemical binding]; other site
261594001362	catalytic residues [active]
261594001363	Membrane transporters of cations and cationic drugs [Inorganic ion transport and metabolism]; Region: EmrE; COG2076
261594001364	Thermophilic metalloprotease (M29); Region: Peptidase_M29; pfam02073
261594001365	Leucyl aminopeptidase (aminopeptidase T) [Amino acid transport and metabolism]; Region: AmpS; COG2309
261594001366	Predicted xylanase/chitin deacetylase [Carbohydrate transport and metabolism]; Region: CDA1; COG0726
261594001367	Putative catalytic NodB homology domain of PgaB, IcaB, and similar proteins which consist of a deformed (beta/alpha)8 barrel fold with 5- or 6-strands; Region: CE4_NodB_like_5s_6s; cd10918
261594001368	putative active site [active]
261594001369	putative metal binding site [ion binding]; other site
261594001370	Predicted xylanase/chitin deacetylase [Carbohydrate transport and metabolism]; Region: CDA1; COG0726
261594001371	Putative catalytic NodB homology domain of PgaB, IcaB, and similar proteins which consist of a deformed (beta/alpha)8 barrel fold with 5- or 6-strands; Region: CE4_NodB_like_5s_6s; cd10918
261594001372	putative active site [active]
261594001373	putative metal binding site [ion binding]; other site
261594001374	Nucleoside permease [Nucleotide transport and metabolism]; Region: NupC; COG1972
261594001375	Na+ dependent nucleoside transporter N-terminus; Region: Nucleos_tra2_N; pfam01773
261594001376	Na+ dependent nucleoside transporter C-terminus; Region: Nucleos_tra2_C; pfam07662
261594001377	Predicted RNA-binding protein, contains TRAM domain [General function prediction only]; Region: COG3269
261594001378	23S rRNA (uracil-5-)-methyltransferase RumA; Region: rumA; TIGR00479
261594001379	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594001380	S-adenosylmethionine binding site [chemical binding]; other site
261594001381	tRNA-dihydrouridine synthase [Translation, ribosomal structure and biogenesis]; Region: COG0042
261594001382	Dihydrouridine synthase-like (DUS-like) FMN-binding domain. Members of this family catalyze the reduction of the 5,6-double bond of a uridine residue on tRNA. Dihydrouridine modification of tRNA is widely observed in prokaryotes and eukaryotes, and also...; Region: DUS_like_FMN; cd02801
261594001383	FMN binding site [chemical binding]; other site
261594001384	active site
261594001385	catalytic residues [active]
261594001386	substrate binding site [chemical binding]; other site
261594001387	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4807
261594001388	Protein of unknown function (DUF1456); Region: DUF1456; pfam07308
261594001389	Protein of unknown function (DUF1456); Region: DUF1456; pfam07308
261594001390	Protein of unknown function DUF45; Region: DUF45; pfam01863
261594001391	L-alanine-DL-glutamate epimerase and related enzymes of enolase superfamily [Cell envelope biogenesis, outer membrane / General function prediction only]; Region: COG4948
261594001392	L-Ala-D/L-Glu epimerase catalyzes the epimerization of L-Ala-D/L-Glu and other dipeptides. The genomic context and the substrate specificity of characterized members of this family from E.coli and B.subtilis indicates a possible role in the metabolism of...; Region: L-Ala-DL-Glu_epimerase; cd03319
261594001393	active site
261594001394	Na+/H+ antiporter NhaC; Region: antiport_nhaC; TIGR00931
261594001395	Metal-dependent amidase/aminoacylase/carboxypeptidase [General function prediction only]; Region: AbgB; COG1473
261594001396	M20 Peptidase Aminoacylase 1 amhX_like subfamily; Region: M20_Acy1_amhX_like; cd08018
261594001397	metal binding site [ion binding]; metal-binding site
261594001398	putative dimer interface [polypeptide binding]; other site
261594001399	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594001400	S-adenosylmethionine binding site [chemical binding]; other site
261594001401	alkyl hydroperoxide reductase subunit F; Provisional; Region: PRK15317
261594001402	Alkyl hydroperoxide reductase F subunit (AhpF) N-terminal domain (NTD) family, N-terminal TRX-fold subdomain; AhpF is a homodimeric flavoenzyme which catalyzes the NADH-dependent reduction of the peroxiredoxin AhpC, which in turn catalyzes the reduction...; Region: AhpF_NTD_N; cd02974
261594001403	catalytic residue [active]
261594001404	TRX-GRX-like family, Alkyl hydroperoxide reductase F subunit (AhpF) N-terminal domain (NTD) subfamily, C-terminal TRX-fold subdomain; AhpF is a homodimeric flavoenzyme which catalyzes the NADH-dependent reduction of the peroxiredoxin AhpC, which then...; Region: AhpF_NTD_C; cd03026
261594001405	catalytic residues [active]
261594001406	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
261594001407	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
261594001408	peroxiredoxin; Region: AhpC; TIGR03137
261594001409	Peroxiredoxin (PRX) family, Typical 2-Cys PRX subfamily; PRXs are thiol-specific antioxidant (TSA) proteins, which confer a protective role in cells through its peroxidase activity by reducing hydrogen peroxide, peroxynitrite, and organic hydroperoxides; Region: PRX_Typ2cys; cd03015
261594001410	dimer interface [polypeptide binding]; other site
261594001411	decamer (pentamer of dimers) interface [polypeptide binding]; other site
261594001412	catalytic triad [active]
261594001413	peroxidatic and resolving cysteines [active]
261594001414	5-methylribose kinase; Reviewed; Region: PRK12396
261594001415	Phosphotransferase enzyme family; Region: APH; pfam01636
261594001416	methylthioribose-1-phosphate isomerase; Reviewed; Region: mtnA; PRK05720
261594001417	S-methyl-5-thioribose-1-phosphate isomerase; Region: salvage_mtnA; TIGR00512
261594001418	L-fuculose phosphate aldolase; Provisional; Region: PRK06833
261594001419	intersubunit interface [polypeptide binding]; other site
261594001420	active site
261594001421	Zn2+ binding site [ion binding]; other site
261594001422	iron-hydroxamate transporter permease subunit; Provisional; Region: PRK10577
261594001423	Transmembrane subunit (TM), of Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters involved in the uptake of siderophores, heme, vitamin B12, or the divalent cations Mg2+ and Zn2+. PBP-dependent ABC transporters consist of...; Region: TM_ABC_iron-siderophores_like; cd06550
261594001424	ABC-ATPase subunit  interface; other site
261594001425	dimer interface [polypeptide binding]; other site
261594001426	putative PBP binding regions; other site
261594001427	iron-hydroxamate transporter permease subunit; Provisional; Region: PRK10577
261594001428	Transmembrane subunit (TM), of Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters involved in the uptake of siderophores, heme, vitamin B12, or the divalent cations Mg2+ and Zn2+. PBP-dependent ABC transporters consist of...; Region: TM_ABC_iron-siderophores_like; cd06550
261594001429	ABC-ATPase subunit  interface; other site
261594001430	dimer interface [polypeptide binding]; other site
261594001431	putative PBP binding regions; other site
261594001432	ABC-type Fe3+-hydroxamate transport system, periplasmic component [Inorganic ion transport and metabolism]; Region: FepB; COG0614
261594001433	Periplasmic binding protein FeuA.  These proteins have predicted to function as initial receptors in ABC transport of metal ions in some eubacterial species.  They belong to the TroA superfamily of periplasmic metal binding proteins that share a distinct...; Region: FeuA; cd01138
261594001434	putative ligand binding residues [chemical binding]; other site
261594001435	Thioredoxin reductase [Posttranslational modification, protein turnover, chaperones]; Region: TrxB; COG0492
261594001436	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
261594001437	DNA binding domain, excisionase family; Region: excise; TIGR01764
261594001438	Sm and related proteins; Region: Sm_like; cl00259
261594001439	Sm1 motif; other site
261594001440	RNA binding site [nucleotide binding]; other site
261594001441	Saccharopine dehydrogenase; Region: Saccharop_dh; pfam03435
261594001442	Kynurenine formamidase [Amino acid transport and metabolism]; Region: COG1878
261594001443	hypothetical protein; Provisional; Region: PRK06851
261594001444	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cl17189
261594001445	Walker A motif; other site
261594001446	ATP binding site [chemical binding]; other site
261594001447	NTPase; Region: NTPase_1; cl17478
261594001448	Predicted nucleotidyltransferase; Region: Nuc-transf; pfam10127
261594001449	benzoate transport; Region: 2A0115; TIGR00895
261594001450	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594001451	putative substrate translocation pore; other site
261594001452	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594001453	putative aminophosphonate oxidoreductase; Region: Phn_aa_oxid; TIGR03329
261594001454	Glycine/D-amino acid oxidases (deaminating) [Amino acid transport and metabolism]; Region: DadA; COG0665
261594001455	Rieske Fe-S protein [Energy production and conversion]; Region: QcrA; COG0723
261594001456	YhfW family, C-terminal Rieske domain; YhfW is a protein of unknown function with an N-terminal DadA-like (glycine/D-amino acid dehydrogenase) domain and a C-terminal Rieske domain. The Rieske domain is a [2Fe-2S] cluster binding domain involved in...; Region: Rieske_YhfW_C; cd03477
261594001457	[2Fe-2S] cluster binding site [ion binding]; other site
261594001458	Fatty acid desaturase; Region: FA_desaturase; pfam00487
261594001459	The Delta6 Fatty Acid Desaturase (Delta6-FADS)-like CD includes the integral-membrane enzymes: delta-4, delta-5, delta-6, delta-8, delta-8-sphingolipid, and delta-11 desaturases found in vertebrates, higher plants, fungi, and bacteria. These desaturases...; Region: Delta6-FADS-like; cd03506
261594001460	putative di-iron ligands [ion binding]; other site
261594001461	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
261594001462	dimer interface [polypeptide binding]; other site
261594001463	conserved gate region; other site
261594001464	putative PBP binding loops; other site
261594001465	ABC-ATPase subunit interface; other site
261594001466	Bacterial extracellular solute-binding proteins, family 3; Region: SBP_bac_3; pfam00497
261594001467	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
261594001468	substrate binding pocket [chemical binding]; other site
261594001469	membrane-bound complex binding site; other site
261594001470	hinge residues; other site
261594001471	ABC-type polar amino acid transport system, ATPase component [Amino acid transport and metabolism]; Region: GlnQ; COG1126
261594001472	ATP-binding cassette domain of the histidine and glutamine transporters; Region: ABC_HisP_GlnQ; cd03262
261594001473	Walker A/P-loop; other site
261594001474	ATP binding site [chemical binding]; other site
261594001475	Q-loop/lid; other site
261594001476	ABC transporter signature motif; other site
261594001477	Walker B; other site
261594001478	D-loop; other site
261594001479	H-loop/switch region; other site
261594001480	Four helix bundle sensory module for signal transduction; Region: 4HB_MCP_1; pfam12729
261594001481	Methyl-accepting chemotaxis protein [Cell motility and secretion / Signal transduction mechanisms]; Region: Tar; COG0840
261594001482	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
261594001483	dimerization interface [polypeptide binding]; other site
261594001484	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
261594001485	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
261594001486	dimer interface [polypeptide binding]; other site
261594001487	putative CheW interface [polypeptide binding]; other site
261594001488	Methyl-accepting chemotaxis protein [Cell motility and secretion / Signal transduction mechanisms]; Region: Tar; COG0840
261594001489	HAMP domain; Region: HAMP; pfam00672
261594001490	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
261594001491	dimer interface [polypeptide binding]; other site
261594001492	putative CheW interface [polypeptide binding]; other site
261594001493	alpha,alpha-phosphotrehalase; Region: trehalose_treC; TIGR02403
261594001494	Alpha amylase catalytic domain found in Sucrose isomerases, oligo-1,6-glucosidase (also called isomaltase; sucrase-isomaltase; alpha-limit dextrinase), dextran glucosidase (also called glucan 1,6-alpha-glucosidase), and related proteins; Region: AmyAc_SI_OligoGlu_DGase; cd11333
261594001495	Ca binding site [ion binding]; other site
261594001496	active site
261594001497	catalytic site [active]
261594001498	Phosphotransferase system IIC components, glucose/maltose/N-acetylglucosamine-specific [Carbohydrate transport and metabolism]; Region: PtsG; COG1263
261594001499	PTS system, IIBC component; Region: PTS-II-BC-unk1; TIGR02003
261594001500	PTS_IIB, PTS system, glucose/sucrose specific IIB subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This family...; Region: PTS_IIB_glc; cd00212
261594001501	active site turn [active]
261594001502	phosphorylation site [posttranslational modification]
261594001503	Streptococcus agalactiae RgfB, part of a putative two component signal transduction system, and related proteins; Region: RgfB-like; cd09079
261594001504	putative catalytic site [active]
261594001505	putative metal binding site [ion binding]; other site
261594001506	putative phosphate binding site [ion binding]; other site
261594001507	Predicted membrane protein [Function unknown]; Region: COG1511
261594001508	YhgE/Pip N-terminal domain; Region: pip_yhgE_Nterm; TIGR03061
261594001509	Predicted membrane protein [Function unknown]; Region: COG1511
261594001510	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594001511	DNA topoisomerase III; Provisional; Region: PRK07726
261594001512	TOPRIM_TopoIA_TopoIII: The topoisomerase-primase (TORPIM) domain found in members of the type IA family of DNA topoisomerases (Topo IA) similar to topoisomerase III. Type IA DNA topoisomerases remove (relax) negative supercoils in the DNA by: cleaving...; Region: TOPRIM_TopoIA_TopoIII; cd03362
261594001513	active site
261594001514	putative interdomain interaction site [polypeptide binding]; other site
261594001515	putative metal-binding site [ion binding]; other site
261594001516	putative nucleotide binding site [chemical binding]; other site
261594001517	DNA Topoisomerase, subtype IA; DNA-binding, ATP-binding and catalytic domain of bacterial DNA topoisomerases I and III, and eukaryotic DNA topoisomerase III and eubacterial and archael reverse gyrases. Topoisomerases clevage single or double stranded DNA...; Region: TOP1Ac; cd00186
261594001518	domain I; other site
261594001519	DNA binding groove [nucleotide binding]
261594001520	phosphate binding site [ion binding]; other site
261594001521	domain II; other site
261594001522	domain III; other site
261594001523	nucleotide binding site [chemical binding]; other site
261594001524	catalytic site [active]
261594001525	domain IV; other site
261594001526	4-methyl-5-beta-hydroxyethylthiazole (Thz) kinase catalyzes the phosphorylation of the hydroxylgroup of Thz. A reaction that allows cells to recycle Thz into the thiamine biosynthesis pathway, as an alternative to its synthesis from cysteine, tyrosine...; Region: THZ_kinase; cd01170
261594001527	substrate binding site [chemical binding]; other site
261594001528	multimerization interface [polypeptide binding]; other site
261594001529	ATP binding site [chemical binding]; other site
261594001530	Thiamine monophosphate synthase (TMP synthase)/TenI. TMP synthase catalyzes an important step in the thiamine biosynthesis pathway, the substitution of the pyrophosphate of 2-methyl-4-amino-5- hydroxymethylpyrimidine pyrophosphate by 4-methyl-5-; Region: TMP_TenI; cd00564
261594001531	thiamine phosphate binding site [chemical binding]; other site
261594001532	active site
261594001533	pyrophosphate binding site [ion binding]; other site
261594001534	Anaerobic C4-dicarboxylate transporter [General function prediction only]; Region: DcuB; COG2704
261594001535	anaerobic C4-dicarboxylate transporter; Reviewed; Region: PRK09412
261594001536	HAMP domain; Region: HAMP; pfam00672
261594001537	dimerization interface [polypeptide binding]; other site
261594001538	Methyl-accepting chemotaxis-like domains (chemotaxis sensory transducer); Region: MA; smart00283
261594001539	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
261594001540	dimer interface [polypeptide binding]; other site
261594001541	putative CheW interface [polypeptide binding]; other site
261594001542	Domain of unknown function DUF77; Region: DUF77; pfam01910
261594001543	ABC-type nitrate/sulfonate/bicarbonate transport system, permease component [Inorganic ion transport and metabolism]; Region: TauC; COG0600
261594001544	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
261594001545	dimer interface [polypeptide binding]; other site
261594001546	conserved gate region; other site
261594001547	putative PBP binding loops; other site
261594001548	ABC-ATPase subunit interface; other site
261594001549	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cl17432
261594001550	NMT1/THI5 like; Region: NMT1; pfam09084
261594001551	ABC-type nitrate/sulfonate/bicarbonate transport system, ATPase component [Inorganic ion transport and metabolism]; Region: TauB; COG1116
261594001552	ATP-binding cassette domain of the nitrate and sulfonate transporters; Region: ABC_NrtD_SsuB_transporters; cd03293
261594001553	Walker A/P-loop; other site
261594001554	ATP binding site [chemical binding]; other site
261594001555	Q-loop/lid; other site
261594001556	ABC transporter signature motif; other site
261594001557	Walker B; other site
261594001558	D-loop; other site
261594001559	H-loop/switch region; other site
261594001560	ATPase components of ABC transporters with duplicated ATPase domains [General function prediction only]; Region: Uup; COG0488
261594001561	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
261594001562	Walker A/P-loop; other site
261594001563	ATP binding site [chemical binding]; other site
261594001564	Q-loop/lid; other site
261594001565	ABC transporter signature motif; other site
261594001566	Walker B; other site
261594001567	D-loop; other site
261594001568	H-loop/switch region; other site
261594001569	ABC transporter; Region: ABC_tran_2; pfam12848
261594001570	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
261594001571	Glyco_18 domain; Region: Glyco_18; smart00636
261594001572	The GH18 (glycosyl hydrolases, family 18) type II chitinases hydrolyze chitin, an abundant polymer of N-acetylglucosamine and have been identified in bacteria, fungi, insects, plants, viruses, and protozoan parasites. The structure of this domain is an...; Region: GH18_chitinase; cd06548
261594001573	active site
261594001574	Fibronectin type 3 domain; One of three types of internal repeats found in the plasma protein fibronectin. Its tenth fibronectin type III repeat contains an RGD cell recognition sequence in a flexible loop between 2 strands. Approximately 2% of all...; Region: FN3; cd00063
261594001575	Interdomain contacts; other site
261594001576	Cytokine receptor motif; other site
261594001577	CBD_II domain; Region: CBD_II; smart00637
261594001578	Domain of unknown function (DUF1992); Region: DUF1992; pfam09350
261594001579	TRX family; composed of two groups: Group I, which includes proteins that exclusively encode a TRX domain; and Group II, which are composed of fusion proteins of TRX and additional domains. Group I TRX is a small ancient protein that alter the redox...; Region: TRX_family; cd02947
261594001580	catalytic residues [active]
261594001581	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
261594001582	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
261594001583	QacR-like protein, C-terminal region; Region: TetR_C_5; pfam08360
261594001584	H+ Antiporter protein; Region: 2A0121; TIGR00900
261594001585	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594001586	putative substrate translocation pore; other site
261594001587	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
261594001588	non-specific DNA binding site [nucleotide binding]; other site
261594001589	salt bridge; other site
261594001590	sequence-specific DNA binding site [nucleotide binding]; other site
261594001591	Permeases of the major facilitator superfamily [General function prediction only]; Region: COG2270
261594001592	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594001593	putative substrate translocation pore; other site
261594001594	Type I phosphodiesterase / nucleotide pyrophosphatase; Region: Phosphodiest; pfam01663
261594001595	phosphonoacetate hydrolase; Region: hydr_PhnA; TIGR02335
261594001596	YesK-like protein; Region: YesK; pfam14150
261594001597	prolyl-tRNA synthetase; Provisional; Region: PRK08661
261594001598	Prolyl-tRNA synthetase (ProRS) class II core catalytic domain. ProRS is a homodimer. It is responsible for the attachment of proline to the 3' OH group of ribose of the appropriate tRNA. This domain is primarily responsible for ATP-dependent...; Region: ProRS_core_arch_euk; cd00778
261594001599	dimer interface [polypeptide binding]; other site
261594001600	motif 1; other site
261594001601	active site
261594001602	motif 2; other site
261594001603	motif 3; other site
261594001604	ProRS Prolyl-anticodon binding domain, long version found predominantly in eukaryotes and archaea. ProRS belongs to class II aminoacyl-tRNA synthetases (aaRS). This alignment contains the anticodon binding domain, which is responsible for specificity in...; Region: ProRS_anticodon_zinc; cd00862
261594001605	anticodon binding site; other site
261594001606	zinc-binding site [ion binding]; other site
261594001607	Transcriptional regulator/sugar kinase [Transcription / Carbohydrate transport and metabolism]; Region: NagC; COG1940
261594001608	Nucleotide-Binding Domain of the sugar kinase/HSP70/actin superfamily; Region: NBD_sugar-kinase_HSP70_actin; cd00012
261594001609	nucleotide binding site [chemical binding]; other site
261594001610	Uncharacterized proteins involved in stress response, homologs of TerZ and putative cAMP-binding protein CABP1 [Signal transduction mechanisms]; Region: TerZ; COG2310
261594001611	Uncharacterized proteins involved in stress response, similar to tellurium resistance terD; Region: TerD_like; cd06974
261594001612	putative metal binding site [ion binding]; other site
261594001613	Uncharacterized proteins involved in stress response, homologs of TerZ and putative cAMP-binding protein CABP1 [Signal transduction mechanisms]; Region: TerZ; COG2310
261594001614	Uncharacterized proteins involved in stress response, similar to tellurium resistance terD; Region: TerD_like; cd06974
261594001615	putative metal binding site [ion binding]; other site
261594001616	Uncharacterized proteins involved in stress response, homologs of TerZ and putative cAMP-binding protein CABP1 [Signal transduction mechanisms]; Region: TerZ; COG2310
261594001617	Uncharacterized proteins involved in stress response, similar to tellurium resistance terD; Region: TerD_like; cd06974
261594001618	putative metal binding site [ion binding]; other site
261594001619	integral membrane protein, YkoY family; Region: R_switched_YkoY; TIGR03716
261594001620	Domain of unknown function (DUF4356); Region: DUF4356; pfam14266
261594001621	Toxic anion resistance protein (TelA); Region: TelA; pfam05816
261594001622	Cation transporter/ATPase, N-terminus; Region: Cation_ATPase_N; smart00831
261594001623	Cation transport ATPase [Inorganic ion transport and metabolism]; Region: MgtA; COG0474
261594001624	E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122
261594001625	Putative hydrolase of sodium-potassium ATPase alpha subunit; Region: Hydrolase_like2; pfam13246
261594001626	haloacid dehalogenase-like hydrolase; Region: HAD; pfam12710
261594001627	Cation transporting ATPase, C-terminus; Region: Cation_ATPase_C; pfam00689
261594001628	Protein of unknown function (DUF1128); Region: DUF1128; pfam06569
261594001629	Protein-tyrosine-phosphatase [Signal transduction mechanisms]; Region: Wzb; COG0394
261594001630	Low molecular weight phosphatase family; Region: LMWPc; cd00115
261594001631	active site
261594001632	Domain of unknown function (DUF4075); Region: DUF4075; pfam13294
261594001633	Virulence factor BrkB; Region: Virul_fac_BrkB; pfam03631
261594001634	heavy metal translocating P-type ATPase; Region: ATPase-IB_hvy; TIGR01525
261594001635	E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122
261594001636	Soluble P-type ATPase [General function prediction only]; Region: COG4087
261594001637	Permeases of the drug/metabolite transporter (DMT) superfamily [Carbohydrate transport and metabolism / Amino acid transport and metabolism / General function prediction only]; Region: RhaT; COG0697
261594001638	EamA-like transporter family; Region: EamA; pfam00892
261594001639	EamA-like transporter family; Region: EamA; pfam00892
261594001640	YhhN-like protein; Region: YhhN; pfam07947
261594001641	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cd00189
261594001642	binding surface
261594001643	Tetratricopeptide repeat; Region: TPR_16; pfam13432
261594001644	TPR motif; other site
261594001645	Uncharacterized membrane-associated protein [Function unknown]; Region: DedA; COG0586
261594001646	SNARE associated Golgi protein; Region: SNARE_assoc; pfam09335
261594001647	Predicted membrane protein [Function unknown]; Region: COG2510
261594001648	Uncharacterized stress protein (general stress protein 26) [General function prediction only]; Region: COG3871
261594001649	Pyridoxamine 5'-phosphate oxidase; Region: Pyridox_oxidase; pfam01243
261594001650	calcium/proton exchanger (cax); Region: cax; TIGR00378
261594001651	Sodium/calcium exchanger protein; Region: Na_Ca_ex; pfam01699
261594001652	YfkD-like protein; Region: YfkD; pfam14167
261594001653	Radical SAM superfamily; Region: Radical_SAM; pfam04055
261594001654	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
261594001655	FeS/SAM binding site; other site
261594001656	YfkB-like domain; Region: YfkB; pfam08756
261594001657	Fumarate hydratase (Fumerase); Region: Fumerase; pfam05681
261594001658	Fumarase C-terminus; Region: Fumerase_C; pfam05683
261594001659	Catalytic NodB homology domain of Bacillus subtilis polysaccharide deacetylase PdaA, and its bacterial homologs; Region: CE4_BsPdaA_like; cd10948
261594001660	delta-lactam-biosynthetic de-N-acetylase; Region: spore_pdaA; TIGR02884
261594001661	NodB motif; other site
261594001662	active site
261594001663	catalytic site [active]
261594001664	Cd binding site [ion binding]; other site
261594001665	TRAM domain; Region: TRAM; pfam01938
261594001666	23S rRNA (uracil-5-)-methyltransferase RumA; Region: rumA; TIGR00479
261594001667	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594001668	S-adenosylmethionine binding site [chemical binding]; other site
261594001669	lysogenic prophage region PHAGE01; Best Hits not completed.   attL/R=tc[ta]acatgagctgtat
261594001670	tyrosine recombinase XerC; Region: recomb_XerC; TIGR02224
261594001671	phiLC3 phage and phage-related integrases, site-specific recombinases, DNA breaking-rejoining enzymes, C-terminal catalytic domain. This CD includes various bacterial (mainly gram positive) and phage integrases, including those similar to Lactococcus...; Region: INT_phiLC3_C; cd01189
261594001672	Int/Topo IB signature motif; other site
261594001673	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
261594001674	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
261594001675	non-specific DNA binding site [nucleotide binding]; other site
261594001676	salt bridge; other site
261594001677	sequence-specific DNA binding site [nucleotide binding]; other site
261594001678	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
261594001679	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
261594001680	non-specific DNA binding site [nucleotide binding]; other site
261594001681	salt bridge; other site
261594001682	sequence-specific DNA binding site [nucleotide binding]; other site
261594001683	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
261594001684	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
261594001685	non-specific DNA binding site [nucleotide binding]; other site
261594001686	salt bridge; other site
261594001687	sequence-specific DNA binding site [nucleotide binding]; other site
261594001688	phage regulatory protein, rha family; Region: phage_pRha; TIGR02681
261594001689	ORF6C domain; Region: ORF6C; pfam10552
261594001690	Helix-turn-helix domain; Region: HTH_17; pfam12728
261594001691	Replication initiation and membrane attachment; Region: DnaB_2; pfam07261
261594001692	hypothetical protein; Validated; Region: PRK08116
261594001693	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
261594001694	Walker A motif; other site
261594001695	ATP binding site [chemical binding]; other site
261594001696	Protein of unknown function (DUF3954); Region: DUF3954; pfam13128
261594001697	Nucleoside Triphosphate Pyrophosphohydrolase (EC 3.6.1.8) MazG-like domain found in a group of uncharacterized proteins from bacteria and archaea; Region: NTP-PPase_u4; cd11541
261594001698	putative metal binding site [ion binding]; other site
261594001699	phage transcriptional regulator, ArpU family; Region: phage_arpU; TIGR01637
261594001700	HNH endonuclease; Region: HNH; pfam01844
261594001701	Phage terminase-like protein, large subunit [General function prediction only]; Region: COG4626
261594001702	Caudovirus prohead protease; Region: Peptidase_U35; pfam04586
261594001703	phage major capsid protein, HK97 family; Region: major_cap_HK97; TIGR01554
261594001704	Phage capsid family; Region: Phage_capsid; pfam05065
261594001705	Head-Tail Connector Protein gp6 of Bacteriophage HK97 and similar proteins; Region: gp6; cd08054
261594001706	oligomerization interface [polypeptide binding]; other site
261594001707	Phage head-tail joining protein; Region: Phage_H_T_join; cl11461
261594001708	phage major tail protein, phi13 family; Region: maj_tail_phi13; TIGR01603
261594001709	Domain of unknown function (DUF947); Region: DUF947; pfam06102
261594001710	Phage-related protein [Function unknown]; Region: COG4722
261594001711	Phage tail protein; Region: Sipho_tail; pfam05709
261594001712	GDSL-like Lipase/Acylhydrolase family; Region: Lipase_GDSL_2; pfam13472
261594001713	phage minor structural protein, N-terminal region; Region: put_anti_recept; TIGR01665
261594001714	Haemolysin XhlA; Region: XhlA; pfam10779
261594001715	PlyB is a bacteriophage endolysin that displays potent lytic activity toward Bacillus anthracis.  PlyB has an N-terminal glycosyl hydrolase family 25 (GH25) catalytic domain and a C-terminal bacterial SH3-like domain, SH3b.  Both domains are required for...; Region: GH25_PlyB-like; cd06523
261594001716	Glycosyl hydrolases family 25; Region: Glyco_hydro_25; pfam01183
261594001717	active site
261594001718	N-acetylmuramoyl-l-alanine amidase; Region: Amidase02_C; pfam12123
261594001719	tRNA pseudouridine synthase A; Reviewed; Region: PRK12434
261594001720	Eukaryotic and bacterial pseudouridine synthases similar to E.  coli TruA; Region: PseudoU_synth_EcTruA; cd02570
261594001721	dimerization interface 3.5A [polypeptide binding]; other site
261594001722	active site
261594001723	psp operon transcriptional activator PspF; Region: phageshock_pspF; TIGR02974
261594001724	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
261594001725	Walker A motif; other site
261594001726	ATP binding site [chemical binding]; other site
261594001727	Walker B motif; other site
261594001728	arginine finger; other site
261594001729	Bacterial regulatory protein, Fis family; Region: HTH_8; pfam02954
261594001730	hypothetical protein; Validated; Region: PRK06748
261594001731	S-methylmethionine transporter; Provisional; Region: PRK11387
261594001732	acetylornithine deacetylase; Validated; Region: PRK08596
261594001733	Zinc peptidases M18, M20, M28, and M42; Region: Zinc_peptidase_like; cl14876
261594001734	metal binding site [ion binding]; metal-binding site
261594001735	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
261594001736	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
261594001737	non-specific DNA binding site [nucleotide binding]; other site
261594001738	salt bridge; other site
261594001739	sequence-specific DNA binding site [nucleotide binding]; other site
261594001740	Protein of unknown function (DUF1232); Region: DUF1232; pfam06803
261594001741	putative sporulation protein YtaF; Region: spore_YtaF; TIGR02840
261594001742	Domain of unknown function DUF; Region: DUF204; pfam02659
261594001743	Protein of unknown function (DUF3969); Region: DUF3969; pfam13108
261594001744	glutaminase A; Region: Gln_ase; TIGR03814
261594001745	Glutaminase [Amino acid transport and metabolism]; Region: GlsA; COG2066
261594001746	PTS system, N-acetylglucosamine-specific IIBC component; Region: PTS-II-BC-nag; TIGR01998
261594001747	Phosphotransferase system IIC components, glucose/maltose/N-acetylglucosamine-specific [Carbohydrate transport and metabolism]; Region: PtsG; COG1263
261594001748	PTS_IIB, PTS system, glucose/sucrose specific IIB subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This family...; Region: PTS_IIB_glc; cd00212
261594001749	active site turn [active]
261594001750	phosphorylation site [posttranslational modification]
261594001751	Beta-lactamase; Region: Beta-lactamase; pfam00144
261594001752	Beta-lactamase class C and other penicillin binding proteins [Defense mechanisms]; Region: AmpC; COG1680
261594001753	Sm and related proteins; Region: Sm_like; cl00259
261594001754	heptamer interface [polypeptide binding]; other site
261594001755	Sm1 motif; other site
261594001756	hexamer interface [polypeptide binding]; other site
261594001757	RNA binding site [nucleotide binding]; other site
261594001758	Sm2 motif; other site
261594001759	Sm and related proteins; Region: Sm_like; cl00259
261594001760	heptamer interface [polypeptide binding]; other site
261594001761	Sm1 motif; other site
261594001762	hexamer interface [polypeptide binding]; other site
261594001763	RNA binding site [nucleotide binding]; other site
261594001764	Sm2 motif; other site
261594001765	DPM_DPG-synthase_like is a member of the Glycosyltransferase 2 superfamily; Region: DPM_DPG-synthase_like; cd04179
261594001766	Ligand binding site; other site
261594001767	Putative Catalytic site; other site
261594001768	DXD motif; other site
261594001769	Glycosyltransferases involved in cell wall biogenesis [Cell envelope biogenesis, outer membrane]; Region: WcaA; COG0463
261594001770	Glycosyltransferase family A (GT-A) includes diverse families of glycosyl transferases with a common GT-A type structural fold; Region: Glyco_tranf_GTA_type; cl11394
261594001771	active site
261594001772	Nucleoside-diphosphate-sugar epimerases [Cell envelope biogenesis, outer membrane / Carbohydrate transport and metabolism]; Region: WcaG; COG0451
261594001773	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
261594001774	NAD(P) binding site [chemical binding]; other site
261594001775	active site
261594001776	Glycosyltransferase family A (GT-A) includes diverse families of glycosyl transferases with a common GT-A type structural fold; Region: Glyco_tranf_GTA_type; cl11394
261594001777	active site
261594001778	Glycosyltransferases involved in cell wall biogenesis [Cell envelope biogenesis, outer membrane]; Region: WcaA; COG0463
261594001779	Glycosyltransferase family A (GT-A) includes diverse families of glycosyl transferases with a common GT-A type structural fold; Region: Glyco_tranf_GTA_type; cl11394
261594001780	active site
261594001781	formate acetyltransferase 1; Region: pyr_form_ly_1; TIGR01255
261594001782	Pyruvate formate lyase 1; Region: PFL1; cd01678
261594001783	coenzyme A binding site [chemical binding]; other site
261594001784	active site
261594001785	catalytic residues [active]
261594001786	glycine loop; other site
261594001787	pyruvate formate-lyase 1-activating enzyme; Region: PFLA; TIGR02493
261594001788	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
261594001789	FeS/SAM binding site; other site
261594001790	diacylglycerol glucosyltransferase; Provisional; Region: PRK13609
261594001791	Monogalactosyldiacylglycerol (MGDG) synthase; Region: MGDG_synth; pfam06925
261594001792	Glycosyltransferases catalyze the transfer of sugar moieties from activated donor molecules to specific acceptor molecules, forming glycosidic bonds. The acceptor molecule can be a lipid, a protein, a heterocyclic compound, or another carbohydrate...; Region: Glycosyltransferase_GTB_type; cl10013
261594001793	YfhE-like protein; Region: YfhE; pfam14152
261594001794	Acetyltransferase (GNAT) domain; Region: Acetyltransf_3; pfam13302
261594001795	Imidazolonepropionase and related amidohydrolases [Secondary metabolites biosynthesis, transport, and catabolism]; Region: HutI; COG1228
261594001796	Metallo-dependent hydrolases, subgroup C is part of the superfamily of metallo-dependent hydrolases, a large group of proteins that show conservation in their 3-dimensional fold (TIM barrel) and in details of their active site. The vast majority of the...; Region: Met_dep_hydrolase_C; cd01309
261594001797	active site
261594001798	atypical (a) SDRs, subgroup 8; Region: SDR_a8; cd05242
261594001799	TIGR01777 family protein; Region: yfcH
261594001800	putative NAD(P) binding site [chemical binding]; other site
261594001801	putative active site [active]
261594001802	recombination regulator RecX; Provisional; Region: recX; PRK14135
261594001803	Protein of unknown function (DUF1811); Region: DUF1811; pfam08838
261594001804	YpzG-like protein; Region: YpzG; pfam14139
261594001805	Small acid-soluble spore protein K family; Region: SspK; pfam08176
261594001806	WVELL protein; Region: WVELL; pfam14043
261594001807	Predicted membrane-bound metal-dependent hydrolases [General function prediction only]; Region: COG1988
261594001808	A/G-specific DNA glycosylase [DNA replication, recombination, and repair]; Region: MutY; COG1194
261594001809	endonuclease III; includes endonuclease III (DNA-(apurinic or apyrimidinic site) lyase), alkylbase DNA glycosidases (Alka-family) and other DNA glycosidases; Region: ENDO3c; cd00056
261594001810	minor groove reading motif; other site
261594001811	helix-hairpin-helix signature motif; other site
261594001812	substrate binding pocket [chemical binding]; other site
261594001813	active site
261594001814	iron-sulpphur binding domain in DNA-(apurinic or apyrimidinic site) lyase (subfamily of ENDO3); Region: FES; smart00525
261594001815	DNA glycosylase (MutY in bacteria and hMYH in humans) is responsible for repairing misread  A*oxoG residues to C*G by removing the inappropriately paired adenine base from the DNA backbone. It belongs to the Nudix hydrolase superfamily and is important...; Region: DNA_Glycosylase_C; cd03431
261594001816	DNA binding and oxoG recognition site [nucleotide binding]
261594001817	YgaB-like protein; Region: YgaB; pfam14182
261594001818	hypothetical protein; Provisional; Region: PRK13662
261594001819	ABC-type multidrug transport system, ATPase and permease components [Defense mechanisms]; Region: MdlB; COG1132
261594001820	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
261594001821	ATP-binding cassette domain of the bacterial lipid flippase and related proteins, subfamily C; Region: ABCC_MsbA; cd03251
261594001822	Walker A/P-loop; other site
261594001823	ATP binding site [chemical binding]; other site
261594001824	Q-loop/lid; other site
261594001825	ABC transporter signature motif; other site
261594001826	Walker B; other site
261594001827	D-loop; other site
261594001828	H-loop/switch region; other site
261594001829	Predicted membrane protein [Function unknown]; Region: COG4129
261594001830	Bacterial protein of unknown function (DUF939); Region: DUF939; pfam06081
261594001831	glutamate synthase subunit alpha; Provisional; Region: gltB; PRK11750
261594001832	Glutamine amidotransferases class-II (Gn-AT), glutamate synthase (GltS)-type. GltS is a homodimer that synthesizes L-glutamate from 2-oxoglutarate and L-glutamine, an important step in ammonia assimilation in bacteria, cyanobacteria and plants. The...; Region: GltS; cd00713
261594001833	active site
261594001834	dimer interface [polypeptide binding]; other site
261594001835	Glutamate synthase central domain; Region: Glu_syn_central; pfam04898
261594001836	Glutamate synthase (GltS) FMN-binding domain.  GltS is a complex iron-sulfur flavoprotein that catalyzes the reductive synthesis of L-glutamate from 2-oxoglutarate and L-glutamine via intramolecular channelling of ammonia, a reaction in the plant, yeast...; Region: GltS_FMN; cd02808
261594001837	active site
261594001838	FMN binding site [chemical binding]; other site
261594001839	substrate binding site [chemical binding]; other site
261594001840	3Fe-4S cluster binding site [ion binding]; other site
261594001841	GXGXG domain. This domain of unknown function is found at the C-terminus of the large subunit (gltB) of glutamate synthase (GltS),  in subunit C of tungsten formylmethanofuran dehydrogenase (FwdC) and in subunit C of molybdenum formylmethanofuran...; Region: GXGXG; cd00504
261594001842	domain_subunit interface; other site
261594001843	glutamate-1-semialdehyde aminotransferase; Provisional; Region: PRK12389
261594001844	Acetyl ornithine aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to ornithine aminotransferase, acetylornithine aminotransferase; Region: OAT_like; cd00610
261594001845	inhibitor-cofactor binding pocket; inhibition site
261594001846	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594001847	catalytic residue [active]
261594001848	ABC-type uncharacterized transport system, ATPase component [General function prediction only]; Region: COG4586
261594001849	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
261594001850	Walker A/P-loop; other site
261594001851	ATP binding site [chemical binding]; other site
261594001852	Q-loop/lid; other site
261594001853	ABC transporter signature motif; other site
261594001854	Walker B; other site
261594001855	D-loop; other site
261594001856	H-loop/switch region; other site
261594001857	ABC-type uncharacterized transport system, permease component [General function prediction only]; Region: COG4587
261594001858	ABC-2 family transporter protein; Region: ABC2_membrane_6; cl01496
261594001859	ABC-2 family transporter protein; Region: ABC2_membrane_6; cl01496
261594001860	ABC-type uncharacterized transport system, permease component [General function prediction only]; Region: COG4587
261594001861	Ion channel; Region: Ion_trans_2; pfam07885
261594001862	Peroxiredoxin [Posttranslational modification, protein turnover, chaperones]; Region: AhpC; COG0450
261594001863	Peroxiredoxin (PRX) family, Bacterioferritin comigratory protein (BCP) subfamily; composed of thioredoxin-dependent thiol peroxidases, widely expressed in pathogenic bacteria, that protect cells against toxicity from reactive oxygen species by reducing...; Region: PRX_BCP; cd03017
261594001864	catalytic triad [active]
261594001865	Ferric uptake regulator(Fur) and related metalloregulatory proteins; typically iron-dependent, DNA-binding repressors and activators; Region: Fur_like; cd07153
261594001866	metal binding site 2 [ion binding]; metal-binding site
261594001867	putative DNA binding helix; other site
261594001868	metal binding site 1 [ion binding]; metal-binding site
261594001869	dimer interface [polypeptide binding]; other site
261594001870	structural Zn2+ binding site [ion binding]; other site
261594001871	Protein of unknown function (DUF2614); Region: DUF2614; pfam11023
261594001872	Protein of unknown function (DUF3884); Region: DUF3884; pfam13024
261594001873	hypothetical protein; Provisional; Region: PRK12378
261594001874	Nudix hydrolase is a superfamily of enzymes found in all three kingdoms of life, and it catalyzes the hydrolysis of NUcleoside DIphosphates linked to other moieties, X. Enzymes belonging to this superfamily require a divalent cation, such as Mg2+ or Mn2+...; Region: Nudix_Hydrolase; cd02883
261594001875	nudix motif; other site
261594001876	Transglycosylase; Region: Transgly; pfam00912
261594001877	Protein-disulfide isomerase [Posttranslational modification, protein turnover, chaperones]; Region: DsbG; COG1651
261594001878	Thioredoxin; Region: Thioredoxin_4; pfam13462
261594001879	epoxyqueuosine reductase; Region: TIGR00276
261594001880	Domain of unknown function (DUF1730); Region: DUF1730; pfam08331
261594001881	Putative amidase domain; Region: Amidase_6; pfam12671
261594001882	Predicted rRNA methylase (SpoU class) [Translation, ribosomal structure and biogenesis]; Region: CspR; COG0219
261594001883	PAS fold; Region: PAS_4; pfam08448
261594001884	PAS domain S-box; Region: sensory_box; TIGR00229
261594001885	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
261594001886	putative active site [active]
261594001887	heme pocket [chemical binding]; other site
261594001888	c-di-GMP synthetase (diguanylate cyclase, GGDEF domain) [Signal    transduction mechanisms]; Region: COG2199
261594001889	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
261594001890	metal binding site [ion binding]; metal-binding site
261594001891	active site
261594001892	I-site; other site
261594001893	EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2).  The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cd01948
261594001894	Putative Ser protein kinase [Signal transduction mechanisms]; Region: PrkA; COG2766
261594001895	PrkA serine protein kinase C-terminal domain; Region: PrkA; pfam06798
261594001896	sporulation protein YhbH; Region: spore_yhbH; TIGR02877
261594001897	NEAr Transport domain, a component of cell surface proteins; Region: NEAT; cd06920
261594001898	heme-binding site [chemical binding]; other site
261594001899	Leucine rich repeat; Region: LRR_8; pfam13855
261594001900	Leucine-rich repeats (LRRs), ribonuclease inhibitor (RI)-like subfamily. LRRs are 20-29 residue sequence motifs present in many proteins that participate in protein-protein interactions and have different functions and cellular locations. LRRs correspond...; Region: LRR_RI; cl15309
261594001901	Substrate binding site [chemical binding]; other site
261594001902	Leucine Rich repeats (2 copies); Region: LRR_4; pfam12799
261594001903	Leucine Rich repeats (2 copies); Region: LRR_4; pfam12799
261594001904	Leucine Rich repeats (2 copies); Region: LRR_4; pfam12799
261594001905	Leucine Rich repeats (2 copies); Region: LRR_4; pfam12799
261594001906	Leucine Rich repeats (2 copies); Region: LRR_4; pfam12799
261594001907	Leucine-rich repeats (LRRs), ribonuclease inhibitor (RI)-like subfamily. LRRs are 20-29 residue sequence motifs present in many proteins that participate in protein-protein interactions and have different functions and cellular locations. LRRs correspond...; Region: LRR_RI; cl15309
261594001908	Leucine rich repeat; Region: LRR_8; pfam13855
261594001909	Leucine rich repeat; Region: LRR_8; pfam13855
261594001910	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594001911	Acetyltransferases [General function prediction only]; Region: RimI; COG0456
261594001912	Coenzyme A binding pocket [chemical binding]; other site
261594001913	BCCT family transporter; Region: BCCT; pfam02028
261594001914	Peptidase family M9 N-terminal; Region: Peptidase_M9_N; pfam08453
261594001915	Peptidase Gluzincin family (thermolysin-like proteinases, TLPs) includes peptidases M1, M2, M3, M4, M13, M32 and M36 (fungalysins); Region: GluZincin; cl14813
261594001916	FOG: PKD repeat [General function prediction only]; Region: COG3291
261594001917	polycystic kidney disease I (PKD) domain; similar to other cell-surface modules, with an IG-like fold; domain probably functions as a ligand binding site in protein-protein or protein-carbohydrate interactions; a single instance of the repeat is...; Region: PKD; cd00146
261594001918	Bacterial pre-peptidase C-terminal domain; Region: PPC; pfam04151
261594001919	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2268
261594001920	Band_7_flotillin: a subgroup of the band 7 domain of flotillin (reggie) like proteins. This subgroup contains proteins similar to stomatin, prohibitin, flotillin, HlfK/C and podicin.  These two proteins are lipid raft-associated.  Individual proteins of...; Region: Band_7_flotillin; cd03399
261594001921	ligand binding domain of Tar- and Tsr-related chemoreceptors; Region: Tar_Tsr_LBD; cl00144
261594001922	Cache domain; Region: Cache_1; pfam02743
261594001923	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
261594001924	dimerization interface [polypeptide binding]; other site
261594001925	Methyl-accepting chemotaxis-like domains (chemotaxis sensory transducer); Region: MA; smart00283
261594001926	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
261594001927	dimer interface [polypeptide binding]; other site
261594001928	putative CheW interface [polypeptide binding]; other site
261594001929	Signal transduction histidine kinase regulating citrate/malate metabolism [Signal transduction mechanisms]; Region: CitA; COG3290
261594001930	PAS domain; Region: PAS; smart00091
261594001931	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594001932	ATP binding site [chemical binding]; other site
261594001933	Mg2+ binding site [ion binding]; other site
261594001934	G-X-G motif; other site
261594001935	H+/citrate symporter [Energy production and conversion]; Region: CitM; cl17620
261594001936	Citrate transporter; Region: CitMHS; pfam03600
261594001937	hypothetical protein; Provisional; Region: PRK12784
261594001938	NosL; Region: NosL; cl01769
261594001939	Ankyrin repeats (3 copies); Region: Ank_2; pfam12796
261594001940	Ankyrin repeat; Region: Ank; pfam00023
261594001941	Ankyrin repeats (3 copies); Region: Ank_2; pfam12796
261594001942	ankyrin repeats;  ankyrin repeats mediate protein-protein interactions in very diverse families of proteins. The number of ANK repeats in a protein can range from 2 to over 20 (ankyrins, for example). ANK repeats may occur in combinations with other...; Region: ANK; cd00204
261594001943	Ankyrin repeats (3 copies); Region: Ank_2; pfam12796
261594001944	Glycerol-3-phosphate responsive antiterminator; Region: G3P_antiterm; cl00852
261594001945	glycerol-3-phosphate transporter ATP-binding subunit; Provisional; Region: ugpC; PRK11650
261594001946	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
261594001947	Walker A/P-loop; other site
261594001948	ATP binding site [chemical binding]; other site
261594001949	Q-loop/lid; other site
261594001950	ABC transporter signature motif; other site
261594001951	Walker B; other site
261594001952	D-loop; other site
261594001953	H-loop/switch region; other site
261594001954	ABC-type polysaccharide transport system, permease component [Carbohydrate transport and metabolism]; Region: LplB; COG4209
261594001955	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
261594001956	dimer interface [polypeptide binding]; other site
261594001957	conserved gate region; other site
261594001958	putative PBP binding loops; other site
261594001959	ABC-ATPase subunit interface; other site
261594001960	ABC-type sugar transport system, permease component [Carbohydrate transport and metabolism]; Region: UgpE; COG0395
261594001961	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cl00427
261594001962	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
261594001963	dimer interface [polypeptide binding]; other site
261594001964	conserved gate region; other site
261594001965	putative PBP binding loops; other site
261594001966	ABC-ATPase subunit interface; other site
261594001967	ABC-type sugar transport system, periplasmic component [Carbohydrate transport and metabolism]; Region: UgpB; COG1653
261594001968	Bacterial extracellular solute-binding protein; Region: SBP_bac_1; cl17199
261594001969	Calcineurin-like phosphoesterase; Region: Metallophos; pfam00149
261594001970	phosphoprotein phosphatases of the metallophosphatase superfamily, metallophosphatase domain; Region: MPP_PPP_family; cd00144
261594001971	active site
261594001972	metal binding site [ion binding]; metal-binding site
261594001973	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
261594001974	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594001975	active site
261594001976	phosphorylation site [posttranslational modification]
261594001977	intermolecular recognition site; other site
261594001978	dimerization interface [polypeptide binding]; other site
261594001979	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
261594001980	DNA binding site [nucleotide binding]
261594001981	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
261594001982	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
261594001983	dimer interface [polypeptide binding]; other site
261594001984	phosphorylation site [posttranslational modification]
261594001985	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594001986	ATP binding site [chemical binding]; other site
261594001987	Mg2+ binding site [ion binding]; other site
261594001988	G-X-G motif; other site
261594001989	leucyl-tRNA synthetase; Reviewed; Region: leuS; PRK12300
261594001990	A sub-family of peptidase family C39. Peptidase family C39 mostly contains bacteriocin-processing endopeptidases from bacteria. The cysteine peptidases in family C39 cleave the "double-glycine" leader peptides from the precursors of various...; Region: Peptidase_C39A; cd02549
261594001991	putative active site [active]
261594001992	ligand binding domain of Tar- and Tsr-related chemoreceptors; Region: Tar_Tsr_LBD; cl00144
261594001993	Cache domain; Region: Cache_1; pfam02743
261594001994	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
261594001995	dimerization interface [polypeptide binding]; other site
261594001996	Methyl-accepting chemotaxis-like domains (chemotaxis sensory transducer); Region: MA; smart00283
261594001997	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
261594001998	dimer interface [polypeptide binding]; other site
261594001999	putative CheW interface [polypeptide binding]; other site
261594002000	sensory histidine kinase DcuS; Provisional; Region: PRK11086
261594002001	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594002002	ATP binding site [chemical binding]; other site
261594002003	Mg2+ binding site [ion binding]; other site
261594002004	G-X-G motif; other site
261594002005	Response regulator of citrate/malate metabolism [Transcription / Signal transduction mechanisms]; Region: CitB; COG4565
261594002006	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594002007	active site
261594002008	phosphorylation site [posttranslational modification]
261594002009	intermolecular recognition site; other site
261594002010	dimerization interface [polypeptide binding]; other site
261594002011	2-hydroxycarboxylate transporter family; Region: 2HCT; pfam03390
261594002012	Malic enzyme [Energy production and conversion]; Region: SfcA; COG0281
261594002013	Malic enzyme, N-terminal domain; Region: malic; pfam00390
261594002014	NAD(P) binding domain of malic enzyme (ME), subgroup 2; Region: NAD_bind_2_malic_enz; cd05311
261594002015	putative NAD(P) binding site [chemical binding]; other site
261594002016	EamA-like transporter family; Region: EamA; pfam00892
261594002017	Carboxylate/Amino Acid/Amine Transporter; Region: 2A78; TIGR00950
261594002018	EamA-like transporter family; Region: EamA; pfam00892
261594002019	Transcriptional regulators containing a DNA-binding HTH domain and an aminotransferase domain (MocR family) and their eukaryotic orthologs [Transcription / Amino acid transport and metabolism]; Region: ARO8; COG1167
261594002020	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
261594002021	DNA-binding site [nucleotide binding]; DNA binding site
261594002022	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
261594002023	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594002024	homodimer interface [polypeptide binding]; other site
261594002025	catalytic residue [active]
261594002026	Acetyltransferase (GNAT) domain; Region: Acetyltransf_4; pfam13420
261594002027	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594002028	Coenzyme A binding pocket [chemical binding]; other site
261594002029	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
261594002030	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
261594002031	dimerization interface [polypeptide binding]; other site
261594002032	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
261594002033	dimer interface [polypeptide binding]; other site
261594002034	phosphorylation site [posttranslational modification]
261594002035	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594002036	ATP binding site [chemical binding]; other site
261594002037	Mg2+ binding site [ion binding]; other site
261594002038	G-X-G motif; other site
261594002039	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
261594002040	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594002041	active site
261594002042	phosphorylation site [posttranslational modification]
261594002043	intermolecular recognition site; other site
261594002044	dimerization interface [polypeptide binding]; other site
261594002045	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
261594002046	DNA binding site [nucleotide binding]
261594002047	Acetyltransferase (GNAT) domain; Region: Acetyltransf_4; pfam13420
261594002048	Arrestin_N terminal like; Region: LDB19; pfam13002
261594002049	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594002050	Coenzyme A binding pocket [chemical binding]; other site
261594002051	formate dehydrogenase accessory protein; Reviewed; Region: PRK00724
261594002052	Uncharacterized anaerobic dehydrogenase [General function prediction only]; Region: COG3383
261594002053	2Fe-2S iron-sulfur cluster binding domain. Iron-sulfur proteins play an important role in electron transfer processes and in various enzymatic reactions. The family includes plant and algal ferredoxins, which act as electron carriers in photosynthesis...; Region: fer2; cd00207
261594002054	catalytic loop [active]
261594002055	iron binding site [ion binding]; other site
261594002056	NADH-ubiquinone oxidoreductase-G iron-sulfur binding region; Region: NADH-G_4Fe-4S_3; pfam10588
261594002057	4Fe-4S binding domain; Region: Fer4; pfam00037
261594002058	Formate dehydrogenase H (Formate-Dh-H) catalyzes the reversible oxidation of formate to CO2 with the release of a proton and two electrons. It is a component of the anaerobic formate hydrogen lyase complex. The E. coli formate dehydrogenase H (Fdh-H) is...; Region: MopB_Formate-Dh-H; cd02753
261594002059	[4Fe-4S] binding site [ion binding]; other site
261594002060	molybdopterin cofactor binding site; other site
261594002061	Molybdopterin-Binding, C-terminal (MopB_CT) domain of the MopB superfamily of proteins, a  large, diverse, heterogeneous superfamily of enzymes that, in general, bind molybdopterin as a cofactor. The MopB domain is found in a wide variety of molybdenum-...; Region: MopB_CT; cl09929
261594002062	molybdopterin cofactor binding site; other site
261594002063	Membrane domain of glycerophosphoryl diester phosphodiesterase; Region: GPDPase_memb; pfam10110
261594002064	Glycerophosphoryl diester phosphodiesterase [Energy production and conversion]; Region: UgpQ; COG0584
261594002065	Glycerophosphodiester phosphodiesterase domain of uncharacterized bacterial glycerophosphodiester phosphodiesterases; Region: GDPD_memb_like; cd08579
261594002066	putative active site [active]
261594002067	catalytic site [active]
261594002068	putative metal binding site [ion binding]; other site
261594002069	Alanine dehydrogenase [Amino acid transport and metabolism]; Region: Ald; COG0686
261594002070	Alanine dehydrogenase NAD-binding and catalytic domains; Region: L-AlaDH; cd05305
261594002071	hexamer interface [polypeptide binding]; other site
261594002072	ligand binding site [chemical binding]; other site
261594002073	putative active site [active]
261594002074	NAD(P) binding site [chemical binding]; other site
261594002075	amino acid transporter; Region: 2A0306; TIGR00909
261594002076	C-terminus of AA_permease; Region: AA_permease_C; pfam13906
261594002077	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
261594002078	dimerization interface [polypeptide binding]; other site
261594002079	putative DNA binding site [nucleotide binding]; other site
261594002080	putative Zn2+ binding site [ion binding]; other site
261594002081	Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371
261594002082	metal-binding site [ion binding]
261594002083	Cation transport ATPase [Inorganic ion transport and metabolism]; Region: ZntA; COG2217
261594002084	Heavy-metal-associated domain; Region: HMA; pfam00403
261594002085	metal-binding site [ion binding]
261594002086	E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122
261594002087	Soluble P-type ATPase [General function prediction only]; Region: COG4087
261594002088	nicotinate phosphoribosyltransferase; Validated; Region: PRK09243
261594002089	Nicotinate phosphoribosyltransferase (NAPRTase), subgroup A. Nicotinate phosphoribosyltransferase catalyses the formation of NAMN and PPi from 5-phosphoribosy -1-pyrophosphate (PRPP) and nicotinic acid, this is the first, and also rate limiting, reaction...; Region: NAPRTase_A; cd01570
261594002090	active site
261594002091	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
261594002092	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
261594002093	non-specific DNA binding site [nucleotide binding]; other site
261594002094	salt bridge; other site
261594002095	sequence-specific DNA binding site [nucleotide binding]; other site
261594002096	Tetratricopeptide repeat; Region: TPR_12; pfam13424
261594002097	Zinc metalloprotease (elastase) [Amino acid transport and metabolism]; Region: LasB; COG3227
261594002098	Fungalysin/Thermolysin Propeptide Motif; Region: FTP; pfam07504
261594002099	Peptidase propeptide and YPEB domain; Region: PepSY; pfam03413
261594002100	Peptidase M4 family includes thermolysin, protealysin, aureolysin and neutral protease; Region: M4_neutral_protease; cd09597
261594002101	active site
261594002102	Zn binding site [ion binding]; other site
261594002103	Uncharacterized conserved protein [Function unknown]; Region: COG0398
261594002104	SNARE associated Golgi protein; Region: SNARE_assoc; pfam09335
261594002105	Putative peptidoglycan binding domain; Region: PG_binding_4; pfam12229
261594002106	VanW like protein; Region: VanW; pfam04294
261594002107	Cell envelope-related transcriptional attenuator domain; Region: LytR_cpsA_psr; cl00581
261594002108	Nucleoside permease [Nucleotide transport and metabolism]; Region: NupC; COG1972
261594002109	Na+ dependent nucleoside transporter N-terminus; Region: Nucleos_tra2_N; pfam01773
261594002110	Nucleoside recognition; Region: Gate; pfam07670
261594002111	Na+ dependent nucleoside transporter C-terminus; Region: Nucleos_tra2_C; pfam07662
261594002112	This conserved domain belongs to a superfamily including the bleomycin resistance protein, glyoxalase I, and type I ring-cleaving dioxygenases; Region: Glo_EDI_BRP_like_1; cd08352
261594002113	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
261594002114	putative metal binding site [ion binding]; other site
261594002115	Domain of unknown function DUF21; Region: DUF21; pfam01595
261594002116	FOG: CBS domain [General function prediction only]; Region: COG0517
261594002117	This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domains associated with the CorC_HlyC domain. CorC_HlyC is a transporter associated domain. This small domain is found in Na+/H+ antiporters, in proteins involved in...; Region: CBS_pair_CorC_HlyC_assoc; cd04590
261594002118	aspartate ammonia-lyase; Provisional; Region: aspA; PRK12273
261594002119	Aspartase; Region: Aspartase; cd01357
261594002120	active sites [active]
261594002121	tetramer interface [polypeptide binding]; other site
261594002122	L-lactate permease; Region: Lactate_perm; cl00701
261594002123	L-lactate permease [Energy production and conversion]; Region: LldP; COG1620
261594002124	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
261594002125	dimerization interface [polypeptide binding]; other site
261594002126	putative Zn2+ binding site [ion binding]; other site
261594002127	putative DNA binding site [nucleotide binding]; other site
261594002128	acid-soluble spore protein H; Provisional; Region: sspH; PRK01625
261594002129	amino acid/peptide transporter (Peptide:H+ symporter), bacterial; Region: yjdL_sub1_fam; TIGR00924
261594002130	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594002131	putative substrate translocation pore; other site
261594002132	Fe3+-siderophore binding domain FhuD.  These proteins have been shown to function as initial receptors in ABC transport of Fe3+-siderophores in many eubacterial species. They belong to the TroA-like superfamily of helical backbone metal receptor proteins...; Region: FhuD; cd01146
261594002133	Periplasmic binding protein; Region: Peripla_BP_2; pfam01497
261594002134	siderophore binding site; other site
261594002135	iron-hydroxamate transporter permease subunit; Provisional; Region: PRK10577
261594002136	Transmembrane subunit (TM), of Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters involved in the uptake of siderophores, heme, vitamin B12, or the divalent cations Mg2+ and Zn2+. PBP-dependent ABC transporters consist of...; Region: TM_ABC_iron-siderophores_like; cd06550
261594002137	ABC-ATPase subunit  interface; other site
261594002138	dimer interface [polypeptide binding]; other site
261594002139	putative PBP binding regions; other site
261594002140	ABC-type enterobactin transport system, permease component [Inorganic ion transport and metabolism]; Region: FepG; COG4779
261594002141	Transmembrane subunit (TM), of Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters involved in the uptake of siderophores, heme, vitamin B12, or the divalent cations Mg2+ and Zn2+. PBP-dependent ABC transporters consist of...; Region: TM_ABC_iron-siderophores_like; cd06550
261594002142	ABC-ATPase subunit  interface; other site
261594002143	dimer interface [polypeptide binding]; other site
261594002144	putative PBP binding regions; other site
261594002145	ABC-type cobalamin/Fe3+-siderophores transport systems, ATPase components [Inorganic ion transport and metabolism / Coenzyme metabolism]; Region: FepC; COG1120
261594002146	ATP-binding component of iron-siderophores, vitamin B12 and hemin transporters and related proteins; Region: ABC_Iron-Siderophores_B12_Hemin; cd03214
261594002147	Walker A/P-loop; other site
261594002148	ATP binding site [chemical binding]; other site
261594002149	Q-loop/lid; other site
261594002150	ABC transporter signature motif; other site
261594002151	Walker B; other site
261594002152	D-loop; other site
261594002153	H-loop/switch region; other site
261594002154	Methyltransferase domain; Region: Methyltransf_31; pfam13847
261594002155	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594002156	S-adenosylmethionine binding site [chemical binding]; other site
261594002157	pyridoxal phosphate-dependent acyltransferase, putative; Region: gly_Cac_T_rel; TIGR01825
261594002158	KBL_like; this family belongs to the pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD corresponds to serine palmitoyltransferase (SPT), 5-aminolevulinate synthase (ALAS); Region: KBL_like; cd06454
261594002159	substrate-cofactor binding pocket; other site
261594002160	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594002161	catalytic residue [active]
261594002162	Nucleoside-diphosphate-sugar epimerases [Cell envelope biogenesis, outer membrane / Carbohydrate transport and metabolism]; Region: WcaG; COG0451
261594002163	L-threonine dehydrogenase, extended (e) SDRs; Region: TDH_SDR_e; cd05272
261594002164	NAD binding site [chemical binding]; other site
261594002165	homodimer interface [polypeptide binding]; other site
261594002166	active site
261594002167	putative substrate binding site [chemical binding]; other site
261594002168	Nudix hydrolase is a superfamily of enzymes found in all three kingdoms of life, and it catalyzes the hydrolysis of NUcleoside DIphosphates linked to other moieties, X. Enzymes belonging to this superfamily require a divalent cation, such as Mg2+ or Mn2+...; Region: Nudix_Hydrolase; cd02883
261594002169	nudix motif; other site
261594002170	Nitric oxide reductase activation protein [Inorganic ion transport and metabolism]; Region: NorD; COG4548
261594002171	norD type: Denitrifying bacteria contain both membrane bound and periplasmic nitrate reductases. Denitrification plays a major role  in completing the nitrogen cycle by converting nitrate or nitrite to nitrogen gas. The pathway for microbial...; Region: vWA_norD_type; cd01454
261594002172	metal ion-dependent adhesion site (MIDAS); other site
261594002173	MoxR-like ATPases [General function prediction only]; Region: COG0714
261594002174	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
261594002175	Walker A motif; other site
261594002176	ATP binding site [chemical binding]; other site
261594002177	Walker B motif; other site
261594002178	arginine finger; other site
261594002179	cardiolipin synthetase; Reviewed; Region: PRK12452
261594002180	Catalytic domain, repeat 1, of bacterial cardiolipin synthase and similar proteins; Region: PLDc_CLS_1; cd09110
261594002181	putative active site [active]
261594002182	catalytic site [active]
261594002183	catalytic domain repeat 2 of bacterial cardiolipin synthase and similar proteins; Region: PLDc_CLS_2; cd09112
261594002184	putative active site [active]
261594002185	catalytic site [active]
261594002186	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
261594002187	PAS domain; Region: PAS_9; pfam13426
261594002188	putative active site [active]
261594002189	heme pocket [chemical binding]; other site
261594002190	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
261594002191	metal binding site [ion binding]; metal-binding site
261594002192	active site
261594002193	I-site; other site
261594002194	EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2).  The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cd01948
261594002195	Amino acid permease; Region: AA_permease_2; pfam13520
261594002196	Spore germination protein; Region: Spore_permease; cl17796
261594002197	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
261594002198	DNA-binding site [nucleotide binding]; DNA binding site
261594002199	trehalose operon repressor, B. subtilis-type; Region: trehalos_R_Bsub; TIGR02404
261594002200	UTRA domain; Region: UTRA; pfam07702
261594002201	PTS system, trehalose-specific IIBC component; Region: PTS-IIBC-Tre; TIGR01992
261594002202	PTS_IIB, PTS system, glucose/sucrose specific IIB subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This family...; Region: PTS_IIB_glc; cd00212
261594002203	active site turn [active]
261594002204	phosphorylation site [posttranslational modification]
261594002205	Phosphotransferase system IIC components, glucose/maltose/N-acetylglucosamine-specific [Carbohydrate transport and metabolism]; Region: PtsG; COG1263
261594002206	alpha,alpha-phosphotrehalase; Region: trehalose_treC; TIGR02403
261594002207	Alpha amylase catalytic domain found in Sucrose isomerases, oligo-1,6-glucosidase (also called isomaltase; sucrase-isomaltase; alpha-limit dextrinase), dextran glucosidase (also called glucan 1,6-alpha-glucosidase), and related proteins; Region: AmyAc_SI_OligoGlu_DGase; cd11333
261594002208	Ca binding site [ion binding]; other site
261594002209	active site
261594002210	catalytic site [active]
261594002211	germination protein, Ger(x)C family; Region: spore_ger_x_C; TIGR02887
261594002212	Spore germination B3/ GerAC like, C-terminal; Region: Spore_GerAC; pfam05504
261594002213	Spore germination protein; Region: Spore_permease; cl17796
261594002214	Bacillus/Clostridium GerA spore germination protein; Region: GerA; pfam03323
261594002215	CAAX protease self-immunity; Region: Abi; pfam02517
261594002216	Aminoglycoside 3'-phosphotransferase (APH) and Choline Kinase (ChoK) family. The APH/ChoK family is part of a larger superfamily that includes the catalytic domains of other kinases, such as the typical serine/threonine/tyrosine protein kinases (PKs)...; Region: APH_ChoK_like; cl17270
261594002217	active site
261594002218	ATP binding site [chemical binding]; other site
261594002219	substrate binding site [chemical binding]; other site
261594002220	Na+/alanine symporter [Amino acid transport and metabolism]; Region: AlsT; COG1115
261594002221	Sodium:alanine symporter family; Region: Na_Ala_symp; pfam01235
261594002222	ABC-type polar amino acid transport system, ATPase component [Amino acid transport and metabolism]; Region: GlnQ; COG1126
261594002223	ATP-binding cassette domain of the histidine and glutamine transporters; Region: ABC_HisP_GlnQ; cd03262
261594002224	Walker A/P-loop; other site
261594002225	ATP binding site [chemical binding]; other site
261594002226	Q-loop/lid; other site
261594002227	ABC transporter signature motif; other site
261594002228	Walker B; other site
261594002229	D-loop; other site
261594002230	H-loop/switch region; other site
261594002231	Bacterial extracellular solute-binding proteins, family 3; Region: SBP_bac_3; pfam00497
261594002232	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
261594002233	substrate binding pocket [chemical binding]; other site
261594002234	membrane-bound complex binding site; other site
261594002235	hinge residues; other site
261594002236	ABC-type arginine transport system, permease component [Amino acid transport and metabolism]; Region: ArtQ; COG4215
261594002237	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
261594002238	dimer interface [polypeptide binding]; other site
261594002239	conserved gate region; other site
261594002240	putative PBP binding loops; other site
261594002241	ABC-ATPase subunit interface; other site
261594002242	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
261594002243	dimer interface [polypeptide binding]; other site
261594002244	conserved gate region; other site
261594002245	putative PBP binding loops; other site
261594002246	ABC-ATPase subunit interface; other site
261594002247	S-methylmethionine transporter; Provisional; Region: PRK11387
261594002248	OsmC-like protein; Region: OsmC; pfam02566
261594002249	Diadenosine tetraphosphate (Ap4A) hydrolase and other HIT family hydrolases [Nucleotide transport and metabolism / Carbohydrate transport and metabolism / General function prediction only]; Region: Hit; COG0537
261594002250	nucleotide binding site/active site [active]
261594002251	HIT family signature motif; other site
261594002252	catalytic residue [active]
261594002253	RNA polymerase sigma factor; Provisional; Region: PRK12542
261594002254	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
261594002255	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
261594002256	DNA binding residues [nucleotide binding]
261594002257	Domain of unknown function (DUF4367); Region: DUF4367; pfam14285
261594002258	Predicted transcriptional regulator [Transcription]; Region: COG2378
261594002259	HTH domain; Region: HTH_11; pfam08279
261594002260	WYL domain; Region: WYL; pfam13280
261594002261	Dihydrofolate reductase [Coenzyme metabolism]; Region: FolA; COG0262
261594002262	RibD C-terminal domain; Region: RibD_C; cl17279
261594002263	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
261594002264	dimerization interface [polypeptide binding]; other site
261594002265	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
261594002266	dimer interface [polypeptide binding]; other site
261594002267	phosphorylation site [posttranslational modification]
261594002268	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594002269	ATP binding site [chemical binding]; other site
261594002270	Mg2+ binding site [ion binding]; other site
261594002271	G-X-G motif; other site
261594002272	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
261594002273	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594002274	active site
261594002275	phosphorylation site [posttranslational modification]
261594002276	intermolecular recognition site; other site
261594002277	dimerization interface [polypeptide binding]; other site
261594002278	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
261594002279	DNA binding site [nucleotide binding]
261594002280	Sulfate permease and related transporters (MFS superfamily) [Inorganic ion transport and metabolism]; Region: SUL1; COG0659
261594002281	Sulfate transporter N-terminal domain with GLY motif; Region: Sulfate_tra_GLY; pfam13792
261594002282	Sulfate transporter family; Region: Sulfate_transp; pfam00916
261594002283	Sulphate Transporter and Anti-Sigma factor antagonist domain of SulP-like sulfate transporters, plays a role in the function and regulation of the transport activity, proposed general NTP binding function; Region: STAS_SulP_like_sulfate_transporter; cd07042
261594002284	Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293
261594002285	Ligand Binding Site [chemical binding]; other site
261594002286	Protein of unknown function (DUF4027); Region: DUF4027; pfam13219
261594002287	The substrate binding component of an ABC-type lactococcal OppA-like transport system contains; Region: PBP2_Lactococcal_OppA_like; cd08510
261594002288	Bacterial extracellular solute-binding proteins, family 5 Middle; Region: SBP_bac_5; pfam00496
261594002289	peptide binding site [polypeptide binding]; other site
261594002290	nickel ABC transporter, permease subunit NikC; Region: nickel_nikC; TIGR02790
261594002291	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
261594002292	dimer interface [polypeptide binding]; other site
261594002293	conserved gate region; other site
261594002294	putative PBP binding loops; other site
261594002295	ABC-ATPase subunit interface; other site
261594002296	ABC-type dipeptide/oligopeptide/nickel transport systems, permease components [Amino acid transport and metabolism / Inorganic ion transport and metabolism]; Region: DppB; COG0601
261594002297	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
261594002298	putative PBP binding loops; other site
261594002299	ABC-ATPase subunit interface; other site
261594002300	ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component [Amino acid transport and metabolism / Inorganic ion transport and metabolism]; Region: DppF; COG1124
261594002301	ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257
261594002302	Walker A/P-loop; other site
261594002303	ATP binding site [chemical binding]; other site
261594002304	Q-loop/lid; other site
261594002305	ABC transporter signature motif; other site
261594002306	Walker B; other site
261594002307	D-loop; other site
261594002308	H-loop/switch region; other site
261594002309	Oligopeptide/dipeptide transporter, C-terminal region; Region: oligo_HPY; pfam08352
261594002310	ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component [Amino acid transport and metabolism / Inorganic ion transport and metabolism]; Region: DppD; COG0444
261594002311	ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257
261594002312	Walker A/P-loop; other site
261594002313	ATP binding site [chemical binding]; other site
261594002314	Q-loop/lid; other site
261594002315	ABC transporter signature motif; other site
261594002316	Walker B; other site
261594002317	D-loop; other site
261594002318	H-loop/switch region; other site
261594002319	Oligopeptide/dipeptide transporter, C-terminal region; Region: oligo_HPY; cl07097
261594002320	sn-glycerol-3-phosphate transporter; Provisional; Region: glpT; PRK11273
261594002321	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594002322	putative substrate translocation pore; other site
261594002323	helix_turn_helix multiple antibiotic resistance protein; Region: HTH_MARR; smart00347
261594002324	MarR family; Region: MarR; pfam01047
261594002325	Transcriptional regulators [Transcription]; Region: PurR; COG1609
261594002326	Helix-turn-helix (HTH) DNA binding domain of the LacI family of transcriptional regulators; Region: HTH_LacI; cd01392
261594002327	DNA binding site [nucleotide binding]
261594002328	domain linker motif; other site
261594002329	Ligand binding domain of the lacI-like transcription regulator from a novel metal-reducing bacterium Alkaliphilus Metalliredigens (strain Qymf) and its close homologs; Region: PBP1_Qymf_like; cd06291
261594002330	dimerization interface [polypeptide binding]; other site
261594002331	ligand binding site [chemical binding]; other site
261594002332	sodium binding site [ion binding]; other site
261594002333	Sugar kinases, ribokinase family [Carbohydrate transport and metabolism]; Region: RbsK; COG0524
261594002334	Ribokinase catalyses the phosphorylation of ribose to ribose-5-phosphate using ATP. This reaction is the first step in the ribose metabolism. It traps ribose within the cell after uptake and also prepares the sugar for use in the synthesis of nucleotides...; Region: ribokinase; cd01174
261594002335	substrate binding site [chemical binding]; other site
261594002336	dimer interface [polypeptide binding]; other site
261594002337	ATP binding site [chemical binding]; other site
261594002338	D-ribose pyranase; Provisional; Region: PRK11797
261594002339	ABC-type sugar transport system, ATPase component [Carbohydrate transport and metabolism]; Region: MglA; COG1129
261594002340	First domain of the ATP-binding cassette component of monosaccharide transport system; Region: ABC_Carb_Monos_I; cd03216
261594002341	Walker A/P-loop; other site
261594002342	ATP binding site [chemical binding]; other site
261594002343	Q-loop/lid; other site
261594002344	ABC transporter signature motif; other site
261594002345	Walker B; other site
261594002346	D-loop; other site
261594002347	H-loop/switch region; other site
261594002348	Second domain of the ATP-binding cassette component of monosaccharide transport system; Region: ABC_Carb_Monos_II; cd03215
261594002349	Branched-chain amino acid transport system / permease component; Region: BPD_transp_2; pfam02653
261594002350	Transmembrane subunit (TM) of Escherichia coli AraH and related proteins. E. coli AraH is the TM of a Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporter involved in the uptake of the monosaccharide arabinose. This group...; Region: TM_PBP1_transp_AraH_like; cd06579
261594002351	TM-ABC transporter signature motif; other site
261594002352	D-ribose transporter subunit RbsB; Provisional; Region: PRK10653
261594002353	Periplasmic sugar-binding domain of the thermophilic Thermoanaerobacter tengcongensis ribose binding protein (ttRBP) and its mesophilic homologs; Region: PBP1_ribose_binding; cd06323
261594002354	ligand binding site [chemical binding]; other site
261594002355	dimerization interface [polypeptide binding]; other site
261594002356	Transaldolase-like fructose-6-phosphate aldolases (FSA) found in bacteria and archaea; Region: Transaldolase_FSA; cd00956
261594002357	active site
261594002358	intersubunit interactions; other site
261594002359	catalytic residue [active]
261594002360	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4412
261594002361	Immune inhibitor A peptidase M6; Region: Peptidase_M6; pfam05547
261594002362	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594002363	Major Facilitator Superfamily; Region: MFS_1; pfam07690
261594002364	putative substrate translocation pore; other site
261594002365	Threonine dehydrogenase and related Zn-dependent dehydrogenases [Amino acid transport and metabolism / General function prediction only]; Region: Tdh; COG1063
261594002366	(2R,3R)-2,3-butanediol dehydrogenase; Region: butanediol_DH_like; cd08233
261594002367	putative NAD(P) binding site [chemical binding]; other site
261594002368	catalytic Zn binding site [ion binding]; other site
261594002369	Ion channel; Region: Ion_trans_2; pfam07885
261594002370	Zinc dependent phospholipase C (alpha toxin); Region: Zn_dep_PLPC; cd11009
261594002371	Zn binding site [ion binding]; other site
261594002372	Neutral sphingomyelinases (nSMase) catalyze the hydrolysis of sphingomyelin in biological membranes to ceramide and phosphorylcholine; Region: nSMase; cd09078
261594002373	putative catalytic site [active]
261594002374	metal binding site A [ion binding]; metal-binding site
261594002375	phosphate binding site [ion binding]; other site
261594002376	metal binding site C [ion binding]; metal-binding site
261594002377	metal binding site B [ion binding]; metal-binding site
261594002378	Type III Pyridoxal 5-phosphate (PLP)-Dependent Enzymes Similar to D-Serine Dehydratase and D-Threonine Aldolase, Unknown Group 2; Region: PLPDE_III_DSD_D-TA_like_2; cd06813
261594002379	Predicted amino acid aldolase or racemase [Amino acid transport and metabolism]; Region: COG3616
261594002380	dimer interface [polypeptide binding]; other site
261594002381	active site
261594002382	pyridoxal 5'-phosphate (PLP) binding site [chemical binding]; other site
261594002383	substrate binding site [chemical binding]; other site
261594002384	catalytic residue [active]
261594002385	FAD-linked oxidoreductase; Region: bact_FAD_ox; TIGR01679
261594002386	FAD binding domain; Region: FAD_binding_4; pfam01565
261594002387	D-arabinono-1,4-lactone oxidase; Region: ALO; pfam04030
261594002388	VanZ like family; Region: VanZ; pfam04892
261594002389	RDD family; Region: RDD; pfam06271
261594002390	undecaprenyl pyrophosphate phosphatase; Reviewed; Region: PRK12554
261594002391	Methyl-accepting chemotaxis-like domains (chemotaxis sensory transducer); Region: MA; smart00283
261594002392	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
261594002393	dimer interface [polypeptide binding]; other site
261594002394	putative CheW interface [polypeptide binding]; other site
261594002395	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3883
261594002396	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3584
261594002397	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
261594002398	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
261594002399	non-specific DNA binding site [nucleotide binding]; other site
261594002400	salt bridge; other site
261594002401	sequence-specific DNA binding site [nucleotide binding]; other site
261594002402	Sortase A (SrtA) or subfamily-1 sortases are cysteine transpeptidases found in gram-positive bacteria that anchor surface proteins to peptidoglycans of the bacterial cell wall envelope. They do so by catalyzing a transpeptidation reaction in which the...; Region: Sortase_A_1; cd06165
261594002403	active site
261594002404	catalytic site [active]
261594002405	Dipeptide/tripeptide permease [Amino acid transport and metabolism]; Region: PTR2; COG3104
261594002406	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594002407	putative substrate translocation pore; other site
261594002408	Branched-chain amino acid transport protein; Region: Branch_AA_trans; pfam05525
261594002409	Ribosomal L29 protein/HIP.  L29 is a protein of the large ribosomal Subunit. A homolog, called heparin/heparan sulfate interacting protein (HIP), has also been identified in mammals.  L29 is located on the surface of the large ribosomal subunit, where it...; Region: Ribosomal_L29_HIP; cl09943
261594002410	Predicted membrane protein (DUF2339); Region: DUF2339; pfam10101
261594002411	ABC-type uncharacterized transport system; Region: ABC_transp_aux; pfam09822
261594002412	Gamma-aminobutyrate permease and related permeases [Amino acid transport and metabolism]; Region: AnsP; COG1113
261594002413	Xanthine/uracil/vitamin C permease [Nucleotide transport and    metabolism]; Region: COG2252
261594002414	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
261594002415	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
261594002416	non-specific DNA binding site [nucleotide binding]; other site
261594002417	salt bridge; other site
261594002418	sequence-specific DNA binding site [nucleotide binding]; other site
261594002419	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594002420	Coenzyme A binding pocket [chemical binding]; other site
261594002421	Protein of unknown function (DUF4022); Region: DUF4022; pfam13214
261594002422	Kef-type K+ transport systems, membrane components [Inorganic ion transport and metabolism]; Region: KefB; COG0475
261594002423	Sodium/hydrogen exchanger family; Region: Na_H_Exchanger; pfam00999
261594002424	K+ transport systems, NAD-binding component [Inorganic ion transport and metabolism]; Region: TrkA; COG0569
261594002425	TrkA-N domain; Region: TrkA_N; pfam02254
261594002426	TrkA-C domain; Region: TrkA_C; pfam02080
261594002427	cytochrome aa3 quinol oxidase, subunit IV; Region: QoxD; TIGR02901
261594002428	Ubiquinol oxidase subunit III subfamily. Ubiquinol oxidase, the terminal oxidase in the respiratory chains of aerobic bacteria, is a multi-chain transmembrane protein located in the cell membrane.  It catalyzes the reduction of O2 and simultaneously...; Region: Ubiquinol_oxidase_III; cd02863
261594002429	Subunit I/III interface [polypeptide binding]; other site
261594002430	Subunit III/IV interface [polypeptide binding]; other site
261594002431	Heme/copper-type cytochrome/quinol oxidases, subunit 1 [Energy production and conversion]; Region: CyoB; COG0843
261594002432	Ubiquinol oxidase subunit I.  Ubiquinol oxidase, the terminal oxidase in the respiratory chains of aerobic bacteria, is a multi-chain transmembrane protein located in the cell membrane.  It catalyzes the reduction of O2 and simultaneously pumps protons...; Region: Ubiquinol_Oxidase_I; cd01662
261594002433	D-pathway; other site
261594002434	Putative ubiquinol binding site [chemical binding]; other site
261594002435	Low-spin heme (heme b) binding site [chemical binding]; other site
261594002436	Putative water exit pathway; other site
261594002437	Binuclear center (heme o3/CuB) [ion binding]; other site
261594002438	K-pathway; other site
261594002439	Putative proton exit pathway; other site
261594002440	cytochrome aa3 quinol oxidase, subunit II; Region: QOXA; TIGR01432
261594002441	Cytochrome C oxidase subunit II, transmembrane domain; Region: COX2_TM; pfam02790
261594002442	S-methylmethionine transporter; Provisional; Region: PRK11387
261594002443	A sub-family of peptidase family C39. Peptidase family C39 mostly contains bacteriocin-processing endopeptidases from bacteria. The cysteine peptidases in family C39 cleave the "double-glycine" leader peptides from the precursors of various...; Region: Peptidase_C39A; cd02549
261594002444	putative active site [active]
261594002445	Metal-dependent amidase/aminoacylase/carboxypeptidase [General function prediction only]; Region: AbgB; COG1473
261594002446	M20 Peptidase Aminoacylase 1 family; Region: M20_Acy1; cd03886
261594002447	metal binding site [ion binding]; metal-binding site
261594002448	dimer interface [polypeptide binding]; other site
261594002449	Protein of unknown function (DUF3311); Region: DUF3311; pfam11755
261594002450	Solute carrier 5 family, sodium/glucose transporters and related proteins; solute-binding domain; Region: SLC5sbd; cd10322
261594002451	Predicted symporter [General function prediction only]; Region: DhlC; COG4147
261594002452	Na binding site [ion binding]; other site
261594002453	Bacillus/Clostridium GerA spore germination protein; Region: GerA; pfam03323
261594002454	spore germination protein (amino acid permease); Region: 2A0309; TIGR00912
261594002455	germination protein, Ger(x)C family; Region: spore_ger_x_C; TIGR02887
261594002456	Spore germination B3/ GerAC like, C-terminal; Region: Spore_GerAC; pfam05504
261594002457	FeoA domain; Region: FeoA; pfam04023
261594002458	phosphate binding protein; Region: ptsS_2; TIGR02136
261594002459	Bacterial extracellular solute-binding protein; Region: SBP_bac_11; pfam13531
261594002460	ABC-type phosphate transport system, permease component [Inorganic ion transport and metabolism]; Region: PstC; COG0573
261594002461	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
261594002462	dimer interface [polypeptide binding]; other site
261594002463	conserved gate region; other site
261594002464	putative PBP binding loops; other site
261594002465	ABC-ATPase subunit interface; other site
261594002466	ABC-type phosphate transport system, permease component [Inorganic ion transport and metabolism]; Region: PstA; COG0581
261594002467	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
261594002468	dimer interface [polypeptide binding]; other site
261594002469	conserved gate region; other site
261594002470	putative PBP binding loops; other site
261594002471	ABC-ATPase subunit interface; other site
261594002472	AAA domain; Region: AAA_33; pfam13671
261594002473	Nucleoside/nucleotide kinase (NK) is a protein superfamily consisting of multiple families of enzymes that share structural similarity and are functionally related to the catalysis of the reversible phosphate group transfer from nucleoside triphosphates...; Region: NK; cl17190
261594002474	active site
261594002475	Cation/multidrug efflux pump [Defense mechanisms]; Region: AcrB; COG0841
261594002476	FOG: CBS domain [General function prediction only]; Region: COG0517
261594002477	The CBS domain, named after human CBS, is a small domain originally identified in cystathionine beta-synthase and is subsequently found in a wide range of different proteins. CBS domains usually occur in tandem repeats. They associate to form a so-called...; Region: CBS_pair_9; cd04622
261594002478	Domain of unknown function (DUF3960); Region: DUF3960; pfam13142
261594002479	Protein of unknown function (DUF3965); Region: DUF3965; pfam13112
261594002480	Bacterial SH3 domain; Region: SH3_3; pfam08239
261594002481	Bacterial SH3 domain; Region: SH3_3; pfam08239
261594002482	Bacterial SH3 domain; Region: SH3_3; pfam08239
261594002483	Membrane proteins related to metalloendopeptidases [Cell envelope biogenesis, outer membrane]; Region: NlpD; COG0739
261594002484	Peptidase family M23; Region: Peptidase_M23; pfam01551
261594002485	Putative transcription activator [Transcription]; Region: TenA; COG0819
261594002486	ABC-type nitrate/sulfonate/bicarbonate transport system, ATPase component [Inorganic ion transport and metabolism]; Region: TauB; COG1116
261594002487	ATP-binding cassette domain of the nitrate and sulfonate transporters; Region: ABC_NrtD_SsuB_transporters; cd03293
261594002488	Walker A/P-loop; other site
261594002489	ATP binding site [chemical binding]; other site
261594002490	Q-loop/lid; other site
261594002491	ABC transporter signature motif; other site
261594002492	Walker B; other site
261594002493	D-loop; other site
261594002494	H-loop/switch region; other site
261594002495	ABC-type nitrate/sulfonate/bicarbonate transport system, permease component [Inorganic ion transport and metabolism]; Region: TauC; COG0600
261594002496	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
261594002497	dimer interface [polypeptide binding]; other site
261594002498	conserved gate region; other site
261594002499	putative PBP binding loops; other site
261594002500	ABC-ATPase subunit interface; other site
261594002501	NMT1/THI5 like; Region: NMT1; pfam09084
261594002502	TRAP transporter solute receptor, TAXI family; Region: TRAP_TAXI; TIGR02122
261594002503	Thiamine monophosphate synthase (TMP synthase)/TenI. TMP synthase catalyzes an important step in the thiamine biosynthesis pathway, the substitution of the pyrophosphate of 2-methyl-4-amino-5- hydroxymethylpyrimidine pyrophosphate by 4-methyl-5-; Region: TMP_TenI; cd00564
261594002504	thiamine phosphate binding site [chemical binding]; other site
261594002505	active site
261594002506	pyrophosphate binding site [ion binding]; other site
261594002507	glycine oxidase ThiO; Region: thiamin_ThiO; TIGR02352
261594002508	putative aminophosphonate oxidoreductase; Region: Phn_aa_oxid; TIGR03329
261594002509	ThiaminS ubiquitin-like sulfur carrier protein; Region: ThiS; cd00565
261594002510	thiS-thiF/thiG interaction site; other site
261594002511	Thiazole synthase (ThiG) is the tetrameric enzyme that is involved in the formation of the thiazole moiety of thiamin pyrophosphate, an essential ubiquitous cofactor that plays an important role in carbohydrate and amino acid metabolism. ThiG catalyzes...; Region: ThiG; cd04728
261594002512	ThiS interaction site; other site
261594002513	putative active site [active]
261594002514	tetramer interface [polypeptide binding]; other site
261594002515	thiamine/molybdopterin biosynthesis ThiF/MoeB-like protein; Validated; Region: PRK07688
261594002516	ThiF_MoeB_HesA. Family of E1-like enzymes involved in molybdopterin and thiamine biosynthesis family. The common reaction mechanism catalyzed by MoeB and ThiF, like other E1 enzymes, begins with a nucleophilic attack of the C-terminal carboxylate of MoaD...; Region: ThiF_MoeB_HesA_family; cd00757
261594002517	ATP binding site [chemical binding]; other site
261594002518	substrate interface [chemical binding]; other site
261594002519	4-amino-5-hydroxymethyl-2-methyl-pyrimidine phosphate kinase (HMPP-kinase) catalyzes two consecutive phosphorylation steps in the thiamine phosphate biosynthesis pathway, leading to the synthesis of vitamin B1. The first step is the phosphorylation of...; Region: HMPP_kinase; cd01169
261594002520	dimer interface [polypeptide binding]; other site
261594002521	substrate binding site [chemical binding]; other site
261594002522	ATP binding site [chemical binding]; other site
261594002523	potassium-transporting ATPase subunit A; Provisional; Region: PRK05482
261594002524	potassium-transporting ATPase subunit B; Provisional; Region: PRK01122
261594002525	E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122
261594002526	Soluble P-type ATPase [General function prediction only]; Region: COG4087
261594002527	potassium-transporting ATPase subunit C; Provisional; Region: PRK13997
261594002528	Osmosensitive K+ channel His kinase sensor domain; Region: KdpD; pfam02702
261594002529	USP domain is located between the N-terminal sensor domain and C-terminal catalytic domain of this Osmosensitive K+ channel histidine kinase family. The family of KdpD sensor kinase proteins regulates the kdpFABC operon responsible for potassium...; Region: USP_OKCHK; cd01987
261594002530	Ligand Binding Site [chemical binding]; other site
261594002531	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594002532	Major Facilitator Superfamily; Region: MFS_1; pfam07690
261594002533	putative substrate translocation pore; other site
261594002534	helix_turn_helix multiple antibiotic resistance protein; Region: HTH_MARR; smart00347
261594002535	MarR family; Region: MarR; pfam01047
261594002536	Predicted esterase of the alpha-beta hydrolase superfamily [General function prediction only]; Region: COG4667
261594002537	Hypothetical patatin similar to yjju protein of Escherichia coli; Region: Pat_hypo_Ecoli_yjju_like; cd07208
261594002538	active site
261594002539	nucleophile elbow; other site
261594002540	Xanthine/uracil/vitamin C permease [Nucleotide transport and    metabolism]; Region: COG2252
261594002541	short chain dehydrogenase; Provisional; Region: PRK06701
261594002542	classical (c) SDR, subgroup 1; Region: SDR_c1; cd05355
261594002543	NAD binding site [chemical binding]; other site
261594002544	metal binding site [ion binding]; metal-binding site
261594002545	active site
261594002546	Sugar kinases, ribokinase family [Carbohydrate transport and metabolism]; Region: RbsK; COG0524
261594002547	Fructokinases (FRKs) mainly from bacteria and plants are enzymes with high specificity for fructose, as are all FRKs, but they catalyzes the conversion of fructose to fructose-6-phosphate, which is an entry point into glycolysis via conversion into...; Region: bac_FRK; cd01167
261594002548	putative substrate binding site [chemical binding]; other site
261594002549	putative ATP binding site [chemical binding]; other site
261594002550	sucrose-6-phosphate hydrolase; Region: scrB_fam; TIGR01322
261594002551	Glycosyl hydrolase family 32, beta-fructosidases; Region: GH32_B_Fructosidase; cd08996
261594002552	substrate binding [chemical binding]; other site
261594002553	active site
261594002554	Glycosyl hydrolases family 32 C terminal; Region: Glyco_hydro_32C; pfam08244
261594002555	PTS system, sucrose-specific IIBC component; Region: PTS-II-BC-sucr; TIGR01996
261594002556	PTS_IIB, PTS system, glucose/sucrose specific IIB subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This family...; Region: PTS_IIB_glc; cd00212
261594002557	active site turn [active]
261594002558	phosphorylation site [posttranslational modification]
261594002559	Phosphotransferase system IIC components, glucose/maltose/N-acetylglucosamine-specific [Carbohydrate transport and metabolism]; Region: PtsG; COG1263
261594002560	Transcriptional regulators [Transcription]; Region: PurR; COG1609
261594002561	Helix-turn-helix (HTH) DNA binding domain of the LacI family of transcriptional regulators; Region: HTH_LacI; cd01392
261594002562	DNA binding site [nucleotide binding]
261594002563	domain linker motif; other site
261594002564	Ligand-binding domain of DNA transcription repressor specific for trehalose (TreR) which is a member of the LacI-GalR family of bacterial transcription regulators; Region: PBP1_TreR_like; cd01542
261594002565	dimerization interface [polypeptide binding]; other site
261594002566	ligand binding site [chemical binding]; other site
261594002567	Domain of Unknown Function (DUF1540); Region: DUF1540; pfam07561
261594002568	TRX family; composed of two groups: Group I, which includes proteins that exclusively encode a TRX domain; and Group II, which are composed of fusion proteins of TRX and additional domains. Group I TRX is a small ancient protein that alter the redox...; Region: TRX_family; cd02947
261594002569	catalytic residues [active]
261594002570	putative disulfide oxidoreductase; Provisional; Region: PRK03113
261594002571	YhdB-like protein; Region: YhdB; pfam14148
261594002572	Protein of unknown function with PCYCGC motif; Region: PCYCGC; pfam13798
261594002573	germination protein, Ger(x)C family; Region: spore_ger_x_C; TIGR02887
261594002574	Spore germination B3/ GerAC like, C-terminal; Region: Spore_GerAC; pfam05504
261594002575	Bacillus/Clostridium GerA spore germination protein; Region: GerA; pfam03323
261594002576	Nitroreductase-like family which includes NADH oxidase and arsenite oxidiase. NADH oxidase catalyses the oxidation of NAD(P)H and accepts a wide broad range of compounds as electron acceptors, such as nitrocompound. Arsenite oxidase in a...; Region: Arsenite_oxidase; cd02135
261594002577	putative FMN binding site [chemical binding]; other site
261594002578	Uncharacterized conserved protein [Function unknown]; Region: SpoVR; COG2719
261594002579	SpoVR like protein; Region: SpoVR; pfam04293
261594002580	Neutral/alkaline non-lysosomal ceramidase; Region: Ceramidase_alk; cl04712
261594002581	Neutral/alkaline non-lysosomal ceramidase; Region: Ceramidase_alk; cl04712
261594002582	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
261594002583	putative DNA binding site [nucleotide binding]; other site
261594002584	putative Zn2+ binding site [ion binding]; other site
261594002585	helix_turn_helix multiple antibiotic resistance protein; Region: HTH_MARR; smart00347
261594002586	Protein of unknown function (DUF3238); Region: DUF3238; pfam11579
261594002587	Protein of unknown function (DUF3238); Region: DUF3238; pfam11579
261594002588	CoA-disulfide reductase; Region: CoA_CoA_reduc; TIGR03385
261594002589	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
261594002590	Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain; Region: Pyr_redox_dim; pfam02852
261594002591	Member of the Rhodanese Homology Domain superfamily. Included in this CD are the Lactococcus lactis NADH oxidase, Bacillus cereus NADH dehydrogenase, and Bacteroides thetaiotaomicron pyridine nucleotide-disulphide oxidoreductase, and similar...; Region: RHOD_Pyr_redox; cd01524
261594002592	active site residue [active]
261594002593	Uncharacterized protein YrkD from Bacillus subtilis and related domains; this domain superfamily was previously known as part of DUF156; Region: BsYrkD-like_DUF156; cd10155
261594002594	putative homodimer interface [polypeptide binding]; other site
261594002595	putative homotetramer interface [polypeptide binding]; other site
261594002596	putative metal binding site [ion binding]; other site
261594002597	putative homodimer-homodimer interface [polypeptide binding]; other site
261594002598	putative allosteric switch controlling residues; other site
261594002599	SirA, YedF, and YeeD. Two-layered alpha/beta sandwich domain.  SirA (also known as UvrY,  and YhhP) belongs to a family of bacterial two-component response regulators that controls secondary metabolism and virulence. The other member of this...; Region: SirA_YedF_YeeD; cd00291
261594002600	CPxP  motif; other site
261594002601	Rhodanese Homology Domain (RHOD); an alpha beta fold domain found duplicated in the rhodanese protein. The cysteine containing enzymatically active version of the domain is also found in the Cdc25 class of protein phosphatases and a variety of proteins...; Region: RHOD; cd00158
261594002602	active site residue [active]
261594002603	Member of the Rhodanese Homology Domain superfamily. This CD includes predicted proteins with rhodanese-like domains found N-terminal of the metallo-beta-lactamase domain; Region: RHOD_Lact_B; cd01523
261594002604	active site residue [active]
261594002605	Metallo-beta-lactamase superfamily; Region: Lactamase_B; smart00849
261594002606	SirA, YedF, and YeeD. Two-layered alpha/beta sandwich domain.  SirA (also known as UvrY,  and YhhP) belongs to a family of bacterial two-component response regulators that controls secondary metabolism and virulence. The other member of this...; Region: SirA_YedF_YeeD; cd00291
261594002607	CPxP  motif; other site
261594002608	Rhodanese Homology Domain (RHOD); an alpha beta fold domain found duplicated in the rhodanese protein. The cysteine containing enzymatically active version of the domain is also found in the Cdc25 class of protein phosphatases and a variety of proteins...; Region: RHOD; cd00158
261594002609	active site residue [active]
261594002610	DsrE/DsrF/DrsH-like family; Region: DrsE_2; pfam13686
261594002611	Sulfite exporter TauE/SafE; Region: TauE; pfam01925
261594002612	Cell envelope-related transcriptional attenuator domain; Region: LytR_cpsA_psr; cl00581
261594002613	Yhdh and yhfp-like putative quinone oxidoreductases; Region: MDR_yhdh_yhfp; cd05280
261594002614	putative quinone oxidoreductase, YhdH/YhfP family; Region: oxido_YhdH; TIGR02823
261594002615	NADP binding site [chemical binding]; other site
261594002616	dimer interface [polypeptide binding]; other site
261594002617	Na+/phosphate symporter [Inorganic ion transport and metabolism]; Region: NptA; COG1283
261594002618	Na+/Pi-cotransporter; Region: Na_Pi_cotrans; pfam02690
261594002619	Na+/Pi-cotransporter; Region: Na_Pi_cotrans; pfam02690
261594002620	PhoU domain; Region: PhoU; pfam01895
261594002621	PhoU domain; Region: PhoU; pfam01895
261594002622	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594002623	Major Facilitator Superfamily; Region: MFS_1; pfam07690
261594002624	putative substrate translocation pore; other site
261594002625	Uncharacterized conserved protein [Function unknown]; Region: COG3589
261594002626	Bacterial protein of unknown function (DUF871); Region: DUF871; pfam05913
261594002627	Transcriptional antiterminator [Transcription]; Region: BglG; COG3711
261594002628	HTH domain; Region: HTH_11; pfam08279
261594002629	Mga helix-turn-helix domain; Region: Mga; pfam05043
261594002630	PRD domain; Region: PRD; pfam00874
261594002631	PRD domain; Region: PRD; pfam00874
261594002632	PTS_IIB_bgl_like: the PTS (phosphotransferase system) IIB domain of a family of sensory systems composed of a membrane-bound sugar-sensor (similar to BglF) and a transcription antiterminator (similar to BglG) which regulate expression of genes involved...; Region: PTS_IIB_bgl_like; cd05568
261594002633	active site
261594002634	P-loop; other site
261594002635	phosphorylation site [posttranslational modification]
261594002636	PTS_IIA, PTS system, fructose/mannitol specific IIA subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This...; Region: PTS_IIA_fru; cd00211
261594002637	active site
261594002638	phosphorylation site [posttranslational modification]
261594002639	PTS_IIA, PTS system, lactose/cellobiose specific IIA subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This...; Region: PTS_IIA_lac; cd00215
261594002640	active site
261594002641	methionine cluster; other site
261594002642	phosphorylation site [posttranslational modification]
261594002643	metal binding site [ion binding]; metal-binding site
261594002644	PTS_IIB_chitobiose_lichenan: subunit IIB of enzyme II (EII) of the N,N-diacetylchitobiose-specific and lichenan-specific phosphoenolpyruvate:carbohydrate phosphotransferase system (PTS). In these systems, EII is either a lichenan- or an N; Region: PTS_IIB_chitobiose_lichenan; cd05564
261594002645	active site
261594002646	P-loop; other site
261594002647	phosphorylation site [posttranslational modification]
261594002648	cellobiose phosphotransferase system IIC component; Reviewed; Region: celD; PRK09592
261594002649	Phosphotransferase system cellobiose-specific component IIC [Carbohydrate transport and metabolism]; Region: CelB; COG1455
261594002650	Uncharacterized conserved protein [Function unknown]; Region: COG3589
261594002651	Bacterial protein of unknown function (DUF871); Region: DUF871; pfam05913
261594002652	Bacterial SH3 domain; Region: SH3_3; pfam08239
261594002653	Bacterial SH3 domain; Region: SH3_3; pfam08239
261594002654	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3584
261594002655	MacB-like periplasmic core domain; Region: MacB_PCD; pfam12704
261594002656	ABC-type antimicrobial peptide transport system, permease component [Defense mechanisms]; Region: SalY; COG0577
261594002657	FtsX-like permease family; Region: FtsX; pfam02687
261594002658	ABC-type antimicrobial peptide transport system, ATPase component [Defense mechanisms]; Region: SalX; COG1136
261594002659	ATP-binding cassette domain of the transporters involved in export of lipoprotein and macrolide, and cell division protein; Region: ABC_MJ0796_LolCDE_FtsE; cd03255
261594002660	Walker A/P-loop; other site
261594002661	ATP binding site [chemical binding]; other site
261594002662	Q-loop/lid; other site
261594002663	ABC transporter signature motif; other site
261594002664	Walker B; other site
261594002665	D-loop; other site
261594002666	H-loop/switch region; other site
261594002667	RND family efflux transporter, MFP subunit; Region: RND_mfp; TIGR01730
261594002668	HlyD family secretion protein; Region: HlyD_3; pfam13437
261594002669	conserved hypothetical integral membrane protein TIGR02206; Region: intg_mem_TP0381
261594002670	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cl00427
261594002671	ABC-type dipeptide/oligopeptide/nickel transport systems, permease components [Amino acid transport and metabolism / Inorganic ion transport and metabolism]; Region: DppB; COG0601
261594002672	ABC-type dipeptide/oligopeptide/nickel transport systems, permease components [Amino acid transport and metabolism / Inorganic ion transport and metabolism]; Region: DppC; COG1173
261594002673	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
261594002674	dimer interface [polypeptide binding]; other site
261594002675	conserved gate region; other site
261594002676	ABC-ATPase subunit interface; other site
261594002677	Branched-chain amino acid transport protein; Region: Branch_AA_trans; pfam05525
261594002678	Manganese catalase, ferritin-like diiron-binding domain; Region: Mn_catalase; cd01051
261594002679	dimanganese center [ion binding]; other site
261594002680	CotJB protein; Region: CotJB; pfam12652
261594002681	Spore coat associated protein JA (CotJA); Region: CotJA; pfam11007
261594002682	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
261594002683	This domain superfamily is found in a variety of structurally related metalloproteins, including the type I extradiol dioxygenases, glyoxalase I and a group of antibiotic resistance proteins; Region: Glo_EDI_BRP_like; cl14632
261594002684	active site
261594002685	Domain of unknown function (DUF2935); Region: DUF2935; pfam11155
261594002686	Domain of unknown function (DUF2935); Region: DUF2935; pfam11155
261594002687	Ku protein, prokaryotic; Region: Ku_bact; TIGR02772
261594002688	Ku-core domain, Ku-like subfamily; composed of prokaryotic homologs of the eukaryotic DNA binding protein Ku. The alignment includes the core domain shared by the prokaryotic YkoV-like proteins and the eukaryotic Ku70 and Ku80. The prokaryotic Ku...; Region: KU_like; cd00789
261594002689	putative DNA binding site [nucleotide binding]; other site
261594002690	putative homodimer interface [polypeptide binding]; other site
261594002691	Uncharacterized conserved protein [Function unknown]; Region: COG3339
261594002692	Uncharacterized membrane-associated protein [Function unknown]; Region: DedA; COG0586
261594002693	SNARE associated Golgi protein; Region: SNARE_assoc; pfam09335
261594002694	Protein of unknown function (DUF3992); Region: DUF3992; pfam13157
261594002695	Protein of unknown function (DUF3992); Region: DUF3992; pfam13157
261594002696	Calcineurin-like phosphoesterase; Region: Metallophos; pfam00149
261594002697	metallophosphatase superfamily, metallophosphatase domain; Region: MPP_superfamily; cl13995
261594002698	active site
261594002699	metal binding site [ion binding]; metal-binding site
261594002700	Fibronectin type 3 domain; One of three types of internal repeats found in the plasma protein fibronectin. Its tenth fibronectin type III repeat contains an RGD cell recognition sequence in a flexible loop between 2 strands. Approximately 2% of all...; Region: FN3; cd00063
261594002701	Interdomain contacts; other site
261594002702	Cytokine receptor motif; other site
261594002703	Concanavalin A-like lectin/glucanases superfamily; Region: Laminin_G_3; pfam13385
261594002704	amino acid transporter; Region: 2A0306; TIGR00909
261594002705	C-terminus of AA_permease; Region: AA_permease_C; pfam13906
261594002706	Kef-type K+ transport systems, membrane components [Inorganic ion transport and metabolism]; Region: KefB; COG0475
261594002707	Sodium/hydrogen exchanger family; Region: Na_H_Exchanger; pfam00999
261594002708	Transcriptional regulators [Transcription]; Region: RpiR; COG1737
261594002709	Helix-turn-helix domain, rpiR family; Region: HTH_6; pfam01418
261594002710	RpiR-like protein. RpiR contains a SIS (Sugar ISomerase) domain, which is found in many phosphosugar isomerases and phosphosugar binding proteins. In E. coli, rpiR negatively regulates the expression of rpiB gene. Both rpiB and rpiA are ribose phosphate...; Region: SIS_RpiR; cd05013
261594002711	putative active site [active]
261594002712	N-acetylmuramic acid-6-phosphate etherase; Reviewed; Region: murQ; PRK05441
261594002713	N-acetylmuramic acid 6-phosphate etherase. Members of this family contain the SIS (Sugar ISomerase) domain. The SIS domain is found in many phosphosugar isomerases and phosphosugar binding proteins. The bacterial cell wall sugar N-acetylmuramic acid...; Region: SIS_Etherase; cd05007
261594002714	putative active site [active]
261594002715	PTS_IIB, PTS system, glucose/sucrose specific IIB subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This family...; Region: PTS_IIB_glc; cd00212
261594002716	PTS system N-acetylmuramic acid transporter subunits EIIBC; Reviewed; Region: murP; PRK09586
261594002717	active site turn [active]
261594002718	phosphorylation site [posttranslational modification]
261594002719	Phosphotransferase system IIC components, glucose/maltose/N-acetylglucosamine-specific [Carbohydrate transport and metabolism]; Region: PtsG; COG1263
261594002720	Uncharacterized conserved protein [Function unknown]; Region: COG3589
261594002721	Bacterial protein of unknown function (DUF871); Region: DUF871; pfam05913
261594002722	DoxX; Region: DoxX; pfam07681
261594002723	Ketosteroid isomerase-related protein [General function prediction only]; Region: COG3631
261594002724	hypothetical protein; Provisional; Region: PRK06770
261594002725	Permeases of the drug/metabolite transporter (DMT) superfamily [Carbohydrate transport and metabolism / Amino acid transport and metabolism / General function prediction only]; Region: RhaT; COG0697
261594002726	EamA-like transporter family; Region: EamA; pfam00892
261594002727	EamA-like transporter family; Region: EamA; pfam00892
261594002728	Transcriptional regulators [Transcription]; Region: Lrp; COG1522
261594002729	Winged helix-turn-helix DNA-binding; Region: HTH_24; pfam13412
261594002730	AsnC family; Region: AsnC_trans_reg; pfam01037
261594002731	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594002732	Coenzyme A binding pocket [chemical binding]; other site
261594002733	Membrane transporters of cations and cationic drugs [Inorganic ion transport and metabolism]; Region: EmrE; COG2076
261594002734	Membrane transporters of cations and cationic drugs [Inorganic ion transport and metabolism]; Region: EmrE; COG2076
261594002735	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
261594002736	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
261594002737	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594002738	Major Facilitator Superfamily; Region: MFS_1; pfam07690
261594002739	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594002740	Predicted transcriptional regulators [Transcription]; Region: COG1733
261594002741	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
261594002742	putative DNA binding site [nucleotide binding]; other site
261594002743	putative Zn2+ binding site [ion binding]; other site
261594002744	SnoaL-like polyketide cyclase; Region: SnoaL; pfam07366
261594002745	NADPH-dependent FMN reductase; Region: FMN_red; pfam03358
261594002746	Flavodoxin-like fold; Region: Flavodoxin_2; pfam02525
261594002747	ABC-type uncharacterized transport system, periplasmic component [General function prediction only]; Region: COG4533
261594002748	Sugar transport-related sRNA regulator N-term; Region: SgrR_N; pfam12793
261594002749	The C-terminal solute-binding domain of DNA-binding transcriptional regulator SgrR is related to the ABC-type oligopeptide-binding proteins and contains the type 2 periplasmic-binding fold; Region: PBP2_SgrR_like; cd08507
261594002750	Major Facilitator Superfamily; Region: MFS_1; pfam07690
261594002751	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594002752	putative substrate translocation pore; other site
261594002753	intracellular protease, PfpI family; Region: PfpI; TIGR01382
261594002754	A type 1 glutamine amidotransferase (GATase1)-like domain found in PfpI from Pyrococcus furiosus; Region: GATase1_PfpI_like; cd03134
261594002755	proposed catalytic triad [active]
261594002756	conserved cys residue [active]
261594002757	Catalase [Inorganic ion transport and metabolism]; Region: KatE; COG0753
261594002758	Clade 2 of the heme-binding enzyme catalase; Region: catalase_clade_2; cd08155
261594002759	tetramer interface [polypeptide binding]; other site
261594002760	heme binding pocket [chemical binding]; other site
261594002761	Type 1 glutamine amidotransferase (GATase1)-like domain found in at the C-terminal of several large catalases; Region: GATase1_catalase; cd03132
261594002762	domain interactions; other site
261594002763	Bacterial ABC transporter protein EcsB; Region: EcsB; pfam05975
261594002764	arginine:agmatin antiporter; Provisional; Region: PRK10644
261594002765	Spore germination protein; Region: Spore_permease; cl17796
261594002766	glutamate racemase; Provisional; Region: PRK00865
261594002767	Protein of unknown function (DUF3626); Region: DUF3626; pfam12294
261594002768	NADP-dependent glyceraldehyde-3-phosphate dehydrogenase; Provisional; Region: PLN00412
261594002769	NADP+-dependent non-phosphorylating glyceraldehyde 3-phosphate dehydrogenase and ALDH family 11; Region: ALDH_F11_NP-GAPDH; cd07082
261594002770	tetrameric interface [polypeptide binding]; other site
261594002771	activator binding site; other site
261594002772	NADP binding site [chemical binding]; other site
261594002773	substrate binding site [chemical binding]; other site
261594002774	catalytic residues [active]
261594002775	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
261594002776	putative multidrug transporter membrane\ATP-binding components; Provisional; Region: PRK10789
261594002777	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
261594002778	Walker A/P-loop; other site
261594002779	ATP binding site [chemical binding]; other site
261594002780	Q-loop/lid; other site
261594002781	ABC transporter signature motif; other site
261594002782	Walker B; other site
261594002783	D-loop; other site
261594002784	H-loop/switch region; other site
261594002785	Bacterial extracellular solute-binding proteins, family 3; Region: SBP_bac_3; pfam00497
261594002786	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
261594002787	substrate binding pocket [chemical binding]; other site
261594002788	membrane-bound complex binding site; other site
261594002789	hinge residues; other site
261594002790	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
261594002791	dimer interface [polypeptide binding]; other site
261594002792	conserved gate region; other site
261594002793	putative PBP binding loops; other site
261594002794	ABC-ATPase subunit interface; other site
261594002795	ABC-type polar amino acid transport system, ATPase component [Amino acid transport and metabolism]; Region: GlnQ; COG1126
261594002796	ATP-binding cassette domain of the histidine and glutamine transporters; Region: ABC_HisP_GlnQ; cd03262
261594002797	Walker A/P-loop; other site
261594002798	ATP binding site [chemical binding]; other site
261594002799	Q-loop/lid; other site
261594002800	ABC transporter signature motif; other site
261594002801	Walker B; other site
261594002802	D-loop; other site
261594002803	H-loop/switch region; other site
261594002804	Small, acid-soluble spore proteins, alpha/beta type; Region: SASP; pfam00269
261594002805	YheC/D like ATP-grasp; Region: ATPgrasp_YheCD; pfam14398
261594002806	YheC/D like ATP-grasp; Region: ATPgrasp_YheCD; pfam14398
261594002807	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4399
261594002808	hypothetical protein; Provisional; Region: PRK13676
261594002809	Protein of unknown function (DUF1700); Region: DUF1700; pfam08006
261594002810	acetolactate synthase; Reviewed; Region: PRK08617
261594002811	Pyrimidine (PYR) binding domain of POX and related proteins; Region: TPP_PYR_POX_like; cd07035
261594002812	PYR/PP interface [polypeptide binding]; other site
261594002813	dimer interface [polypeptide binding]; other site
261594002814	TPP binding site [chemical binding]; other site
261594002815	Thiamine pyrophosphate enzyme, central domain; Region: TPP_enzyme_M; pfam00205
261594002816	Thiamine pyrophosphate (TPP) enzyme family, TPP-binding module; found in many key metabolic enzymes which use TPP (also known as thiamine diphosphate) as a cofactor. These enzymes include, among others, the E1 components of the pyruvate, the acetoin and...; Region: TPP_enzymes; cl01629
261594002817	TPP-binding site [chemical binding]; other site
261594002818	Alpha-acetolactate decarboxylase; Region: AAL_decarboxy; pfam03306
261594002819	Alkyladenine DNA glycosylase catalyzes the first step in base excision repair; Region: AAG; cd00540
261594002820	active site
261594002821	DNA binding site [nucleotide binding]
261594002822	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cl17915
261594002823	haloacid dehalogenase-like hydrolase; Region: Hydrolase_3; pfam08282
261594002824	active site
261594002825	motif I; other site
261594002826	motif II; other site
261594002827	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
261594002828	choice-of-anchor A domain; Region: choice_anch_A; TIGR04215
261594002829	Cna protein B-type domain; Region: Cna_B; pfam05738
261594002830	Cna protein B-type domain; Region: Cna_B; pfam05738
261594002831	Cna protein B-type domain; Region: Cna_B; pfam05738
261594002832	Cna protein B-type domain; Region: Cna_B; pfam05738
261594002833	Cna protein B-type domain; Region: Cna_B; pfam05738
261594002834	coproporphyrinogen III oxidase; Provisional; Region: PRK08207
261594002835	long-chain-fatty-acid--CoA ligase; Validated; Region: PRK06187
261594002836	Adenylate forming domain, Class I; Region: AFD_class_I; cl17068
261594002837	Bacterial Bile acid CoA ligases and similar proteins; Region: BACL_like; cd05929
261594002838	acyl-activating enzyme (AAE) consensus motif; other site
261594002839	acyl-activating enzyme (AAE) consensus motif; other site
261594002840	putative AMP binding site [chemical binding]; other site
261594002841	putative active site [active]
261594002842	putative CoA binding site [chemical binding]; other site
261594002843	high affinity sulphate transporter 1; Region: sulP; TIGR00815
261594002844	Sulfate transporter family; Region: Sulfate_transp; pfam00916
261594002845	Sulphate Transporter and Anti-Sigma factor antagonist domain of SulP-like sulfate transporters, plays a role in the function and regulation of the transport activity, proposed general NTP binding function; Region: STAS_SulP_like_sulfate_transporter; cd07042
261594002846	preprotein translocase subunit SecA; Reviewed; Region: PRK09200
261594002847	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cl17251
261594002848	ATP binding site [chemical binding]; other site
261594002849	putative Mg++ binding site [ion binding]; other site
261594002850	SecA preprotein cross-linking domain; Region: SecA_PP_bind; smart00958
261594002851	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
261594002852	nucleotide binding region [chemical binding]; other site
261594002853	ATP-binding site [chemical binding]; other site
261594002854	stage V sporulation protein B; Region: spore_V_B; TIGR02900
261594002855	Stage V sporulation protein B, also known as Stage III sporulation protein F, and related proteins; Region: MATE_SpoVB_like; cd13124
261594002856	Polysaccharide pyruvyl transferase family protein [Cell wall/membrane/envelope biogenesis]; Region: WcaK; COG2327
261594002857	polysaccharide pyruvyl transferase CsaB; Region: S_layer_CsaB; TIGR03609
261594002858	S-layer homology domain; Region: SLH; pfam00395
261594002859	S-layer homology domain; Region: SLH; pfam00395
261594002860	S-layer homology domain; Region: SLH; pfam00395
261594002861	Bacterial Ig-like domain (group 2); Region: Big_2; pfam02368
261594002862	S-layer homology domain; Region: SLH; pfam00395
261594002863	S-layer homology domain; Region: SLH; pfam00395
261594002864	S-layer homology domain; Region: SLH; pfam00395
261594002865	DHHW protein; Region: DHHW; pfam14286
261594002866	DHHW protein; Region: DHHW; pfam14286
261594002867	Predicted membrane protein involved in D-alanine export [Cell envelope biogenesis, outer membrane]; Region: DltB; COG1696
261594002868	Predicted membrane protein involved in D-alanine export [Cell envelope biogenesis, outer membrane]; Region: DltB; COG1696
261594002869	enoyl-CoA hydratase; Provisional; Region: PRK07659
261594002870	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
261594002871	substrate binding site [chemical binding]; other site
261594002872	oxyanion hole (OAH) forming residues; other site
261594002873	trimer interface [polypeptide binding]; other site
261594002874	Nucleoside Triphosphate Pyrophosphohydrolase (EC 3.6.1.8) MazG-like domain found in a group of uncharacterized proteins from archaea and bacteria; Region: NTP-PPase_COG4997; cd11532
261594002875	metal binding site [ion binding]; metal-binding site
261594002876	Cellulase M and related proteins [Carbohydrate transport and metabolism]; Region: FrvX; COG1363
261594002877	M42 Peptidase, Endoglucanase-like subfamily; Region: M42_glucanase_like; cd05657
261594002878	putative oligomer interface [polypeptide binding]; other site
261594002879	putative active site [active]
261594002880	metal binding site [ion binding]; metal-binding site
261594002881	S-layer homology domain; Region: SLH; pfam00395
261594002882	S-layer homology domain; Region: SLH; pfam00395
261594002883	S-layer homology domain; Region: SLH; pfam00395
261594002884	N-acetylmuramoyl-L-alanine amidase [Cell envelope biogenesis, outer membrane]; Region: AmiC; COG0860
261594002885	N-acetylmuramoyl-L-alanine amidase or MurNAc-LAA (also known as peptidoglycan aminohydrolase, NAMLA amidase, NAMLAA, Amidase 3, and peptidoglycan amidase; EC 3.5.1.28) is an autolysin that hydrolyzes the amide bond between N-acetylmuramoyl and L-amino...; Region: MurNAc-LAA; cd02696
261594002886	active site
261594002887	metal binding site [ion binding]; metal-binding site
261594002888	Predicted DNA modification methylase [DNA replication, recombination, and repair]; Region: COG1041
261594002889	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594002890	S-adenosylmethionine binding site [chemical binding]; other site
261594002891	Protein of unknown function (DUF2639); Region: DUF2639; pfam11121
261594002892	proline racemase; Provisional; Region: PRK13969
261594002893	hydroxyproline-2-epimerase; Provisional; Region: PRK13971
261594002894	ornithine cyclodeaminase; Validated; Region: PRK08618
261594002895	NAD(P) binding domain of Shikimate dehydrogenase; Region: NAD_bind_Shikimate_DH; cd01065
261594002896	NAD(P) binding site [chemical binding]; other site
261594002897	Yip1 domain; Region: Yip1; pfam04893
261594002898	The substrate-binding domain of an ABC-type nickel/oligopeptide-like import system contains the type 2 periplasmic binding fold; Region: PBP2_NikA_DppA_OppA_like; cd00995
261594002899	Bacterial extracellular solute-binding proteins, family 5 Middle; Region: SBP_bac_5; pfam00496
261594002900	ABC-type dipeptide/oligopeptide/nickel transport systems, permease components [Amino acid transport and metabolism / Inorganic ion transport and metabolism]; Region: DppB; COG0601
261594002901	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
261594002902	dimer interface [polypeptide binding]; other site
261594002903	conserved gate region; other site
261594002904	putative PBP binding loops; other site
261594002905	ABC-ATPase subunit interface; other site
261594002906	ABC-type dipeptide/oligopeptide/nickel transport systems, permease components [Amino acid transport and metabolism / Inorganic ion transport and metabolism]; Region: DppC; COG1173
261594002907	N-terminal TM domain of oligopeptide transport permease C; Region: OppC_N; pfam12911
261594002908	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
261594002909	dimer interface [polypeptide binding]; other site
261594002910	conserved gate region; other site
261594002911	putative PBP binding loops; other site
261594002912	ABC-ATPase subunit interface; other site
261594002913	ABC-type oligopeptide transport system, ATPase component [Amino acid transport and metabolism]; Region: AppF; COG4608
261594002914	ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257
261594002915	Walker A/P-loop; other site
261594002916	ATP binding site [chemical binding]; other site
261594002917	Q-loop/lid; other site
261594002918	ABC transporter signature motif; other site
261594002919	Walker B; other site
261594002920	D-loop; other site
261594002921	H-loop/switch region; other site
261594002922	oligopeptide/dipeptide ABC transporter, ATP-binding protein, C-terminal domain; Region: oligo_HPY; TIGR01727
261594002923	Domain of unknown function (DUF4352); Region: DUF4352; pfam11611
261594002924	SMI1 / KNR4 family (SUKH-1); Region: SMI1_KNR4; pfam09346
261594002925	SMI1 / KNR4 family (SUKH-1); Region: SMI1_KNR4; pfam09346
261594002926	alpha-ketoglutarate transporter; Provisional; Region: PRK10406
261594002927	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594002928	putative substrate translocation pore; other site
261594002929	Signal transduction histidine kinase regulating citrate/malate metabolism [Signal transduction mechanisms]; Region: CitA; COG3290
261594002930	PAS domain; Region: PAS; smart00091
261594002931	putative active site [active]
261594002932	heme pocket [chemical binding]; other site
261594002933	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594002934	ATP binding site [chemical binding]; other site
261594002935	Mg2+ binding site [ion binding]; other site
261594002936	G-X-G motif; other site
261594002937	Response regulator of citrate/malate metabolism [Transcription / Signal transduction mechanisms]; Region: CitB; COG4565
261594002938	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594002939	active site
261594002940	phosphorylation site [posttranslational modification]
261594002941	intermolecular recognition site; other site
261594002942	dimerization interface [polypeptide binding]; other site
261594002943	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3181
261594002944	Uncharacterized proteins involved in stress response, homologs of TerZ and putative cAMP-binding protein CABP1 [Signal transduction mechanisms]; Region: TerZ; COG2310
261594002945	Uncharacterized proteins involved in stress response, similar to tellurium resistance terD; Region: TerD_like; cd06974
261594002946	putative metal binding site [ion binding]; other site
261594002947	Uncharacterized proteins involved in stress response, similar to tellurium resistance terD; Region: TerD_like; cd06974
261594002948	putative metal binding site [ion binding]; other site
261594002949	Domain of unknown function (DUF3578); Region: DUF3578; pfam12102
261594002950	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cl17189
261594002951	Domain of unknown function (DUF2357); Region: DUF2357; pfam09823
261594002952	Protein of unknown function (DUF524); Region: DUF524; pfam04411
261594002953	Tic20-like protein; Region: Tic20; pfam09685
261594002954	Helix-Turn-Helix DNA binding domain of the transcription regulators TipAL, Mta, and SkgA; Region: HTH_TipAL-Mta; cd01106
261594002955	DNA binding residues [nucleotide binding]
261594002956	Predicted transcriptional regulators [Transcription]; Region: SoxR; COG0789
261594002957	dimer interface [polypeptide binding]; other site
261594002958	TipAS antibiotic-recognition domain; Region: TipAS; pfam07739
261594002959	Nucleoside Triphosphate Pyrophosphohydrolase (EC 3.6.1.8) MazG-like domain found in a group of uncharacterized proteins from archaea and bacteria; Region: NTP-PPase_COG4997; cd11532
261594002960	metal binding site [ion binding]; metal-binding site
261594002961	Replication initiation and membrane attachment; Region: DnaB_2; pfam07261
261594002962	replicative DNA helicase; Provisional; Region: PRK06749
261594002963	DnaB-like helicase N terminal domain; Region: DnaB; pfam00772
261594002964	DnaB helicase C terminal domain. The hexameric helicase DnaB unwinds the DNA duplex at the  chromosome replication fork. Although the mechanism by which DnaB both couples ATP hydrolysis to translocation along DNA and denatures the duplex is unknown, a...; Region: DnaB_C; cd00984
261594002965	Walker A motif; other site
261594002966	ATP binding site [chemical binding]; other site
261594002967	Walker B motif; other site
261594002968	DNA binding loops [nucleotide binding]
261594002969	Domain of Unknown Function with PDB structure (DUF3862); Region: DUF3862; pfam12978
261594002970	Predicted transcriptional regulators [Transcription]; Region: COG1378
261594002971	Sugar-specific transcriptional regulator TrmB; Region: TrmB; pfam01978
261594002972	Middle phospholipase D-like domain of the transcriptional regulator TrmB and similar proteins; Region: PLDc_like_TrmB_middle; cd09124
261594002973	C-terminal domain interface [polypeptide binding]; other site
261594002974	sugar binding site [chemical binding]; other site
261594002975	hypothetical protein; Provisional; Region: PRK10621
261594002976	Sulfite exporter TauE/SafE; Region: TauE; pfam01925
261594002977	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
261594002978	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
261594002979	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594002980	putative substrate translocation pore; other site
261594002981	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594002982	Predicted permease; Region: DUF318; cl17795
261594002983	Predicted permeases [General function prediction only]; Region: COG0701
261594002984	Predicted transcriptional regulators [Transcription]; Region: COG1695
261594002985	Transcriptional regulator PadR-like family; Region: PadR; pfam03551
261594002986	Protein of unknown function (DUF3373); Region: DUF3373; pfam11853
261594002987	Dienelactone hydrolase and related enzymes [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG0412
261594002988	Protein of unknown function (DUF1470); Region: DUF1470; pfam07336
261594002989	Conserved protein containing a Zn-ribbon-like motif, possibly RNA-binding [General function prediction only]; Region: COG5516
261594002990	CGNR zinc finger; Region: zf-CGNR; pfam11706
261594002991	HPP family; Region: HPP; pfam04982
261594002992	Pseudomonas fluorescens MupV-like, extended (e) SDRs; Region: MupV_like_SDR_e; cd05263
261594002993	NAD dependent epimerase/dehydratase family; Region: Epimerase; pfam01370
261594002994	putative NAD(P) binding site [chemical binding]; other site
261594002995	active site
261594002996	putative substrate binding site [chemical binding]; other site
261594002997	Alpha/beta hydrolase family; Region: Abhydrolase_6; pfam12697
261594002998	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
261594002999	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
261594003000	YmzC-like protein; Region: YmzC; pfam14157
261594003001	Domain of unknown function (DUF4259); Region: DUF4259; pfam14078
261594003002	Transcriptional regulators [Transcription]; Region: MarR; COG1846
261594003003	MarR family; Region: MarR_2; pfam12802
261594003004	Rat sarcoma (Ras)-like superfamily of small guanosine triphosphatases (GTPases); Region: Ras_like_GTPase; cl17170
261594003005	CDP-alcohol phosphatidyltransferase; Region: CDP-OH_P_transf; pfam01066
261594003006	CDP-diacylglycerol--serine O-phosphatidyltransferase; Region: pssA; TIGR00473
261594003007	ATP synthase I chain; Region: ATP_synt_I; pfam03899
261594003008	Predicted membrane protein (DUF2306); Region: DUF2306; pfam10067
261594003009	VanZ like family; Region: VanZ; pfam04892
261594003010	DhaKLM operon coactivator DhaQ; Provisional; Region: PRK14483
261594003011	Dihydroxyacetone kinase [Carbohydrate transport and metabolism]; Region: DAK1; COG2376
261594003012	probable dihydroxyacetone kinase regulator; Region: DHAK_reg; TIGR02366
261594003013	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
261594003014	Transcriptional regulator C-terminal region; Region: TetR_C_8; pfam14278
261594003015	dihydroxyacetone kinase; Provisional; Region: PRK14479
261594003016	dihydroxyacetone kinase subunit DhaK; Provisional; Region: PRK14481
261594003017	DAK2 domain; Region: Dak2; pfam02734
261594003018	Flavodoxin-like fold; Region: Flavodoxin_2; cl00438
261594003019	Predicted transcriptional regulator [Transcription]; Region: COG1959
261594003020	Transcriptional regulator; Region: Rrf2; pfam02082
261594003021	CAAX protease self-immunity; Region: Abi; pfam02517
261594003022	c-di-GMP phosphodiesterase class II (HD-GYP domain) [Signal transduction mechanisms]; Region: COG2206
261594003023	Metal dependent phosphohydrolases with conserved 'HD' motif; Region: HDc; cd00077
261594003024	Zn2+ binding site [ion binding]; other site
261594003025	Mg2+ binding site [ion binding]; other site
261594003026	S-layer homology domain; Region: SLH; pfam00395
261594003027	S-layer homology domain; Region: SLH; pfam00395
261594003028	S-layer homology domain; Region: SLH; pfam00395
261594003029	Transglutaminase-like superfamily; Region: Transglut_core; pfam01841
261594003030	Predicted transcriptional regulators [Transcription]; Region: COG1695
261594003031	Transcriptional regulator PadR-like family; Region: PadR; cl17335
261594003032	Protein of unknown function (DUF2812); Region: DUF2812; pfam11193
261594003033	Protein of unknown function (DUF2798); Region: DUF2798; pfam11391
261594003034	Heat induced stress protein YflT; Region: YflT; pfam11181
261594003035	CsbD-like; Region: CsbD; pfam05532
261594003036	Predicted membrane protein [Function unknown]; Region: COG2261
261594003037	Sulphate Transporter and Anti-Sigma factor antagonist) domain of anti-anti-sigma factors, key regulators of anti-sigma factors by phosphorylation; Region: STAS_anti-anti-sigma_factors; cd07043
261594003038	anti sigma factor interaction site; other site
261594003039	regulatory phosphorylation site [posttranslational modification]; other site
261594003040	Anti-sigma regulatory factor (Ser/Thr protein kinase) [Signal transduction mechanisms]; Region: RsbW; COG2172
261594003041	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594003042	ATP binding site [chemical binding]; other site
261594003043	Mg2+ binding site [ion binding]; other site
261594003044	G-X-G motif; other site
261594003045	RNA polymerase sigma-B factor; Region: Sigma_B; TIGR02941
261594003046	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
261594003047	Sigma-70 region 3; Region: Sigma70_r3; pfam04539
261594003048	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
261594003049	DNA binding residues [nucleotide binding]
261594003050	Ferritin-like domain; Region: Ferritin; pfam00210
261594003051	Ferritin-like superfamily of diiron-containing four-helix-bundle proteins; Region: Ferritin_like; cd00657
261594003052	dinuclear metal binding motif [ion binding]; other site
261594003053	Response regulator receiver domain; Region: Response_reg; pfam00072
261594003054	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594003055	active site
261594003056	phosphorylation site [posttranslational modification]
261594003057	intermolecular recognition site; other site
261594003058	dimerization interface [polypeptide binding]; other site
261594003059	Serine phosphatase RsbU, regulator of sigma subunit [Signal transduction mechanisms / Transcription]; Region: RsbU; COG2208
261594003060	Stage II sporulation protein E (SpoIIE); Region: SpoIIE; pfam07228
261594003061	CheR methyltransferase, all-alpha domain; Region: CheR_N; pfam03705
261594003062	Methylase of chemotaxis methyl-accepting proteins [Cell motility and secretion / Signal transduction mechanisms]; Region: CheR; COG1352
261594003063	CheR methyltransferase, SAM binding domain; Region: CheR; pfam01739
261594003064	CHASE3 domain; Region: CHASE3; pfam05227
261594003065	GAF domain; Region: GAF; pfam01590
261594003066	GAF domain; Region: GAF_2; pfam13185
261594003067	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
261594003068	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
261594003069	dimer interface [polypeptide binding]; other site
261594003070	phosphorylation site [posttranslational modification]
261594003071	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594003072	ATP binding site [chemical binding]; other site
261594003073	Mg2+ binding site [ion binding]; other site
261594003074	G-X-G motif; other site
261594003075	Response regulator receiver domain; Region: Response_reg; pfam00072
261594003076	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594003077	active site
261594003078	phosphorylation site [posttranslational modification]
261594003079	intermolecular recognition site; other site
261594003080	dimerization interface [polypeptide binding]; other site
261594003081	Histidine-containing phosphocarrier protein (HPr)-like proteins. HPr is a central component of the bacterial phosphoenolpyruvate sugar phosphotransferase system (PTS). The PTS catalyses the phosphorylation of sugar substrates during their translocation...; Region: PTS-HPr_like; cl00206
261594003082	Protein of unknown function (DUF4028); Region: DUF4028; pfam13220
261594003083	hypothetical protein; Provisional; Region: PRK12856
261594003084	2-enoyl thioester reductase-like; Region: ETR_like; cd05282
261594003085	NADPH:quinone reductase and related Zn-dependent oxidoreductases [Energy production and conversion / General function prediction only]; Region: Qor; COG0604
261594003086	NADP binding site [chemical binding]; other site
261594003087	dimer interface [polypeptide binding]; other site
261594003088	Protein of unknown function (DUF2639); Region: DUF2639; pfam11121
261594003089	YhzD-like protein; Region: YhzD; pfam14120
261594003090	DNA repair exonuclease [DNA replication, recombination, and repair]; Region: SbcD; COG0420
261594003091	Mre11 nuclease, N-terminal metallophosphatase domain; Region: MPP_Mre11_N; cd00840
261594003092	active site
261594003093	metal binding site [ion binding]; metal-binding site
261594003094	DNA binding site [nucleotide binding]
261594003095	Predicted ATP-binding protein involved in virulence [General function prediction only]; Region: COG3950
261594003096	AAA domain; Region: AAA_27; pfam13514
261594003097	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG0675
261594003098	Helix-turn-helix domain; Region: HTH_OrfB_IS605; pfam12323
261594003099	Probable transposase; Region: OrfB_IS605; pfam01385
261594003100	3'-5' exoribonuclease YhaM; Provisional; Region: PRK13480
261594003101	YhaM_OBF_like: A subfamily of OB folds similar to that found in Bacillus subtilis YhaM and Staphylococcus aureus cmp-binding factor-1 (SaCBF1). Both these proteins are 3'-to-5'exoribonucleases. YhaM requires Mn2+ or Co2+ for activity and is...; Region: YhaM_OBF_like; cd04492
261594003102	generic binding surface II; other site
261594003103	generic binding surface I; other site
261594003104	Metal dependent phosphohydrolases with conserved 'HD' motif; Region: HDc; cd00077
261594003105	Zn2+ binding site [ion binding]; other site
261594003106	Mg2+ binding site [ion binding]; other site
261594003107	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
261594003108	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
261594003109	Arabinose efflux permease [Carbohydrate transport and metabolism]; Region: AraJ; COG2814
261594003110	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594003111	N-terminal domain of Sphingobium chlorophenolicum 2,6-dichloro-p-hydroquinone 1,2-dioxygenase (PcpA), and similar proteins; Region: PcpA_N_like; cd08346
261594003112	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
261594003113	Zn binding site [ion binding]; other site
261594003114	C-terminal domain of Sphingobium chlorophenolicum 2,6-dichloro-p-hydroquinone 1,2-dioxygenase (PcpA), and similar proteins; Region: PcpA_C_like; cd08347
261594003115	Zn binding site [ion binding]; other site
261594003116	N-terminal domain of Sphingobium chlorophenolicum 2,6-dichloro-p-hydroquinone 1,2-dioxygenase (PcpA), and similar proteins; Region: PcpA_N_like; cd08346
261594003117	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
261594003118	Zn binding site [ion binding]; other site
261594003119	C-terminal domain of Sphingobium chlorophenolicum 2,6-dichloro-p-hydroquinone 1,2-dioxygenase (PcpA), and similar proteins; Region: PcpA_C_like; cd08347
261594003120	Zn binding site [ion binding]; other site
261594003121	Tetratricopeptide repeat; Region: TPR_12; pfam13424
261594003122	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cd00189
261594003123	TPR motif; other site
261594003124	binding surface
261594003125	Alpha/beta hydrolase family; Region: Abhydrolase_6; pfam12697
261594003126	homoserine O-acetyltransferase; Provisional; Region: metX; cl17114
261594003127	Sporulation protein YhaL; Region: Spore_YhaL; pfam14147
261594003128	Domain of unknown function (DUF2935); Region: DUF2935; pfam11155
261594003129	Domain of unknown function (DUF2935); Region: DUF2935; pfam11155
261594003130	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
261594003131	non-specific DNA binding site [nucleotide binding]; other site
261594003132	salt bridge; other site
261594003133	sequence-specific DNA binding site [nucleotide binding]; other site
261594003134	Glycerol-3-phosphate responsive antiterminator (mRNA-binding) [Transcription]; Region: GlpP; COG1954
261594003135	Glycerol uptake facilitator and related permeases (Major Intrinsic Protein Family) [Carbohydrate transport and metabolism]; Region: GlpF; COG0580
261594003136	amphipathic channel; other site
261594003137	Asn-Pro-Ala signature motifs; other site
261594003138	glycerol kinase; Provisional; Region: glpK; PRK00047
261594003139	Escherichia coli glycerol kinase-like proteins; belongs to the FGGY family of carbohydrate kinases; Region: FGGY_EcGK_like; cd07786
261594003140	N- and C-terminal domain interface [polypeptide binding]; other site
261594003141	active site
261594003142	MgATP binding site [chemical binding]; other site
261594003143	catalytic site [active]
261594003144	metal binding site [ion binding]; metal-binding site
261594003145	glycerol binding site [chemical binding]; other site
261594003146	homotetramer interface [polypeptide binding]; other site
261594003147	homodimer interface [polypeptide binding]; other site
261594003148	FBP binding site [chemical binding]; other site
261594003149	protein IIAGlc interface [polypeptide binding]; other site
261594003150	Glycerol-3-phosphate dehydrogenase [Energy production and conversion]; Region: GlpA; COG0578
261594003151	Protein of unknown function (DUF2283); Region: DUF2283; cl02251
261594003152	RNA polymerase factor sigma C; Reviewed; Region: PRK09415
261594003153	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
261594003154	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
261594003155	DNA binding residues [nucleotide binding]
261594003156	lineage-specific thermal regulator protein; Provisional; Region: lstR; PRK09416
261594003157	Predicted transcriptional regulators [Transcription]; Region: COG1695
261594003158	Bacterial cell division membrane protein [Cell division and chromosome partitioning]; Region: FtsW; COG0772
261594003159	helix_turn_helix multiple antibiotic resistance protein; Region: HTH_MARR; smart00347
261594003160	MarR family; Region: MarR; pfam01047
261594003161	DoxX-like family; Region: DoxX_2; pfam13564
261594003162	drug resistance transporter, EmrB/QacA subfamily; Region: efflux_EmrB; TIGR00711
261594003163	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594003164	putative substrate translocation pore; other site
261594003165	drug resistance transporter, EmrB/QacA subfamily; Region: efflux_EmrB; TIGR00711
261594003166	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594003167	putative substrate translocation pore; other site
261594003168	Superfamily I DNA and RNA helicases [General function prediction only]; Region: COG3973
261594003169	Part of AAA domain; Region: AAA_19; pfam13245
261594003170	Family description; Region: UvrD_C_2; pfam13538
261594003171	peptidylprolyl isomerase; Reviewed; Region: prsA; PRK03002
261594003172	PPIC-type PPIASE domain; Region: Rotamase; pfam00639
261594003173	Protein of unknown function (DUF1878); Region: DUF1878; pfam08963
261594003174	transcriptional regulator Hpr; Provisional; Region: PRK13777
261594003175	MarR family; Region: MarR; pfam01047
261594003176	Gas vesicle protein [General function prediction only]; Region: GvpP; COG4980
261594003177	HINT (histidine triad nucleotide-binding protein) subgroup: Members of this CD belong to the superfamily of histidine triad hydrolases that act on alpha-phosphate of ribonucleotides. This subgroup includes members from all three forms of cellular life; Region: HINT_subgroup; cd01277
261594003178	HIT family signature motif; other site
261594003179	catalytic residue [active]
261594003180	ABC-type Na+ transport system, ATPase component [Energy production and conversion / Inorganic ion transport and metabolism]; Region: NatA; COG4555
261594003181	ATP-binding cassette domain of the drug resistance transporter and related proteins, subfamily A; Region: ABC_DR_subfamily_A; cd03230
261594003182	Walker A/P-loop; other site
261594003183	ATP binding site [chemical binding]; other site
261594003184	Q-loop/lid; other site
261594003185	ABC transporter signature motif; other site
261594003186	Walker B; other site
261594003187	D-loop; other site
261594003188	H-loop/switch region; other site
261594003189	Bacterial ABC transporter protein EcsB; Region: EcsB; pfam05975
261594003190	EcsC protein family; Region: EcsC; pfam12787
261594003191	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
261594003192	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
261594003193	Uncharacterized conserved protein [Function unknown]; Region: COG3402
261594003194	Cysteine-rich CPCC; Region: Cys_rich_CPCC; pfam14206
261594003195	Protein of unknown function (DUF1304); Region: DUF1304; pfam06993
261594003196	Helix-Turn-Helix DNA binding domain of the BmrR transcription regulator; Region: HTH_BmrR; cd01107
261594003197	MerR HTH family regulatory protein; Region: MerR_1; pfam13411
261594003198	DNA binding residues [nucleotide binding]
261594003199	drug binding residues [chemical binding]; other site
261594003200	dimer interface [polypeptide binding]; other site
261594003201	Uncharacterized conserved protein [Function unknown]; Region: COG3402
261594003202	Predicted membrane protein [Function unknown]; Region: COG3428
261594003203	Bacterial PH domain; Region: DUF304; pfam03703
261594003204	Bacterial PH domain; Region: DUF304; pfam03703
261594003205	Bacterial PH domain; Region: DUF304; pfam03703
261594003206	Uncharacterized enzyme involved in biosynthesis of extracellular polysaccharides [General function prediction only]; Region: COG2329
261594003207	Transglycosylase; Region: Transgly; pfam00912
261594003208	penicillin-binding protein, 1A family; Region: PBP_1a_fam; TIGR02074
261594003209	Penicillin binding protein transpeptidase domain; Region: Transpeptidase; pfam00905
261594003210	methylcobalamin:coenzyme M methyltransferase; Validated; Region: PRK06252
261594003211	Uroporphyrinogen decarboxylase (URO-D) is a dimeric cytosolic enzyme that decarboxylates the four acetate side chains of uroporphyrinogen III (uro-III) to create coproporphyrinogen III, without requiring any prosthetic groups or cofactors. This reaction...; Region: URO-D; cd00717
261594003212	substrate binding site [chemical binding]; other site
261594003213	active site
261594003214	ferrochelatase; Provisional; Region: PRK12435
261594003215	Ferrochelatase, N-terminal domain: Ferrochelatase (protoheme ferrolyase or HemH) is the terminal enzyme of the heme biosynthetic pathway. It catalyzes the insertion of ferrous iron into the protoporphyrin IX ring yielding protoheme. This enzyme is...; Region: Ferrochelatase_N; cd03411
261594003216	C-terminal domain interface [polypeptide binding]; other site
261594003217	active site
261594003218	Ferrochelatase, C-terminal domain: Ferrochelatase (protoheme ferrolyase or HemH) is the terminal enzyme of the heme biosynthetic pathway. It catalyzes the insertion of ferrous iron into the protoporphyrin IX ring yielding protoheme. This enzyme is...; Region: Ferrochelatase_C; cd00419
261594003219	active site
261594003220	N-terminal domain interface [polypeptide binding]; other site
261594003221	protoporphyrinogen oxidase; Reviewed; Region: PRK11883
261594003222	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
261594003223	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
261594003224	Protein of unknown function (DUF4026); Region: DUF4026; pfam13218
261594003225	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3779
261594003226	Fn3 associated; Region: Fn3_assoc; pfam13287
261594003227	YhcR_OBF_like: A subfamily of OB-fold domains similar to the OB folds of Bacillus subtilis YhcR. YhcR is a sugar-nonspecific nuclease, which is active in the presence of Ca2+ and Mn2+. It cleaves RNA endonucleolytically, producing 3'-monophosphate...; Region: YhcR_OBF_like; cd04486
261594003228	generic binding surface II; other site
261594003229	generic binding surface I; other site
261594003230	Mycoplasma pulmonis MnuA nuclease-like; Region: MnuA_DNase1-like; cd10283
261594003231	putative active site [active]
261594003232	putative catalytic site [active]
261594003233	putative Mg binding site IVb [ion binding]; other site
261594003234	putative phosphate binding site [ion binding]; other site
261594003235	putative DNA binding site [nucleotide binding]; other site
261594003236	putative Mg binding site IVa [ion binding]; other site
261594003237	Penicillinase repressor; Region: Pencillinase_R; pfam03965
261594003238	BlaR1 peptidase M56; Region: Peptidase_M56; pfam05569
261594003239	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
261594003240	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
261594003241	Predicted membrane protein [Function unknown]; Region: COG1511
261594003242	YhgE/Pip N-terminal domain; Region: pip_yhgE_Nterm; TIGR03061
261594003243	X-X-X-Leu-X-X-Gly heptad repeats; Region: xxxLxxG_by_4; TIGR03057
261594003244	X-X-X-Leu-X-X-Gly heptad repeats; Region: xxxLxxG_by_4; TIGR03057
261594003245	YhgE/Pip C-terminal domain; Region: pip_yhgE_Cterm; TIGR03062
261594003246	Uncharacterized protein conserved in bacteria (DUF2087); Region: DUF2087; pfam09860
261594003247	Acetyltransferase (GNAT) domain; Region: Acetyltransf_3; pfam13302
261594003248	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594003249	Coenzyme A binding pocket [chemical binding]; other site
261594003250	Transcriptional regulators [Transcription]; Region: PurR; COG1609
261594003251	Helix-turn-helix (HTH) DNA binding domain of the LacI family of transcriptional regulators; Region: HTH_LacI; cd01392
261594003252	DNA binding site [nucleotide binding]
261594003253	domain linker motif; other site
261594003254	Ligand-binding domain of a novel transcription factor implicated in catabolite repression in Bacillus and Clostridium species; Region: PBP1_CcpB_like; cd06286
261594003255	putative dimerization interface [polypeptide binding]; other site
261594003256	putative ligand binding site [chemical binding]; other site
261594003257	YhfH-like protein; Region: YhfH; pfam14149
261594003258	Metal-dependent hydrolases of the beta-lactamase superfamily III [General function prediction only]; Region: ElaC; COG1234
261594003259	Lipoate-protein ligase A [Coenzyme metabolism]; Region: LplA; COG0095
261594003260	lipoyltransferase and lipoate-protein ligase; Region: lipoyltrans; TIGR00545
261594003261	Bacterial lipoate protein ligase C-terminus; Region: Lip_prot_lig_C; pfam10437
261594003262	ribosomal RNA large subunit methyltransferase N; Provisional; Region: PRK14462
261594003263	long-chain-fatty-acid--CoA ligase; Validated; Region: PRK07656
261594003264	Prokaryotic long-chain fatty acid CoA synthetases similar to Escherichia coli FadD; Region: FC-FACS_FadD_like; cd05936
261594003265	acyl-activating enzyme (AAE) consensus motif; other site
261594003266	putative AMP binding site [chemical binding]; other site
261594003267	putative active site [active]
261594003268	putative CoA binding site [chemical binding]; other site
261594003269	NEAr Transport domain, a component of cell surface proteins; Region: NEAT; cd06920
261594003270	heme-binding site [chemical binding]; other site
261594003271	S-layer homology domain; Region: SLH; pfam00395
261594003272	S-layer homology domain; Region: SLH; pfam00395
261594003273	S-layer homology domain; Region: SLH; pfam00395
261594003274	Uncharacterized protein conserved in Bacteroidetes; Region: Bacuni_01323_like; cd12871
261594003275	Carbohydrate binding domain; Region: CBM_4_9; pfam02018
261594003276	Rhs family protein [Cell envelope biogenesis, outer membrane]; Region: RhsA; COG3209
261594003277	YD repeat (two copies); Region: YD_repeat_2x; TIGR01643
261594003278	Uncharacterized protein conserved in Bacteroidetes; Region: Bacuni_01323_like; cd12871
261594003279	RHS repeat-associated core domain; Region: Rhs_assc_core; TIGR03696
261594003280	Aureocin-like type II bacteriocin; Region: Bacteriocin_IIi; pfam11758
261594003281	Protein of unknown function (DUF1260); Region: DUF1260; pfam06877
261594003282	RHS repeat-associated core domain; Region: Rhs_assc_core; TIGR03696
261594003283	Metal dependent phosphohydrolases with conserved 'HD' motif; Region: HDc; cd00077
261594003284	Zn2+ binding site [ion binding]; other site
261594003285	Mg2+ binding site [ion binding]; other site
261594003286	Putative zinc-finger; Region: zf-HC2; pfam13490
261594003287	Sigma factor regulator N-terminal; Region: Sigma_reg_N; pfam13800
261594003288	Sigma factor regulator C-terminal; Region: Sigma_reg_C; pfam13791
261594003289	RNA polymerase sigma factor; Provisional; Region: PRK12541
261594003290	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
261594003291	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
261594003292	DNA binding residues [nucleotide binding]
261594003293	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
261594003294	helix_turn_helix, arabinose operon control protein; Region: HTH_ARAC; smart00342
261594003295	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
261594003296	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3708
261594003297	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
261594003298	Glyoxalase-like domain; Region: Glyoxalase_2; pfam12681
261594003299	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
261594003300	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
261594003301	dimer interface [polypeptide binding]; other site
261594003302	phosphorylation site [posttranslational modification]
261594003303	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594003304	ATP binding site [chemical binding]; other site
261594003305	Mg2+ binding site [ion binding]; other site
261594003306	G-X-G motif; other site
261594003307	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
261594003308	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594003309	active site
261594003310	phosphorylation site [posttranslational modification]
261594003311	intermolecular recognition site; other site
261594003312	dimerization interface [polypeptide binding]; other site
261594003313	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
261594003314	DNA binding site [nucleotide binding]
261594003315	CAAX protease self-immunity; Region: Abi; pfam02517
261594003316	Peptidase family M48; Region: Peptidase_M48; pfam01435
261594003317	Four helix bundle sensory module for signal transduction; Region: 4HB_MCP_1; pfam12729
261594003318	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
261594003319	dimerization interface [polypeptide binding]; other site
261594003320	Methyl-accepting chemotaxis-like domains (chemotaxis sensory transducer); Region: MA; smart00283
261594003321	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
261594003322	dimer interface [polypeptide binding]; other site
261594003323	putative CheW interface [polypeptide binding]; other site
261594003324	Carboxylate/Amino Acid/Amine Transporter; Region: 2A78; TIGR00950
261594003325	EamA-like transporter family; Region: EamA; pfam00892
261594003326	EamA-like transporter family; Region: EamA; pfam00892
261594003327	S-layer homology domain; Region: SLH; pfam00395
261594003328	S-layer homology domain; Region: SLH; pfam00395
261594003329	S-layer homology domain; Region: SLH; pfam00395
261594003330	S-layer homology domain; Region: SLH; pfam00395
261594003331	S-layer homology domain; Region: SLH; pfam00395
261594003332	S-layer homology domain; Region: SLH; pfam00395
261594003333	S-layer homology domain; Region: SLH; pfam00395
261594003334	S-layer homology domain; Region: SLH; pfam00395
261594003335	S-layer homology domain; Region: SLH; pfam00395
261594003336	malate synthase A; Region: malate_syn_A; TIGR01344
261594003337	Malate synthase A (MSA), present in some bacteria, plants and fungi. Prokaryotic MSAs tend to be monomeric, whereas eukaryotic enzymes are homomultimers. In general, malate synthase catalyzes the Claisen condensation of glyoxylate and acetyl-CoA to...; Region: malate_synt_A; cd00727
261594003338	active site
261594003339	isocitrate lyase; Provisional; Region: PRK15063
261594003340	Members of the ICL/PEPM enzyme family catalyze either P-C or C-C bond formation/cleavage. Known members are phosphoenolpyruvate mutase (PEPM), phosphonopyruvate hydrolase (PPH), carboxyPEP mutase (CPEP mutase), oxaloacetate hydrolase (OAH), isocitrate...; Region: ICL_PEPM; cd00377
261594003341	tetramer interface [polypeptide binding]; other site
261594003342	active site
261594003343	Mg2+/Mn2+ binding site [ion binding]; other site
261594003344	Phosphotransferase enzyme family; Region: APH; pfam01636
261594003345	Aminoglycoside 3'-phosphotransferase (APH) and Choline Kinase (ChoK) family. The APH/ChoK family is part of a larger superfamily that includes the catalytic domains of other kinases, such as the typical serine/threonine/tyrosine protein kinases (PKs)...; Region: APH_ChoK_like; cd05120
261594003346	active site
261594003347	substrate binding site [chemical binding]; other site
261594003348	ATP binding site [chemical binding]; other site
261594003349	Cold-Shock Protein (CSP) contains an S1-like cold-shock domain (CSD) that is found in eukaryotes, prokaryotes, and archaea.  CSP's include the major cold-shock proteins CspA and CspB in bacteria and the eukaryotic gene regulatory factor Y-box...; Region: CSP_CDS; cd04458
261594003350	DNA-binding site [nucleotide binding]; DNA binding site
261594003351	RNA-binding motif; other site
261594003352	ComK protein; Region: ComK; pfam06338
261594003353	Uncharacterized conserved protein [Function unknown]; Region: COG0398
261594003354	SNARE associated Golgi protein; Region: SNARE_assoc; pfam09335
261594003355	signal peptidase I, bacterial type; Region: sigpep_I_bact; TIGR02227
261594003356	The S26 Type I signal peptidase (SPase; LepB; leader peptidase B; leader peptidase I; EC 3.4.21.89) family members are essential membrane-bound serine proteases that function to cleave the amino-terminal signal peptide extension from proteins that are...; Region: S26_SPase_I; cd06530
261594003357	Catalytic site [active]
261594003358	The S26 Type I signal peptidase (SPase; LepB; leader peptidase B; leader peptidase I; EC 3.4.21.89) family members are essential membrane-bound serine proteases that function to cleave the amino-terminal signal peptide extension from proteins that are...; Region: S26_SPase_I; cd06530
261594003359	helicase-exonuclease AddAB, AddB subunit; Region: addB_Gpos; TIGR02773
261594003360	PD-(D/E)XK nuclease superfamily; Region: PDDEXK_1; pfam12705
261594003361	helicase-exonuclease AddAB, AddA subunit, Firmicutes type; Region: addA_Gpos; TIGR02785
261594003362	Part of AAA domain; Region: AAA_19; pfam13245
261594003363	Family description; Region: UvrD_C_2; pfam13538
261594003364	PD-(D/E)XK nuclease superfamily; Region: PDDEXK_1; pfam12705
261594003365	hypothetical protein; Provisional; Region: PRK07758
261594003366	Spore germination protein gerPA/gerPF; Region: gerPA; pfam10676
261594003367	Protein of unknown function (DUF2772); Region: DUF2772; pfam10970
261594003368	Spore germination protein GerPC; Region: GerPC; pfam10737
261594003369	Protein of unknown function (DUF2539); Region: DUF2539; pfam10803
261594003370	Spore germination protein gerPA/gerPF; Region: gerPA; pfam10676
261594003371	2-keto-4-pentenoate hydratase/2-oxohepta-3-ene-1,7-dioic acid hydratase (catechol pathway) [Secondary metabolites biosynthesis, transport, and catabolism]; Region: MhpD; COG0179
261594003372	Fumarylacetoacetate (FAA) hydrolase family; Region: FAA_hydrolase; pfam01557
261594003373	ornithine--oxo-acid transaminase; Provisional; Region: rocD; PRK04073
261594003374	Acetyl ornithine aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to ornithine aminotransferase, acetylornithine aminotransferase; Region: OAT_like; cd00610
261594003375	inhibitor-cofactor binding pocket; inhibition site
261594003376	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594003377	catalytic residue [active]
261594003378	hypothetical protein; Provisional; Region: PRK13673
261594003379	Protein of unknown function (DUF2777); Region: DUF2777; pfam10949
261594003380	Glutamine amidotransferases class-II (GATase) asparagine synthase_B type.  Asparagine synthetase B catalyses the ATP-dependent conversion of aspartate to asparagine. This enzyme is a homodimer, with each monomer composed of a  glutaminase domain and a...; Region: AsnB; cd00712
261594003381	active site
261594003382	asparagine synthase (glutamine-hydrolyzing); Region: asn_synth_AEB; TIGR01536
261594003383	dimer interface [polypeptide binding]; other site
261594003384	The C-terminal domain of Asparagine Synthase B. This domain is always found associated n-terminal amidotransferase domain. Family members that contain this domain catalyse the conversion of aspartate to asparagine. Asparagine synthetase B  catalyzes the...; Region: Asn_Synthase_B_C; cd01991
261594003385	Ligand Binding Site [chemical binding]; other site
261594003386	Molecular Tunnel; other site
261594003387	ferrochelatase; Provisional; Region: PRK12435
261594003388	Ferrochelatase, N-terminal domain: Ferrochelatase (protoheme ferrolyase or HemH) is the terminal enzyme of the heme biosynthetic pathway. It catalyzes the insertion of ferrous iron into the protoporphyrin IX ring yielding protoheme. This enzyme is...; Region: Ferrochelatase_N; cd03411
261594003389	C-terminal domain interface [polypeptide binding]; other site
261594003390	active site
261594003391	Ferrochelatase, C-terminal domain: Ferrochelatase (protoheme ferrolyase or HemH) is the terminal enzyme of the heme biosynthetic pathway. It catalyzes the insertion of ferrous iron into the protoporphyrin IX ring yielding protoheme. This enzyme is...; Region: Ferrochelatase_C; cd00419
261594003392	active site
261594003393	N-terminal domain interface [polypeptide binding]; other site
261594003394	Catalase [Inorganic ion transport and metabolism]; Region: KatE; COG0753
261594003395	Clade 1 of the heme-binding enzyme catalase; Region: catalase_clade_1; cd08154
261594003396	tetramer interface [polypeptide binding]; other site
261594003397	heme binding pocket [chemical binding]; other site
261594003398	Alpha amylase catalytic domain family; Region: AmyAc_family; cl07893
261594003399	Glycosidases [Carbohydrate transport and metabolism]; Region: AmyA; COG0366
261594003400	active site
261594003401	catalytic site [active]
261594003402	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
261594003403	non-specific DNA binding site [nucleotide binding]; other site
261594003404	salt bridge; other site
261594003405	sequence-specific DNA binding site [nucleotide binding]; other site
261594003406	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cl02429
261594003407	binding surface
261594003408	TPR motif; other site
261594003409	Tetratricopeptide repeat; Region: TPR_12; pfam13424
261594003410	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG1666
261594003411	Proteins similar to Escherichia coli YajQ; Region: YajQ_like; cd11740
261594003412	Predicted RNA-bindining protein (contains S1 and HTH domains) [General function prediction only]; Region: COG2996
261594003413	S1 domain; Region: S1_2; pfam13509
261594003414	peptidylprolyl isomerase; Reviewed; Region: prsA; PRK03002
261594003415	PPIC-type PPIASE domain; Region: Rotamase; pfam00639
261594003416	Uncharacterized conserved protein [Function unknown]; Region: COG1284
261594003417	Uncharacterized BCR, YitT family COG1284; Region: DUF161; pfam02588
261594003418	Uncharacterized BCR, YitT family COG1284; Region: DUF161; pfam02588
261594003419	Uncharacterized protein conserved in bacteria (DUF2179); Region: DUF2179; pfam10035
261594003420	Protein of unknown function (DUF3813); Region: DUF3813; pfam12758
261594003421	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
261594003422	haloacid dehalogenase-like hydrolase; Region: Hydrolase_3; pfam08282
261594003423	active site
261594003424	motif I; other site
261594003425	motif II; other site
261594003426	haloacid dehalogenase-like hydrolase; Region: HAD; cl17202
261594003427	YjzC-like protein; Region: YjzC; pfam14168
261594003428	ATP-dependent chaperone ClpB; Region: chaperone_ClpB; TIGR03346
261594003429	Clp amino terminal domain; Region: Clp_N; pfam02861
261594003430	Clp amino terminal domain; Region: Clp_N; pfam02861
261594003431	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
261594003432	Walker A motif; other site
261594003433	ATP binding site [chemical binding]; other site
261594003434	Walker B motif; other site
261594003435	arginine finger; other site
261594003436	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
261594003437	Walker A motif; other site
261594003438	ATP binding site [chemical binding]; other site
261594003439	Walker B motif; other site
261594003440	C-terminal, D2-small domain, of ClpB protein; Region: ClpB_D2-small; pfam10431
261594003441	Protein of unknown function (DUF2929); Region: DUF2929; pfam11151
261594003442	Lysophospholipase [Lipid metabolism]; Region: PldB; COG2267
261594003443	proline-specific peptidase, Bacillus coagulans-type subfamily; Region: pro_imino_pep_2; TIGR01250
261594003444	NAD dependent epimerase/dehydratase family; Region: Epimerase; pfam01370
261594003445	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
261594003446	NAD(P) binding site [chemical binding]; other site
261594003447	active site
261594003448	ComZ; Region: ComZ; pfam10815
261594003449	3-oxoacyl-(acyl carrier protein) synthase III; Reviewed; Region: PRK09352
261594003450	Ketoacyl-acyl carrier protein synthase III (KASIII) initiates the elongation in type II fatty acid synthase systems. It is found in bacteria and plants. Elongation of fatty acids in the type II systems occurs by Claisen condensation of malonyl-acyl...; Region: KAS_III; cd00830
261594003451	dimer interface [polypeptide binding]; other site
261594003452	active site
261594003453	CoA binding pocket [chemical binding]; other site
261594003454	beta-ketoacyl-acyl-carrier-protein synthase II; Region: fabF; TIGR03150
261594003455	Beta-ketoacyl-acyl carrier protein (ACP) synthase (KAS), type I and II. KASs are responsible for the elongation steps in fatty acid biosynthesis. KASIII catalyses the initial condensation and KAS I and II catalyze further elongation steps by Claisen...; Region: KAS_I_II; cd00834
261594003456	dimer interface [polypeptide binding]; other site
261594003457	active site
261594003458	Predicted Zn-dependent protease (DUF2268); Region: DUF2268; pfam10026
261594003459	Protein of unknown function (DUF3603); Region: DUF3603; pfam12227
261594003460	tryptophanyl-tRNA synthetase II; Reviewed; Region: PRK12282
261594003461	catalytic core domain of tryptophanyl-tRNA synthetase; Region: TrpRS_core; cd00806
261594003462	active site
261594003463	HIGH motif; other site
261594003464	dimer interface [polypeptide binding]; other site
261594003465	KMSKS motif; other site
261594003466	Domain of unknown function (DUF3899); Region: DUF3899; pfam13038
261594003467	ABC-type oligopeptide transport system, periplasmic component [Amino acid transport and metabolism]; Region: OppA; COG4166
261594003468	The substrate-binding component of an ABC-type oligopetide import system contains the type 2 periplasmic binding fold; Region: PBP2_OppA; cd08504
261594003469	peptide binding site [polypeptide binding]; other site
261594003470	ABC-type dipeptide/oligopeptide/nickel transport systems, permease components [Amino acid transport and metabolism / Inorganic ion transport and metabolism]; Region: DppB; COG0601
261594003471	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
261594003472	dimer interface [polypeptide binding]; other site
261594003473	conserved gate region; other site
261594003474	putative PBP binding loops; other site
261594003475	ABC-ATPase subunit interface; other site
261594003476	N-terminal TM domain of oligopeptide transport permease C; Region: OppC_N; pfam12911
261594003477	oligopeptide ABC transporter permease OppC; Provisional; Region: PRK15406
261594003478	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
261594003479	dimer interface [polypeptide binding]; other site
261594003480	conserved gate region; other site
261594003481	putative PBP binding loops; other site
261594003482	ABC-ATPase subunit interface; other site
261594003483	ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component [Amino acid transport and metabolism / Inorganic ion transport and metabolism]; Region: DppD; COG0444
261594003484	ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257
261594003485	Walker A/P-loop; other site
261594003486	ATP binding site [chemical binding]; other site
261594003487	Q-loop/lid; other site
261594003488	ABC transporter signature motif; other site
261594003489	Walker B; other site
261594003490	D-loop; other site
261594003491	H-loop/switch region; other site
261594003492	Oligopeptide/dipeptide transporter, C-terminal region; Region: oligo_HPY; cl07097
261594003493	ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component [Amino acid transport and metabolism / Inorganic ion transport and metabolism]; Region: DppF; COG1124
261594003494	ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257
261594003495	Walker A/P-loop; other site
261594003496	ATP binding site [chemical binding]; other site
261594003497	Q-loop/lid; other site
261594003498	ABC transporter signature motif; other site
261594003499	Walker B; other site
261594003500	D-loop; other site
261594003501	H-loop/switch region; other site
261594003502	Oligopeptide/dipeptide transporter, C-terminal region; Region: oligo_HPY; cl07097
261594003503	Na+-driven multidrug efflux pump [Defense mechanisms]; Region: NorM; COG0534
261594003504	Uncharacterized subfamily of the multidrug and toxic compound extrusion (MATE) proteins; Region: MATE_like_8; cd13134
261594003505	ABC-type oligopeptide transport system, periplasmic component [Amino acid transport and metabolism]; Region: OppA; COG4166
261594003506	The substrate-binding component of an ABC-type oligopetide import system contains the type 2 periplasmic binding fold; Region: PBP2_OppA; cd08504
261594003507	peptide binding site [polypeptide binding]; other site
261594003508	Arsenate Reductase (ArsC) family, Spx subfamily; Spx is a unique RNA polymerase (RNAP)-binding protein present in bacilli and some mollicutes. It inhibits transcription by binding to the C-terminal domain of the alpha subunit of RNAP, disrupting complex...; Region: ArsC_Spx; cd03032
261594003509	ArsC family; Region: ArsC; pfam03960
261594003510	putative catalytic residues [active]
261594003511	thiol/disulfide switch; other site
261594003512	integral membrane protein, YjbE family; Region: R_switched_YjbE; TIGR03717
261594003513	adaptor protein; Provisional; Region: PRK02315
261594003514	cardiolipin synthetase; Reviewed; Region: cls; PRK01642
261594003515	Phospholipase_D-nuclease N-terminal; Region: PLDc_N; pfam13396
261594003516	Catalytic domain, repeat 1, of bacterial cardiolipin synthase and similar proteins; Region: PLDc_CLS_1; cd09110
261594003517	putative active site [active]
261594003518	catalytic site [active]
261594003519	catalytic domain repeat 2 of bacterial cardiolipin synthase and similar proteins; Region: PLDc_CLS_2; cd09112
261594003520	putative active site [active]
261594003521	catalytic site [active]
261594003522	Competence protein CoiA-like family; Region: CoiA; cl11541
261594003523	oligoendopeptidase F; Region: pepF; TIGR00181
261594003524	Peptidase family M3B Oligopeptidase F (PepF); Region: M3B_PepF_3; cd09608
261594003525	active site
261594003526	Zn binding site [ion binding]; other site
261594003527	Predicted dithiol-disulfide isomerase involved in polyketide biosynthesis [Secondary metabolites biosynthesis, transport, and catabolism]; Region: FrnE; COG2761
261594003528	DsbA family, FrnE-like subfamily; composed of uncharacterized proteins containing a CXXC motif with similarity to DsbA and FrnE. FrnE is presumed to be a thiol oxidoreductase involved in polyketide biosynthesis, specifically in the production of the...; Region: DsbA_FrnE_like; cd03025
261594003529	catalytic residues [active]
261594003530	Truncated hemoglobins (trHbs) are a family of oxygen-binding heme proteins found in cyanobacteria, eubacteria, unicellular eukaryotes, and plants. The truncated hemoglobins have a characteristic two-over-two alpha helical folding pattern that is distinct...; Region: Trunc_globin; cd00454
261594003531	apolar tunnel; other site
261594003532	heme binding site [chemical binding]; other site
261594003533	dimerization interface [polypeptide binding]; other site
261594003534	Uncharacterized subgroup 1 of the CYTH-like superfamily; Region: CYTH-like_Pase_1; cd07762
261594003535	putative active site [active]
261594003536	putative metal binding residues [ion binding]; other site
261594003537	signature motif; other site
261594003538	putative triphosphate binding site [ion binding]; other site
261594003539	Nucleotidyltransferase (NT) domain of RelA- and SpoT-like ppGpp synthetases and hydrolases; Region: NT_Rel-Spo_like; cd05399
261594003540	synthetase active site [active]
261594003541	NTP binding site [chemical binding]; other site
261594003542	metal binding site [ion binding]; metal-binding site
261594003543	inorganic polyphosphate/ATP-NAD kinase; Provisional; Region: ppnK; PRK04885
261594003544	ATP-NAD kinase; Region: NAD_kinase; pfam01513
261594003545	Pseudouridylate synthases, 23S RNA-specific [Translation, ribosomal structure and biogenesis]; Region: RluA; COG0564
261594003546	Pseudouridine synthase, RsuA/RluD family; Region: PseudoU_synth_RluCD_like; cd02869
261594003547	active site
261594003548	bis(5'-nucleosyl)-tetraphosphatase PrpE; Provisional; Region: PRK13625
261594003549	Bacillus subtilis PrpE and related proteins, metallophosphatase domain; Region: MPP_PrpE; cd07423
261594003550	active site
261594003551	metal binding site [ion binding]; metal-binding site
261594003552	Glycosyltransferase like family 2; Region: Glyco_tranf_2_3; pfam13641
261594003553	Glycosyltransferase family A (GT-A) includes diverse families of glycosyl transferases with a common GT-A type structural fold; Region: Glyco_tranf_GTA_type; cd00761
261594003554	active site
261594003555	Methyltransferase domain; Region: Methyltransf_31; pfam13847
261594003556	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594003557	S-adenosylmethionine binding site [chemical binding]; other site
261594003558	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cl17173
261594003559	UDP-glucose LOS-beta-1,4 glucosyltransferase is required for biosynthesis of lipooligosaccharide; Region: Beta4Glucosyltransferase; cd02511
261594003560	putative metal binding site; other site
261594003561	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cd00189
261594003562	binding surface
261594003563	TPR motif; other site
261594003564	Methyltransferase domain; Region: Methyltransf_23; pfam13489
261594003565	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594003566	S-adenosylmethionine binding site [chemical binding]; other site
261594003567	Glycosyltransferase like family; Region: Glyco_tranf_2_5; pfam13712
261594003568	Glycosyltransferase like family; Region: Glyco_tranf_2_5; pfam13712
261594003569	Glycosyltransferase family A (GT-A) includes diverse families of glycosyl transferases with a common GT-A type structural fold; Region: Glyco_tranf_GTA_type; cl11394
261594003570	dTDP-glucose pyrophosphorylase [Cell envelope biogenesis, outer membrane]; Region: RfbA; COG1209
261594003571	active site
261594003572	dTDP-4-dehydrorhamnose 3,5-epimerase; Region: dTDP_sugar_isom; pfam00908
261594003573	dTDP-D-glucose 4,6-dehydratase [Cell envelope biogenesis, outer membrane]; Region: RfbB; COG1088
261594003574	dTDP-D-glucose 4,6-dehydratase, extended (e) SDRs; Region: dTDP_GD_SDR_e; cd05246
261594003575	NAD binding site [chemical binding]; other site
261594003576	substrate binding site [chemical binding]; other site
261594003577	homodimer interface [polypeptide binding]; other site
261594003578	active site
261594003579	dTDP-6-deoxy-L-lyxo-4-hexulose reductase and related proteins, extended (e) SDRs; Region: dTDP_HR_like_SDR_e; cd05254
261594003580	RmlD substrate binding domain; Region: RmlD_sub_bind; pfam04321
261594003581	NADP binding site [chemical binding]; other site
261594003582	active site
261594003583	putative substrate binding site [chemical binding]; other site
261594003584	enoyl-(acyl carrier protein) reductase; Provisional; Region: PRK08594
261594003585	Enoyl acyl carrier protein (ACP) reductase (ENR), divergent SDR; Region: ENR_SDR; cd05372
261594003586	NAD binding site [chemical binding]; other site
261594003587	homotetramer interface [polypeptide binding]; other site
261594003588	homodimer interface [polypeptide binding]; other site
261594003589	substrate binding site [chemical binding]; other site
261594003590	active site
261594003591	Spore coat protein CotO; Region: Spore_coat_CotO; pfam14153
261594003592	Spore coat protein Z; Region: Spore-coat_CotZ; pfam10612
261594003593	Protein of unknown function (DUF1360); Region: DUF1360; pfam07098
261594003594	Spore coat protein Z; Region: Spore-coat_CotZ; pfam10612
261594003595	Superfamily I DNA and RNA helicases [DNA replication, recombination, and repair]; Region: UvrD; COG0210
261594003596	Part of AAA domain; Region: AAA_19; pfam13245
261594003597	Family description; Region: UvrD_C_2; pfam13538
261594003598	Acetyltransferase (GNAT) domain; Region: Acetyltransf_5; cl17496
261594003599	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594003600	Coenzyme A binding pocket [chemical binding]; other site
261594003601	hypothetical protein; Provisional; Region: PRK13679
261594003602	LigT like Phosphoesterase; Region: LigT_PEase; pfam02834
261594003603	Putative esterase; Region: Esterase; pfam00756
261594003604	Predicted hydrolase of the alpha/beta superfamily [General function prediction only]; Region: COG2819
261594003605	EamA-like transporter family; Region: EamA; pfam00892
261594003606	Carboxylate/Amino Acid/Amine Transporter; Region: 2A78; TIGR00950
261594003607	EamA-like transporter family; Region: EamA; pfam00892
261594003608	Domain of unknown function (DUF1200); Region: DUF1200; pfam06713
261594003609	Bacterial surface proteins containing Ig-like domains [Cell motility and secretion]; Region: COG5492
261594003610	Na(+)/proline cotransporter PutP and related proteins; solute binding domain; Region: SLC5sbd_PutP; cd11475
261594003611	Na binding site [ion binding]; other site
261594003612	anthranilate synthase component I; Provisional; Region: PRK13570
261594003613	Anthranilate synthase component I, N terminal region; Region: Anth_synt_I_N; pfam04715
261594003614	chorismate binding enzyme; Region: Chorismate_bind; pfam00425
261594003615	para-aminobenzoate synthase component II; Provisional; Region: PRK08857
261594003616	Type 1 glutamine amidotransferase (GATase1) domain found in Anthranilate synthase; Region: GATase1_Anthranilate_Synthase; cd01743
261594003617	glutamine binding [chemical binding]; other site
261594003618	catalytic triad [active]
261594003619	anthranilate phosphoribosyltransferase; Provisional; Region: trpD; PRK00188
261594003620	Glycosyl transferase family, helical bundle domain; Region: Glycos_trans_3N; pfam02885
261594003621	Glycosyl transferase family, a/b domain; Region: Glycos_transf_3; pfam00591
261594003622	Indole-3-glycerol phosphate synthase (IGPS); an enzyme in the tryptophan biosynthetic pathway, catalyzing the ring closure reaction of 1-(o-carboxyphenylamino)-1-deoxyribulose-5-phosphate (CdRP) to indole-3-glycerol phosphate (IGP), accompanied by the...; Region: IGPS; cd00331
261594003623	active site
261594003624	ribulose/triose binding site [chemical binding]; other site
261594003625	phosphate binding site [ion binding]; other site
261594003626	substrate (anthranilate) binding pocket [chemical binding]; other site
261594003627	product (indole) binding pocket [chemical binding]; other site
261594003628	Phosphoribosylanthranilate isomerase (PRAI) catalyzes the fourth step of the tryptophan biosynthesis, the conversion of N-(5'- phosphoribosyl)-anthranilate (PRA) to 1-(o-carboxyphenylamino)- 1-deoxyribulose 5-phosphate (CdRP). Most PRAIs are...; Region: PRAI; cd00405
261594003629	active site
261594003630	tryptophan synthase, beta subunit; Region: trpB; TIGR00263
261594003631	Tryptophan synthase-beta:  Trptophan synthase is a bifunctional enzyme that catalyses the last two steps in the biosynthesis of L-tryptophan via its alpha and beta reactions. In the alpha reaction, indole 3-glycerol phosphate is cleaved reversibly to...; Region: Trp-synth_B; cd06446
261594003632	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594003633	catalytic residue [active]
261594003634	tryptophan synthase alpha subunit; Provisional; Region: trpA; CHL00200
261594003635	Ttryptophan synthase (TRPS) alpha subunit (TSA). TPRS is a bifunctional tetrameric enzyme (2 alpha and 2 beta subunits) that catalyzes the last two steps of L-tryptophan biosynthesis. Alpha and beta subunit catalyze two distinct reactions which are both...; Region: Tryptophan_synthase_alpha; cd04724
261594003636	substrate binding site [chemical binding]; other site
261594003637	active site
261594003638	catalytic residues [active]
261594003639	heterodimer interface [polypeptide binding]; other site
261594003640	Protein of unknown function (DUF4029); Region: DUF4029; pfam13221
261594003641	L-lactate permease [Energy production and conversion]; Region: LldP; COG1620
261594003642	L-lactate permease; Region: Lactate_perm; cl00701
261594003643	Uncharacterized conserved protein (DUF2278); Region: DUF2278; pfam10042
261594003644	zinc-ribbon domain; Region: zf-ribbon_3; pfam13248
261594003645	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
261594003646	CoA-disulfide reductase; Region: CoA_CoA_reduc; TIGR03385
261594003647	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
261594003648	Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain; Region: Pyr_redox_dim; pfam02852
261594003649	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594003650	Coenzyme A binding pocket [chemical binding]; other site
261594003651	Protein of unknown function (DUF3908); Region: DUF3908; pfam13048
261594003652	This family is the oxydase domain of NRPS (non-ribosomal peptide synthetase) and other proteins that modify polypeptides by cyclizing a thioester to form a ring. These include epoB, part of the epothilone biosynthesis pathway; tubD, part of the tubulysin...; Region: mcbC-like_oxidoreductase; cd02142
261594003653	NADPH bind site [chemical binding]; other site
261594003654	putative FMN binding site [chemical binding]; other site
261594003655	This family is the oxydase domain of NRPS (non-ribosomal peptide synthetase) and other proteins that modify polypeptides by cyclizing a thioester to form a ring. These include epoB, part of the epothilone biosynthesis pathway; tubD, part of the tubulysin...; Region: mcbC-like_oxidoreductase; cd02142
261594003656	putative FMN binding site [chemical binding]; other site
261594003657	NADPH bind site [chemical binding]; other site
261594003658	bacteriocin biosynthesis cyclodehydratase domain; Region: cyclo_dehyd_2; TIGR03882
261594003659	YcaO-like family; Region: YcaO; pfam02624
261594003660	thiazole/oxazole-forming peptide maturase, SagD family component; Region: TOMM_cyclo_SagD; TIGR03604
261594003661	putative thiazole-containing bacteriocin maturation protein; Region: ocin_ThiF_like; TIGR03693
261594003662	bacteriocin biosynthesis cyclodehydratase domain; Region: cyclo_dehyd_2; TIGR03882
261594003663	dihydrolipoamide succinyltransferase; Validated; Region: PRK05704
261594003664	Lipoyl domain of the dihydrolipoyl acyltransferase component (E2) of 2-oxo acid dehydrogenases. 2-oxo acid dehydrogenase multienzyme complexes, like pyruvate dehydrogenase (PDH), 2-oxoglutarate dehydrogenase (OGDH) and branched-chain 2-oxo acid...; Region: lipoyl_domain; cd06849
261594003665	E3 interaction surface; other site
261594003666	lipoyl attachment site [posttranslational modification]; other site
261594003667	e3 binding domain; Region: E3_binding; pfam02817
261594003668	2-oxoacid dehydrogenases acyltransferase (catalytic domain); Region: 2-oxoacid_dh; pfam00198
261594003669	2-oxoglutarate dehydrogenase E1 component; Reviewed; Region: sucA; PRK09404
261594003670	Thiamine pyrophosphate (TPP) family, E1 of OGDC-like subfamily, TPP-binding module; composed of proteins similar to the E1 component of the 2-oxoglutarate dehydrogenase multienzyme complex (OGDC). OGDC catalyzes the oxidative decarboxylation of...; Region: TPP_E1_OGDC_like; cd02016
261594003671	TPP-binding site [chemical binding]; other site
261594003672	Transketolase, pyrimidine binding domain; Region: Transket_pyr; pfam02779
261594003673	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
261594003674	salt bridge; other site
261594003675	non-specific DNA binding site [nucleotide binding]; other site
261594003676	sequence-specific DNA binding site [nucleotide binding]; other site
261594003677	Domain of unknown function (DUF3976); Region: DUF3976; pfam13121
261594003678	Proteins of 100 residues with WXG; Region: WXG100; pfam06013
261594003679	WXG100 family type VII secretion target; Region: WXG100_ESAT6; TIGR03930
261594003680	Domain of unknown function (DUF4176); Region: DUF4176; pfam13780
261594003681	cxxc_20_cxxc protein; Region: cxxc_20_cxxc; TIGR04104
261594003682	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594003683	S-adenosylmethionine binding site [chemical binding]; other site
261594003684	Beta-lactamase enzyme family; Region: Beta-lactamase2; cl17872
261594003685	D-alanyl-D-alanine carboxypeptidase; Region: Peptidase_S11; pfam00768
261594003686	Penicillin-binding protein 5, C-terminal domain; Region: PBP5_C; smart00936
261594003687	Signal peptidase I [Intracellular trafficking and secretion]; Region: LepB; COG0681
261594003688	The S26 Type I signal peptidase (SPase; LepB; leader peptidase B; leader peptidase I; EC 3.4.21.89) family members are essential membrane-bound serine proteases that function to cleave the amino-terminal signal peptide extension from proteins that are...; Region: S26_SPase_I; cd06530
261594003689	Catalytic site [active]
261594003690	Camelysin metallo-endopeptidase; Region: Peptidase_M73; cl13780
261594003691	Domain of unknown function (DUF4047); Region: DUF4047; pfam13256
261594003692	Camelysin metallo-endopeptidase; Region: Peptidase_M73; pfam12389
261594003693	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
261594003694	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
261594003695	non-specific DNA binding site [nucleotide binding]; other site
261594003696	salt bridge; other site
261594003697	sequence-specific DNA binding site [nucleotide binding]; other site
261594003698	Anti-repressor SinI; Region: SinI; pfam08671
261594003699	Anti-repressor SinI; Region: SinI; pfam08671
261594003700	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4412
261594003701	Immune inhibitor A peptidase M6; Region: Peptidase_M6; pfam05547
261594003702	aldehyde dehydrogenase family protein; Provisional; Region: PTZ00381
261594003703	Bacillus subtilis aldehyde dehydrogenase ywdH-like; Region: ALDH_YwdH-P39616; cd07136
261594003704	NAD(P) binding site [chemical binding]; other site
261594003705	catalytic residues [active]
261594003706	ABC-type spermidine/putrescine transport systems, ATPase components [Amino acid transport and metabolism]; Region: PotA; COG3842
261594003707	ATP-binding cassette domain of the polyamine transporter; Region: ABC_PotA_N; cd03300
261594003708	Walker A/P-loop; other site
261594003709	ATP binding site [chemical binding]; other site
261594003710	Q-loop/lid; other site
261594003711	ABC transporter signature motif; other site
261594003712	Walker B; other site
261594003713	D-loop; other site
261594003714	H-loop/switch region; other site
261594003715	TOBE domain; Region: TOBE_2; pfam08402
261594003716	ABC-type Fe3+ transport system, permease component [Inorganic ion transport and metabolism]; Region: ThiP; COG1178
261594003717	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
261594003718	dimer interface [polypeptide binding]; other site
261594003719	conserved gate region; other site
261594003720	putative PBP binding loops; other site
261594003721	ABC-ATPase subunit interface; other site
261594003722	ABC-type spermidine/putrescine transport system, permease component II [Amino acid transport and metabolism]; Region: PotC; COG1177
261594003723	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
261594003724	dimer interface [polypeptide binding]; other site
261594003725	conserved gate region; other site
261594003726	putative PBP binding loops; other site
261594003727	ABC-ATPase subunit interface; other site
261594003728	spermidine/putrescine ABC transporter periplasmic substrate-binding protein; Reviewed; Region: potD; PRK09501
261594003729	Bacterial extracellular solute-binding protein; Region: SBP_bac_6; pfam13343
261594003730	PAP2_like_2 proteins. PAP2 is a super-family of phosphatases and haloperoxidases. This subgroup, which is specific to bacteria, lacks functional characterization and may act as a membrane-associated lipid phosphatase; Region: PAP2_like_2; cd03392
261594003731	Membrane-associated phospholipid phosphatase [Lipid metabolism]; Region: PgpB; COG0671
261594003732	active site
261594003733	Predicted exporters of the RND superfamily [General function prediction only]; Region: COG1033
261594003734	Sterol-sensing domain of SREBP cleavage-activation; Region: Sterol-sensing; pfam12349
261594003735	Pseudouridylate synthases, 23S RNA-specific [Translation, ribosomal structure and biogenesis]; Region: RluA; COG0564
261594003736	Pseudouridine synthase, RsuA/RluD family; Region: PseudoU_synth_RluCD_like; cd02869
261594003737	active site
261594003738	Protein of unknown function (DUF1648); Region: DUF1648; pfam07853
261594003739	Uncharacterized protein with SCP/PR1 domains [Function unknown]; Region: COG2340
261594003740	SCP_bacterial: SCP-like extracellular protein domain, as found in bacteria and archaea. The wider family of SCP containing proteins includes plant pathogenesis-related protein 1 (PR-1), CRISPs, mammalian cysteine-rich secretory proteins, and allergen 5...; Region: SCP_bacterial; cd05379
261594003741	The HCP family of iron-sulfur proteins includes hybrid cluster protein (HCP), acetyl-CoA synthase (ACS), and carbon monoxide dehydrogenase (CODH), all of which contain [Fe4-S4] metal clusters at their active sites. These proteins have a conserved...; Region: HCP_like; cl14655
261594003742	Fe-S oxidoreductase [Energy production and conversion]; Region: GlpC; COG0247
261594003743	Cysteine-rich domain; Region: CCG; pfam02754
261594003744	Cysteine-rich domain; Region: CCG; pfam02754
261594003745	FAD binding domain; Region: FAD_binding_4; pfam01565
261594003746	glycolate oxidase, subunit GlcD; Region: glcD; TIGR00387
261594003747	Sugar diacid utilization regulator [Transcription / Signal transduction mechanisms]; Region: CdaR; COG3835
261594003748	Putative sugar diacid recognition; Region: Diacid_rec; pfam05651
261594003749	PucR C-terminal helix-turn-helix domain; Region: HTH_30; pfam13556
261594003750	40-residue YVTN family beta-propeller repeat; Region: beta_rpt_yvtn; TIGR02276
261594003751	40-residue YVTN family beta-propeller repeat; Region: beta_rpt_yvtn; TIGR02276
261594003752	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
261594003753	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594003754	active site
261594003755	phosphorylation site [posttranslational modification]
261594003756	intermolecular recognition site; other site
261594003757	dimerization interface [polypeptide binding]; other site
261594003758	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
261594003759	DNA binding site [nucleotide binding]
261594003760	Methyl-accepting chemotaxis protein [Cell motility and secretion / Signal transduction mechanisms]; Region: Tar; COG0840
261594003761	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
261594003762	dimerization interface [polypeptide binding]; other site
261594003763	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
261594003764	dimer interface [polypeptide binding]; other site
261594003765	phosphorylation site [posttranslational modification]
261594003766	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594003767	ATP binding site [chemical binding]; other site
261594003768	Mg2+ binding site [ion binding]; other site
261594003769	G-X-G motif; other site
261594003770	Transcriptional regulators [Transcription]; Region: FadR; COG2186
261594003771	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
261594003772	DNA-binding site [nucleotide binding]; DNA binding site
261594003773	This entry represents the C-terminal ligand binding domain of many members of the GntR family; Region: FCD; smart00895
261594003774	CoB--CoM heterodisulfide reductase, subunit B; Region: CoB_CoM_SS_B; TIGR03288
261594003775	Cysteine-rich domain; Region: CCG; pfam02754
261594003776	Cysteine-rich domain; Region: CCG; pfam02754
261594003777	Uncharacterized conserved protein containing a ferredoxin-like domain [Energy production and conversion]; Region: COG1139
261594003778	Uncharacterized ACR, YkgG family COG1556; Region: DUF162; pfam02589
261594003779	Domain of unknown function (DUF3390); Region: DUF3390; pfam11870
261594003780	Uncharacterized conserved protein [Function unknown]; Region: COG1556
261594003781	Type II secretory pathway, prepilin signal peptidase PulO and related peptidases [Cell motility and secretion / Posttranslational modification, protein turnover, chaperones / Intracellular trafficking and secretion]; Region: PulO; COG1989
261594003782	Bacterial Peptidase A24 N-terminal domain; Region: DiS_P_DiS; pfam06750
261594003783	Type IV leader peptidase family; Region: Peptidase_A24; pfam01478
261594003784	Formate/nitrite transporter; Region: Form_Nir_trans; pfam01226
261594003785	integral membrane protein, YkoY family; Region: R_switched_YkoY; TIGR03716
261594003786	Trk-type K+ transport systems, membrane components [Inorganic ion transport and metabolism]; Region: TrkG; COG0168
261594003787	potassium uptake protein, TrkH family; Region: 2a38; TIGR00933
261594003788	Small, acid-soluble spore proteins, alpha/beta type; Region: SASP; pfam00269
261594003789	(R)-hydratase [(R)-specific enoyl-CoA hydratase] catalyzes the hydration of trans-2-enoyl CoA to (R)-3-hydroxyacyl-CoA as part of the PHA (polyhydroxyalkanoate) biosynthetic pathway. (R)-hydratase contains a hot-dog fold similar to those of thioesterase...; Region: R_hydratase; cd03449
261594003790	dimer interaction site [polypeptide binding]; other site
261594003791	substrate-binding tunnel; other site
261594003792	active site
261594003793	catalytic site [active]
261594003794	substrate binding site [chemical binding]; other site
261594003795	Polyhydroxyalkanoic acid inclusion protein (PhaP_Bmeg); Region: PhaP_Bmeg; cl09820
261594003796	poly-beta-hydroxybutyrate-responsive repressor; Region: repress_PhaQ; TIGR02719
261594003797	Predicted transcriptional regulators [Transcription]; Region: COG1695
261594003798	polyhydroxyalkanoic acid synthase, PhaR subunit; Region: phaR_Bmeg; TIGR02132
261594003799	acetoacetyl-CoA reductase; Provisional; Region: PRK12935
261594003800	beta-Keto acyl carrier protein reductase (BKR), involved in Type II FAS, classical (c) SDRs; Region: BKR_SDR_c; cd05333
261594003801	NAD(P) binding site [chemical binding]; other site
261594003802	homotetramer interface [polypeptide binding]; other site
261594003803	homodimer interface [polypeptide binding]; other site
261594003804	active site
261594003805	poly(R)-hydroxyalkanoic acid synthase, class III, PhaC subunit; Region: PHA_synth_III_C; TIGR01836
261594003806	Poly-beta-hydroxybutyrate polymerase (PhaC) N-terminus; Region: PhaC_N; pfam07167
261594003807	PHB de-polymerase C-terminus; Region: PHB_depo_C; pfam06850
261594003808	putative aminophosphonate oxidoreductase; Region: Phn_aa_oxid; TIGR03329
261594003809	Glycine/D-amino acid oxidases (deaminating) [Amino acid transport and metabolism]; Region: DadA; COG0665
261594003810	potassium uptake protein, TrkH family; Region: 2a38; TIGR00933
261594003811	Trk-type K+ transport systems, membrane components [Inorganic ion transport and metabolism]; Region: TrkG; COG0168
261594003812	Protein of unknown function (DUF3905); Region: DUF3905; pfam13045
261594003813	putative 2-aminoethylphosphonate ABC transporter, periplasmic 2-aminoethylphosphonate-binding protein; Region: phnS2; TIGR03261
261594003814	ABC-type thiamine transport system, periplasmic component [Coenzyme metabolism]; Region: TbpA; COG4143
261594003815	phosphonoacetaldehyde hydrolase; Provisional; Region: PRK13478
261594003816	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
261594003817	motif II; other site
261594003818	2-aminoethylphosphonate--pyruvate transaminase; Provisional; Region: PRK13479
261594003819	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
261594003820	catalytic residue [active]
261594003821	Saccharopine dehydrogenase; Region: Saccharop_dh; pfam03435
261594003822	Transcriptional regulators of sugar metabolism [Transcription / Carbohydrate transport and metabolism]; Region: GlpR; COG1349
261594003823	DeoR-like helix-turn-helix domain; Region: HTH_DeoR; cl17531
261594003824	DeoR C terminal sensor domain; Region: DeoRC; pfam00455
261594003825	FOG: CBS domain [General function prediction only]; Region: COG0517
261594003826	The CBS domain, named after human CBS, is a small domain originally identified in cystathionine beta-synthase and is subsequently found in a wide range of different proteins. CBS domains usually occur in tandem repeats. They associate to form a so-called...; Region: CBS_pair; cd02205
261594003827	Putative catalytic domain of family 2 polysaccharide deacetylases (DACs) from bacteria; Region: CE4_DAC2; cd10936
261594003828	NodB motif; other site
261594003829	putative active site [active]
261594003830	putative catalytic site [active]
261594003831	Zn binding site [ion binding]; other site
261594003832	Spo0E like sporulation regulatory protein; Region: SpoOE-like; pfam09388
261594003833	Protein of unknown function (DUF3149); Region: DUF3149; pfam11346
261594003834	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
261594003835	dimer interface [polypeptide binding]; other site
261594003836	phosphorylation site [posttranslational modification]
261594003837	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594003838	ATP binding site [chemical binding]; other site
261594003839	Mg2+ binding site [ion binding]; other site
261594003840	G-X-G motif; other site
261594003841	helix_turn_helix multiple antibiotic resistance protein; Region: HTH_MARR; smart00347
261594003842	MarR family; Region: MarR; pfam01047
261594003843	Peptidase family M3B Oligopeptidase F (PepF); Region: M3B_PepF_1; cd09606
261594003844	oligoendopeptidase, M3 family; Region: M3_not_pepF; TIGR02289
261594003845	active site
261594003846	Zn binding site [ion binding]; other site
261594003847	DinB superfamily; Region: DinB_2; pfam12867
261594003848	5TMR of 5TMR-LYT; Region: 5TM-5TMR_LYT; pfam07694
261594003849	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
261594003850	dimer interface [polypeptide binding]; other site
261594003851	phosphorylation site [posttranslational modification]
261594003852	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594003853	ATP binding site [chemical binding]; other site
261594003854	Mg2+ binding site [ion binding]; other site
261594003855	G-X-G motif; other site
261594003856	ExsB is a transcription regulator related protein. It is a subfamily of a Adenosine nucleotide binding superfamily of proteins. This protein family is represented by a single member in nearly every completed large (> 1000 genes) prokaryotic genome. In...; Region: ExsB; cd01995
261594003857	Ligand Binding Site [chemical binding]; other site
261594003858	6-pyruvoyl tetrahydropterin synthase; Region: PTPS; pfam01242
261594003859	active site
261594003860	7-cyano-7-deazaguanosine (preQ0) biosynthesis protein QueE; Region: Bsubt_queE; TIGR03365
261594003861	putative 7-cyano-7-deazaguanosine (preQ0) biosynthesis protein QueE; Region: rSAM_QueE_Ecoli; TIGR04322
261594003862	7-cyano-7-deazaguanine reductase; Provisional; Region: PRK13258
261594003863	Uncharacterized protein conserved in bacteria (DUF2187); Region: DUF2187; pfam09953
261594003864	Histidine phosphatase domain found in a functionally diverse set of proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP; cl11399
261594003865	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594003866	Acetyltransferases [General function prediction only]; Region: RimI; COG0456
261594003867	Coenzyme A binding pocket [chemical binding]; other site
261594003868	ribonucleotide reductase stimulatory protein; Reviewed; Region: nrdI; PRK03600
261594003869	ribonucleotide-diphosphate reductase subunit alpha; Validated; Region: PRK07632
261594003870	Ribonucleotide reductase N-terminal; Region: RNR_N; pfam08343
261594003871	Class I ribonucleotide reductase; Region: RNR_I; cd01679
261594003872	active site
261594003873	dimer interface [polypeptide binding]; other site
261594003874	catalytic residues [active]
261594003875	effector binding site; other site
261594003876	R2 peptide binding site; other site
261594003877	ribonucleotide-diphosphate reductase subunit beta; Provisional; Region: nrdF2; PRK13966
261594003878	Ribonucleotide Reductase, R2/beta subunit, ferritin-like diiron-binding domain; Region: RNRR2; cd01049
261594003879	dimer interface [polypeptide binding]; other site
261594003880	putative radical transfer pathway; other site
261594003881	diiron center [ion binding]; other site
261594003882	tyrosyl radical; other site
261594003883	Predicted transcriptional regulators [Transcription]; Region: COG1725
261594003884	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
261594003885	DNA-binding site [nucleotide binding]; DNA binding site
261594003886	ABC-type cobalt transport system, ATPase component [Inorganic ion transport and metabolism]; Region: CbiO; COG1122
261594003887	ATP-binding cassette domain of the drug resistance transporter and related proteins, subfamily A; Region: ABC_DR_subfamily_A; cd03230
261594003888	Walker A/P-loop; other site
261594003889	ATP binding site [chemical binding]; other site
261594003890	Q-loop/lid; other site
261594003891	ABC transporter signature motif; other site
261594003892	Walker B; other site
261594003893	D-loop; other site
261594003894	H-loop/switch region; other site
261594003895	ABC-type multidrug transport system, ATPase component [Defense mechanisms]; Region: CcmA; COG1131
261594003896	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
261594003897	Walker A/P-loop; other site
261594003898	ATP binding site [chemical binding]; other site
261594003899	Q-loop/lid; other site
261594003900	ABC transporter signature motif; other site
261594003901	Walker B; other site
261594003902	D-loop; other site
261594003903	H-loop/switch region; other site
261594003904	ABC-2 family transporter protein; Region: ABC2_membrane_2; cl17866
261594003905	ABC-2 family transporter protein; Region: ABC2_membrane_4; pfam12730
261594003906	CAAX protease self-immunity; Region: Abi; pfam02517
261594003907	SpoVT / AbrB like domain; Region: SpoVT_AbrB; smart00966
261594003908	Protein of unknown function (DUF3913); Region: DUF3913; pfam13052
261594003909	Transcriptional regulators [Transcription]; Region: Lrp; COG1522
261594003910	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
261594003911	putative DNA binding site [nucleotide binding]; other site
261594003912	putative Zn2+ binding site [ion binding]; other site
261594003913	AsnC family; Region: AsnC_trans_reg; pfam01037
261594003914	Uncharacterized conserved protein [Function unknown]; Region: COG2128
261594003915	Isochorismatase family; Region: Isochorismatase; pfam00857
261594003916	Nicotinamidase_ related amidohydrolases.  Cysteine hydrolases of unknown function that share the catalytic triad with other amidohydrolases, like nicotinamidase, which converts nicotinamide to nicotinic acid and ammonia; Region: nicotinamidase_related; cd01014
261594003917	catalytic triad [active]
261594003918	conserved cis-peptide bond; other site
261594003919	SseB protein; Region: SseB; cl06279
261594003920	LD-Carboxypeptidase, a serine protease, includes microcin C7 self immunity protein; Region: Peptidase_S66; cd07025
261594003921	dimer interface [polypeptide binding]; other site
261594003922	catalytic triad [active]
261594003923	Dioxygenases related to 2-nitropropane dioxygenase [General function prediction only]; Region: COG2070
261594003924	2-Nitropropane dioxygenase (NPD), one of the nitroalkane oxidizing enzyme families, catalyzes oxidative denitrification of nitroalkanes to their corresponding carbonyl compounds and nitrites. NDP is a member of the NAD(P)H-dependent flavin oxidoreductase...; Region: NPD_like; cd04730
261594003925	FMN binding site [chemical binding]; other site
261594003926	substrate binding site [chemical binding]; other site
261594003927	putative catalytic residue [active]
261594003928	D-alanyl-lipoteichoic acid biosynthesis protein DltD; Region: LTA_DltD; TIGR04092
261594003929	DltD N-terminal region; Region: DltD_N; pfam04915
261594003930	DltD central region; Region: DltD_M; pfam04918
261594003931	DltD C-terminal region; Region: DltD_C; pfam04914
261594003932	D-alanine--poly(phosphoribitol) ligase subunit 2; Validated; Region: PRK05087
261594003933	D-alanyl-lipoteichoic acid biosynthesis protein DltB; Region: LTA_dltB; TIGR04091
261594003934	D-alanine--poly(phosphoribitol) ligase subunit 1; Provisional; Region: PRK04813
261594003935	D-alanine:D-alanyl carrier protein ligase (DltA); Region: DltA; cd05945
261594003936	acyl-activating enzyme (AAE) consensus motif; other site
261594003937	AMP binding site [chemical binding]; other site
261594003938	D-Ala-teichoic acid biosynthesis protein; Region: DUF3687; pfam12459
261594003939	Metal-dependent amidase/aminoacylase/carboxypeptidase [General function prediction only]; Region: AbgB; COG1473
261594003940	M20 Peptidase Aminoacylase 1 family; Region: M20_Acy1; cd03886
261594003941	metal binding site [ion binding]; metal-binding site
261594003942	dimer interface [polypeptide binding]; other site
261594003943	flavodoxin; Provisional; Region: PRK06756
261594003944	Uncharacterized flavoproteins [Energy production and conversion]; Region: FpaA; COG0426
261594003945	Phosphotransferase enzyme family; Region: APH; pfam01636
261594003946	Aminoglycoside 3'-phosphotransferase (APH) and Choline Kinase (ChoK) family. The APH/ChoK family is part of a larger superfamily that includes the catalytic domains of other kinases, such as the typical serine/threonine/tyrosine protein kinases (PKs)...; Region: APH_ChoK_like; cl17270
261594003947	active site
261594003948	substrate binding site [chemical binding]; other site
261594003949	ATP binding site [chemical binding]; other site
261594003950	Wnt and FGF inhibitory regulator; Region: Shisa; pfam13908
261594003951	multidrug efflux protein; Reviewed; Region: PRK01766
261594003952	Subfamily of the multidrug and toxic compound extrusion (MATE)-like proteins similar to Vibrio cholerae NorM; Region: MATE_NorM_like; cd13131
261594003953	cation binding site [ion binding]; other site
261594003954	undecaprenyl pyrophosphate phosphatase; Reviewed; Region: PRK00281
261594003955	TRX family; composed of two groups: Group I, which includes proteins that exclusively encode a TRX domain; and Group II, which are composed of fusion proteins of TRX and additional domains. Group I TRX is a small ancient protein that alter the redox...; Region: TRX_family; cd02947
261594003956	catalytic residues [active]
261594003957	Regulatory protein YrvL; Region: YrvL; pfam14184
261594003958	helix_turn_helix multiple antibiotic resistance protein; Region: HTH_MARR; smart00347
261594003959	Winged helix DNA-binding domain; Region: HTH_27; pfam13463
261594003960	Na+/H+-dicarboxylate symporters [Energy production and conversion]; Region: GltP; COG1301
261594003961	Sodium:dicarboxylate symporter family; Region: SDF; pfam00375
261594003962	Trk-type K+ transport systems, membrane components [Inorganic ion transport and metabolism]; Region: TrkG; COG0168
261594003963	potassium uptake protein, TrkH family; Region: 2a38; TIGR00933
261594003964	Sporulation protein YtfJ (Spore_YtfJ); Region: Spore_YtfJ; cl01596
261594003965	hypothetical protein; Provisional; Region: PRK03094
261594003966	Protein of unknown function (DUF3911); Region: DUF3911; pfam13050
261594003967	Branched-chain amino acid aminotransferase/4-amino-4-deoxychorismate lyase [Amino acid transport and metabolism / Coenzyme metabolism]; Region: IlvE; COG0115
261594003968	D-Alanine aminotransferase (D-AAT_like): D-amino acid aminotransferase catalyzes transamination between D-amino acids and their respective alpha-keto acids. It plays a major role in the synthesis of bacterial cell wall components like D-alanine and...; Region: D-AAT_like; cd01558
261594003969	homodimer interface [polypeptide binding]; other site
261594003970	substrate-cofactor binding pocket; other site
261594003971	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594003972	catalytic residue [active]
261594003973	acetolactate synthase catalytic subunit; Reviewed; Region: PRK07710
261594003974	Pyrimidine (PYR) binding domain of POX and related proteins; Region: TPP_PYR_POX_like; cd07035
261594003975	PYR/PP interface [polypeptide binding]; other site
261594003976	dimer interface [polypeptide binding]; other site
261594003977	TPP binding site [chemical binding]; other site
261594003978	Thiamine pyrophosphate enzyme, central domain; Region: TPP_enzyme_M; pfam00205
261594003979	Thiamine pyrophosphate (TPP) family, Acetohydroxyacid synthase (AHAS) subfamily, TPP-binding module; composed of proteins similar to the large catalytic subunit of AHAS. AHAS catalyzes the condensation of two molecules of pyruvate to give the...; Region: TPP_AHAS; cd02015
261594003980	TPP-binding site [chemical binding]; other site
261594003981	dimer interface [polypeptide binding]; other site
261594003982	acetolactate synthase 3 regulatory subunit; Reviewed; Region: ilvH; PRK11895
261594003983	N-terminal ACT domain of the Escherichia coli IlvH-like regulatory subunit of acetohydroxyacid synthase (AHAS); Region: ACT_AHAS; cd04878
261594003984	putative valine binding site [chemical binding]; other site
261594003985	dimer interface [polypeptide binding]; other site
261594003986	Small subunit of acetolactate synthase; Region: ALS_ss_C; pfam10369
261594003987	ketol-acid reductoisomerase; Provisional; Region: PRK05479
261594003988	Acetohydroxy acid isomeroreductase, catalytic domain; Region: IlvN; pfam07991
261594003989	Acetohydroxy acid isomeroreductase, catalytic domain; Region: IlvC; pfam01450
261594003990	2-isopropylmalate synthase; Validated; Region: PRK00915
261594003991	2-isopropylmalate synthase (IPMS), N-terminal catalytic TIM barrel domain; Region: DRE_TIM_IPMS; cd07940
261594003992	active site
261594003993	catalytic residues [active]
261594003994	metal binding site [ion binding]; metal-binding site
261594003995	LeuA allosteric (dimerisation) domain; Region: LeuA_dimer; pfam08502
261594003996	3-isopropylmalate dehydrogenase; Provisional; Region: PRK00772
261594003997	tartrate dehydrogenase; Region: TTC; TIGR02089
261594003998	3-isopropylmalate dehydratase large subunit; Reviewed; Region: PRK00402
261594003999	3-isopropylmalate dehydratase catalyzes the isomerization between 2-isopropylmalate and 3-isopropylmalate; Region: IPMI; cd01583
261594004000	substrate binding site [chemical binding]; other site
261594004001	ligand binding site [chemical binding]; other site
261594004002	isopropylmalate isomerase small subunit; Provisional; Region: leuD; PRK01641
261594004003	Aconatase-like swivel domain of 3-isopropylmalate dehydratase and related uncharacterized proteins. 3-isopropylmalate dehydratase catalyzes the isomerization between 2-isopropylmalate and 3-isopropylmalate, via the formation of 2-isopropylmaleate...; Region: IPMI_Swivel; cd01577
261594004004	substrate binding site [chemical binding]; other site
261594004005	ATP phosphoribosyltransferase regulatory subunit; Provisional; Region: hisZ; PRK12292
261594004006	Class II Histidinyl-tRNA synthetase (HisRS)-like catalytic core domain. HisRS is a homodimer. It is responsible for the attachment of histidine to the 3' OH group of ribose of the appropriate tRNA. This domain is primarily responsible for...; Region: HisRS-like_core; cd00773
261594004007	dimer interface [polypeptide binding]; other site
261594004008	motif 1; other site
261594004009	active site
261594004010	motif 2; other site
261594004011	motif 3; other site
261594004012	ATP phosphoribosyltransferase catalytic subunit; Reviewed; Region: hisG; PRK01686
261594004013	ATP phosphoribosyltransferase [Amino acid transport and metabolism]; Region: HisG; COG0040
261594004014	Histidinol dehydrogenase, HisD, E.C 1.1.1.23. Histidinol dehydrogenase catalyzes the last two steps in the L-histidine biosynthesis pathway, which is conserved in bacteria, archaea, fungi, and plants. These last two steps are (i) the NAD-dependent...; Region: Histidinol_dh; cd06572
261594004015	histidinol dehydrogenase; Region: hisD; TIGR00069
261594004016	NAD binding site [chemical binding]; other site
261594004017	dimerization interface [polypeptide binding]; other site
261594004018	product binding site; other site
261594004019	substrate binding site [chemical binding]; other site
261594004020	zinc binding site [ion binding]; other site
261594004021	catalytic residues [active]
261594004022	Imidazoleglycerol-phosphate dehydratase; Region: IGPD; cd07914
261594004023	putative active site pocket [active]
261594004024	4-fold oligomerization interface [polypeptide binding]; other site
261594004025	metal binding residues [ion binding]; metal-binding site
261594004026	3-fold/trimer interface [polypeptide binding]; other site
261594004027	imidazole glycerol phosphate synthase subunit HisH; Provisional; Region: hisH; PRK13141
261594004028	Type 1 glutamine amidotransferase (GATase1) domain found in imidazole glycerol phosphate synthase (IGPS); Region: GATase1_IGP_Synthase; cd01748
261594004029	putative active site [active]
261594004030	oxyanion strand; other site
261594004031	catalytic triad [active]
261594004032	HisA.  Phosphoribosylformimino-5-aminoimidazole carboxamide ribonucleotide (ProFAR) isomerase catalyzes the fourth step in histidine biosynthesis, an isomerisation of the aminoaldose moiety of ProFAR to the aminoketose of PRFAR (N-(5'-phospho-D-1...; Region: HisA; cd04732
261594004033	phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase; Region: TIGR00007
261594004034	catalytic residues [active]
261594004035	The cyclase subunit of imidazoleglycerol phosphate synthase (HisF). Imidazole glycerol phosphate synthase (IGPS) catalyzes the fifth step of histidine biosynthesis, the formation of the imidazole ring. IGPS converts N1-(5'-phosphoribulosyl)...; Region: HisF; cd04731
261594004036	Histidine biosynthesis protein; Region: His_biosynth; pfam00977
261594004037	substrate binding site [chemical binding]; other site
261594004038	glutamase interaction surface [polypeptide binding]; other site
261594004039	phosphoribosyl-AMP cyclohydrolase; Reviewed; Region: hisI; PRK00051
261594004040	Nucleoside Triphosphate Pyrophosphohydrolase (EC 3.6.1.8) MazG-like domain found in Escherichia coli phosphoribosyl-ATP pyrophosphohydrolase (HisIE or PRATP-PH) and its homologs; Region: NTP-PPase_HisIE_like; cd11534
261594004041	metal binding site [ion binding]; metal-binding site
261594004042	histidinol-phosphatase; Validated; Region: PRK06740
261594004043	Polymerase and Histidinol Phosphatase domain of Histidinol phosphate phosphatase of Hisj like; Region: PHP_HisPPase_Hisj_like; cd12110
261594004044	dimer interface [polypeptide binding]; other site
261594004045	active site
261594004046	Putative D-isomer specific 2-hydroxyacid dehydrogenases, NAD-binding and catalytic domains; Region: 2-Hacid_dh_13; cd12178
261594004047	Lactate dehydrogenase and related dehydrogenases [Energy production and conversion / Coenzyme metabolism / General function prediction only]; Region: LdhA; COG1052
261594004048	putative ligand binding site [chemical binding]; other site
261594004049	putative NAD binding site [chemical binding]; other site
261594004050	catalytic site [active]
261594004051	CDP-alcohol phosphatidyltransferase; Region: CDP-OH_P_transf; pfam01066
261594004052	CDP-diacylglycerol--serine O-phosphatidyltransferase; Region: pssA; TIGR00473
261594004053	Phosphoglycerol transferase and related proteins, alkaline phosphatase superfamily [Cell envelope biogenesis, outer membrane]; Region: MdoB; COG1368
261594004054	Sulfatase; Region: Sulfatase; pfam00884
261594004055	Protein of unknown function (DUF3888); Region: DUF3888; pfam13027
261594004056	diaminopimelate decarboxylase; Region: lysA; TIGR01048
261594004057	Type III Pyridoxal 5-phosphate (PLP)-Dependent Enzyme Diaminopimelate Decarboxylase; Region: PLPDE_III_DapDC; cd06828
261594004058	active site
261594004059	pyridoxal 5'-phosphate (PLP) binding site [chemical binding]; other site
261594004060	substrate binding site [chemical binding]; other site
261594004061	catalytic residues [active]
261594004062	dimer interface [polypeptide binding]; other site
261594004063	Uncharacterized small protein (DUF2292); Region: DUF2292; pfam10055
261594004064	3'-phosphoadenosine 5'-phosphosulfate sulfotransferase (PAPS reductase)/FAD synthetase and related enzymes [Amino acid transport and metabolism / Coenzyme metabolism]; Region: CysH; COG0175
261594004065	This domain is found in phosphoadenosine phosphosulphate (PAPS) reductase enzymes or PAPS sulphotransferase. PAPS reductase is part of the adenine nucleotide alpha hydrolases superfamily also including N type ATP PPases and ATP sulphurylases. A highly...; Region: PAPS_reductase; cd01713
261594004066	Active Sites [active]
261594004067	sulfate adenylyltransferase; Reviewed; Region: sat; PRK04149
261594004068	ATP-sulfurylase; Region: ATPS; cd00517
261594004069	active site
261594004070	HXXH motif; other site
261594004071	flexible loop; other site
261594004072	Adenosine 5'-phosphosulfate kinase (APSK) catalyzes the phosphorylation of adenosine 5'-phosphosulfate to form 3'-phosphoadenosine 5'-phosphosulfate (PAPS). The end-product PAPS is a biologically "activated" sulfate form...; Region: APSK; cd02027
261594004073	ligand-binding site [chemical binding]; other site
261594004074	ferredoxin-nitrite reductase; Reviewed; Region: nirA; PRK09566
261594004075	Nitrite/Sulfite reductase ferredoxin-like half domain; Region: NIR_SIR_ferr; pfam03460
261594004076	Nitrite/Sulfite reductase ferredoxin-like half domain; Region: NIR_SIR_ferr; pfam03460
261594004077	Protein of unknown function (DUF3906); Region: DUF3906; pfam13046
261594004078	Uroporphyrin-III C-methyltransferase (S-Adenosyl-L-methionine:uroporphyrinogen III methyltransferase, SUMT); Region: SUMT; cd11642
261594004079	diphthine synthase; Region: dph5; TIGR00522
261594004080	active site
261594004081	SAM binding site [chemical binding]; other site
261594004082	homodimer interface [polypeptide binding]; other site
261594004083	Sirohydrochlorin ferrochelatase [Inorganic ion transport and metabolism]; Region: COG2138
261594004084	Sirohydrochlorin cobalt chelatase (CbiX) and sirohydrochlorin iron chelatase (SirB), N-terminal domain. SirB catalyzes the ferro-chelation of sirohydrochlorin to siroheme, the prosthetic group of sulfite and nitrite reductases. CbiX is a cobaltochelatase; Region: CbiX_SirB_N; cd03416
261594004085	putative active site [active]
261594004086	Sirohydrochlorin cobalt chelatase (CbiX) and sirohydrochlorin iron chelatase (SirB), C-terminal domain. SirB catalyzes the ferro-chelation of sirohydrochlorin to siroheme, the prosthetic group of sulfite and nitrite reductases. CbiX is a cobaltochelatase; Region: CbiX_SirB_C; cd03414
261594004087	putative active site [active]
261594004088	precorrin-2 dehydrogenase; Reviewed; Region: PRK06718
261594004089	Putative NAD(P)-binding; Region: NAD_binding_7; pfam13241
261594004090	solute carrier 6 subfamily, Fusobacterium nucleatum Tyt1-like; solute-binding domain; Region: SLC6sbd_Tyt1-Like; cd10336
261594004091	Na2 binding site [ion binding]; other site
261594004092	putative substrate binding site 1 [chemical binding]; other site
261594004093	Na binding site 1 [ion binding]; other site
261594004094	putative substrate binding site 2 [chemical binding]; other site
261594004095	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3883
261594004096	Membrane proteins related to metalloendopeptidases [Cell envelope biogenesis, outer membrane]; Region: NlpD; COG0739
261594004097	Peptidase family M23; Region: Peptidase_M23; pfam01551
261594004098	Na+/H+-dicarboxylate symporters [Energy production and conversion]; Region: GltP; COG1301
261594004099	Sodium:dicarboxylate symporter family; Region: SDF; cl00573
261594004100	Protein of unknown function (DUF402); Region: DUF402; cl00979
261594004101	Na+/H+ antiporter family; Region: Na_H_antiporter; pfam03553
261594004102	Vpu protein; Region: Vpu; pfam00558
261594004103	PspA/IM30 family; Region: PspA_IM30; pfam04012
261594004104	Cell wall-active antibiotics response protein (DUF2154); Region: DUF2154; pfam09922
261594004105	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: COG4585
261594004106	Histidine kinase; Region: HisKA_3; pfam07730
261594004107	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594004108	ATP binding site [chemical binding]; other site
261594004109	Mg2+ binding site [ion binding]; other site
261594004110	G-X-G motif; other site
261594004111	Response regulator containing a CheY-like receiver domain and an HTH DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: CitB; COG2197
261594004112	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594004113	active site
261594004114	phosphorylation site [posttranslational modification]
261594004115	intermolecular recognition site; other site
261594004116	dimerization interface [polypeptide binding]; other site
261594004117	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
261594004118	DNA binding residues [nucleotide binding]
261594004119	dimerization interface [polypeptide binding]; other site
261594004120	Lipoyl domain of the dihydrolipoyl acyltransferase component (E2) of 2-oxo acid dehydrogenases. 2-oxo acid dehydrogenase multienzyme complexes, like pyruvate dehydrogenase (PDH), 2-oxoglutarate dehydrogenase (OGDH) and branched-chain 2-oxo acid...; Region: lipoyl_domain; cd06849
261594004121	E3 interaction surface; other site
261594004122	lipoyl attachment site [posttranslational modification]; other site
261594004123	Branched-chain amino acid transport protein; Region: Branch_AA_trans; pfam05525
261594004124	Methyltransferase domain; Region: Methyltransf_31; pfam13847
261594004125	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594004126	S-adenosylmethionine binding site [chemical binding]; other site
261594004127	Uncharacterized homologs of Site-2 protease (S2P), zinc metalloproteases (MEROPS family M50) which cleave transmembrane domains of substrate proteins, regulating intramembrane proteolysis (RIP) of diverse signal transduction mechanisms. Members of the...; Region: S2P-M50_like_2; cd06160
261594004128	Peptidase family M50; Region: Peptidase_M50; pfam02163
261594004129	active site
261594004130	putative substrate binding region [chemical binding]; other site
261594004131	bifunctional nitric oxide dioxygenase/dihydropteridine reductase 2; Provisional; Region: PRK13289
261594004132	Globins are heme proteins, which bind and transport oxygen. This family summarizes a diverse set of homologous protein domains, including: (1) tetrameric vertebrate hemoglobins, which are the major protein component of erythrocytes and transport oxygen...; Region: globin; cd01040
261594004133	heme-binding site [chemical binding]; other site
261594004134	FAD_NAD(P)H binding domain of flavohemoglobin. Flavohemoglobins have a globin domain containing a B-type heme fused with a ferredoxin reductase-like FAD/NAD-binding domain. Flavohemoglobins detoxify nitric oxide (NO) via an NO dioxygenase reaction. The...; Region: flavohem_like_fad_nad_binding; cd06184
261594004135	FAD binding pocket [chemical binding]; other site
261594004136	FAD binding motif [chemical binding]; other site
261594004137	phosphate binding motif [ion binding]; other site
261594004138	beta-alpha-beta structure motif; other site
261594004139	NAD binding pocket [chemical binding]; other site
261594004140	Heme binding  pocket [chemical binding]; other site
261594004141	cAMP-binding proteins - catabolite gene activator and regulatory subunit of cAMP-dependent protein kinases [Signal transduction mechanisms]; Region: Crp; COG0664
261594004142	effector domain of the CAP family of transcription factors; members include CAP (or cAMP receptor protein (CRP)), which binds cAMP, FNR (fumarate and nitrate reduction), which uses an iron-sulfur cluster to sense oxygen) and CooA, a heme containing CO...; Region: CAP_ED; cd00038
261594004143	ligand binding site [chemical binding]; other site
261594004144	flexible hinge region; other site
261594004145	helix_turn_helix, cAMP Regulatory protein C-terminus; DNA binding domain of prokaryotic regulatory proteins belonging to the catabolite activator protein family; Region: HTH_CRP; cl17320
261594004146	Sulfite exporter TauE/SafE; Region: TauE; pfam01925
261594004147	Phosphate/sulphate permeases [Inorganic ion transport and metabolism]; Region: PitA; COG0306
261594004148	Phosphate transport regulator (distant homolog of PhoU) [Inorganic ion transport and metabolism]; Region: COG1392
261594004149	Transglycosylase; Region: Transgly; pfam00912
261594004150	penicillin-binding protein, 1A family; Region: PBP_1a_fam; TIGR02074
261594004151	Penicillin binding protein transpeptidase domain; Region: Transpeptidase; pfam00905
261594004152	Carbohydrate Binding Module 6 (CBM6) and CBM35_like superfamily; Region: CBM6-CBM35-CBM36_like; cl14880
261594004153	Protein of unknown function DUF72; Region: DUF72; pfam01904
261594004154	Protein of unknown function (DUF3924); Region: DUF3924; pfam13062
261594004155	DNA breaking-rejoining enzymes, C-terminal catalytic domain. The DNA breaking-rejoining enzyme superfamily includes type IB topoisomerases and tyrosine recombinases that share the same fold in their catalytic domain containing six conserved active site...; Region: DNA_BRE_C; cl00213
261594004156	active site
261594004157	DNA binding site [nucleotide binding]
261594004158	Int/Topo IB signature motif; other site
261594004159	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
261594004160	dimerization interface [polypeptide binding]; other site
261594004161	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
261594004162	dimer interface [polypeptide binding]; other site
261594004163	phosphorylation site [posttranslational modification]
261594004164	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594004165	ATP binding site [chemical binding]; other site
261594004166	Mg2+ binding site [ion binding]; other site
261594004167	G-X-G motif; other site
261594004168	purine nucleoside phosphorylase; Reviewed; Region: deoD; PRK05819
261594004169	Uridine phosphorylase [Nucleotide transport and metabolism]; Region: Udp; COG2820
261594004170	Probable transposase; Region: OrfB_IS605; pfam01385
261594004171	transposase, IS605 OrfB family, central region; Region: tspaseT_teng_C; TIGR01766
261594004172	Putative transposase DNA-binding domain; Region: OrfB_Zn_ribbon; pfam07282
261594004173	Predicted integral membrane protein [Function unknown]; Region: COG0392
261594004174	Uncharacterized conserved protein [Function unknown]; Region: COG2898
261594004175	Uncharacterized conserved protein (DUF2156); Region: DUF2156; pfam09924
261594004176	Protein of unknown function (DUF3907); Region: DUF3907; pfam13047
261594004177	Superoxide dismutase [Inorganic ion transport and metabolism]; Region: SodA; COG0605
261594004178	Iron/manganese superoxide dismutases, alpha-hairpin domain; Region: Sod_Fe_N; pfam00081
261594004179	Iron/manganese superoxide dismutases, C-terminal domain; Region: Sod_Fe_C; pfam02777
261594004180	Beta-lactamase enzyme family; Region: Beta-lactamase2; cl17872
261594004181	D-alanyl-D-alanine carboxypeptidase [Cell envelope biogenesis, outer membrane]; Region: DacC; COG1686
261594004182	Uncharacterized membrane protein, required for spore maturation in B.subtilis. [General function prediction only]; Region: SpmA; COG2715
261594004183	Uncharacterized membrane protein [Function unknown]; Region: SpmB; COG0700
261594004184	16S rRNA uridine-516 pseudouridylate synthase and related pseudouridylate synthases [Translation, ribosomal structure and biogenesis]; Region: RsuA; COG1187
261594004185	S4/Hsp/ tRNA synthetase RNA-binding domain; The domain surface is populated by conserved, charged residues that define a likely RNA-binding site;  Found in stress proteins, ribosomal proteins and tRNA synthetases; This may imply a hitherto unrecognized...; Region: S4; cd00165
261594004186	RNA binding surface [nucleotide binding]; other site
261594004187	Pseudouridine synthases, RsuA subfamily; Region: PseudoU_synth_RsuA_like; cd02870
261594004188	active site
261594004189	TlpA-like family; composed of  TlpA, ResA, DsbE and similar proteins. TlpA, ResA and DsbE are bacterial protein disulfide reductases with important roles in cytochrome maturation. They are membrane-anchored proteins with a soluble TRX domain containing a...; Region: TlpA_like_family; cd02966
261594004190	Thioredoxin-like; Region: Thioredoxin_8; pfam13905
261594004191	catalytic residues [active]
261594004192	ResB protein required for cytochrome c biosynthesis [Posttranslational modification, protein turnover, chaperones]; Region: ResB; COG1333
261594004193	ResB-like family; Region: ResB; pfam05140
261594004194	Cytochrome C assembly protein; Region: Cytochrom_C_asm; cl00504
261594004195	cytochrome c-type biogenesis protein CcsB; Region: cytochr_II_ccsB; TIGR03144
261594004196	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
261594004197	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594004198	active site
261594004199	phosphorylation site [posttranslational modification]
261594004200	intermolecular recognition site; other site
261594004201	dimerization interface [polypeptide binding]; other site
261594004202	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
261594004203	DNA binding site [nucleotide binding]
261594004204	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: VicK; COG5002
261594004205	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
261594004206	dimerization interface [polypeptide binding]; other site
261594004207	PAS domain; Region: PAS; smart00091
261594004208	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
261594004209	dimer interface [polypeptide binding]; other site
261594004210	phosphorylation site [posttranslational modification]
261594004211	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594004212	ATP binding site [chemical binding]; other site
261594004213	Mg2+ binding site [ion binding]; other site
261594004214	G-X-G motif; other site
261594004215	Cobalamin adenosyltransferase; Region: Cob_adeno_trans; pfam01923
261594004216	Membrane proteins related to metalloendopeptidases [Cell envelope biogenesis, outer membrane]; Region: NlpD; COG0739
261594004217	Peptidase family M23; Region: Peptidase_M23; pfam01551
261594004218	FOG: LysM repeat [Cell envelope biogenesis, outer membrane]; Region: LytE; COG1388
261594004219	Lysine Motif is a small domain involved in binding peptidoglycan; Region: LysM; cd00118
261594004220	Predicted membrane protein [Function unknown]; Region: COG3601
261594004221	Protein of unknown function (DUF3816); Region: DUF3816; pfam12822
261594004222	Ferredoxin [Energy production and conversion]; Region: Fer; COG1141
261594004223	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4955
261594004224	DEAD-like helicases superfamily; Region: DEXDc; smart00487
261594004225	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
261594004226	ATP binding site [chemical binding]; other site
261594004227	putative Mg++ binding site [ion binding]; other site
261594004228	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
261594004229	nucleotide binding region [chemical binding]; other site
261594004230	ATP-binding site [chemical binding]; other site
261594004231	CAAX protease self-immunity; Region: Abi; pfam02517
261594004232	Lysine Motif is a small domain involved in binding peptidoglycan; Region: LysM; cd00118
261594004233	MerR HTH family regulatory protein; Region: MerR_1; pfam13411
261594004234	Helix-Turn-Helix DNA binding domain of the transcription regulators MlrA and CarA; Region: HTH_MlrA-CarA; cd01104
261594004235	DNA binding residues [nucleotide binding]
261594004236	B12 binding domain; Region: B12-binding_2; pfam02607
261594004237	B12 binding domain (B12-BD). Most of the members bind different cobalamid derivates, like B12 (adenosylcobamide) or methylcobalamin or methyl-Co(III) 5-hydroxybenzimidazolylcobamide. This domain is found in several enzymes, such as glutamate mutase; Region: B12-binding_like; cl00293
261594004238	adaptor protein; Provisional; Region: PRK02899
261594004239	Glutamate dehydrogenase/leucine dehydrogenase [Amino acid transport and metabolism]; Region: GdhA; COG0334
261594004240	Glu/Leu/Phe/Val dehydrogenase, dimerisation domain; Region: ELFV_dehydrog_N; pfam02812
261594004241	NAD(P) binding domain of glutamate dehydrogenase, subgroup 1; Region: NAD_bind_1_Glu_DH; cd01076
261594004242	NAD(P) binding site [chemical binding]; other site
261594004243	Domain of unknown function (DUF3961); Region: DUF3961; pfam13106
261594004244	Peptidoglycan recognition proteins (PGRPs) are pattern recognition receptors that bind, and in certain cases, hydrolyze peptidoglycans (PGNs) of bacterial cell walls. PGRPs have been divided into three classes: short PGRPs (PGRP-S), that are small (20...; Region: PGRP; cd06583
261594004245	amidase catalytic site [active]
261594004246	Zn binding residues [ion binding]; other site
261594004247	substrate binding site [chemical binding]; other site
261594004248	putative bacillithiol system oxidoreductase, YpdA family; Region: Bthiol_YpdA; TIGR04018
261594004249	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox_3; pfam13738
261594004250	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
261594004251	Type II (periplasmic) bacterial L-asparaginase; Region: L-asparaginase_II; cd08964
261594004252	active site
261594004253	homotetramer interface [polypeptide binding]; other site
261594004254	homodimer interface [polypeptide binding]; other site
261594004255	cytidylate kinase; Provisional; Region: cmk; PRK00023
261594004256	Cytidine monophosphate kinase (CMPK) catalyzes the reversible phosphorylation of cytidine monophosphate (CMP) to produce cytidine diphosphate (CDP), using ATP as the preferred phosphoryl donor; Region: CMPK; cd02020
261594004257	CMP-binding site; other site
261594004258	The sites determining sugar specificity; other site
261594004259	30S ribosomal protein S1; Reviewed; Region: rpsA; PRK06676
261594004260	S1_RPS1_repeat_ec1_hs1: Ribosomal protein S1 (RPS1) domain. RPS1 is a component of the small ribosomal subunit thought to be involved in the recognition and binding of mRNA's during translation initiation. The bacterial RPS1 domain architecture...; Region: S1_RPS1_repeat_ec1_hs1; cd05687
261594004261	RNA binding site [nucleotide binding]; other site
261594004262	S1_RPS1_repeat_ec2_hs2: Ribosomal protein S1 (RPS1) domain. RPS1 is a component of the small ribosomal subunit thought to be involved in the recognition and binding of mRNA's during translation initiation. The bacterial RPS1 domain architecture...; Region: S1_RPS1_repeat_ec2_hs2; cd04465
261594004263	RNA binding site [nucleotide binding]; other site
261594004264	S1_RPS1_repeat_ec3: Ribosomal protein S1 (RPS1) domain. RPS1 is a component of the small ribosomal subunit thought to be involved in the recognition and binding of mRNA's during translation initiation. The bacterial RPS1 domain architecture consists...; Region: S1_RPS1_repeat_ec3; cd05688
261594004265	RNA binding site [nucleotide binding]; other site
261594004266	S1_RPS1_repeat_hs4: Ribosomal protein S1 (RPS1) domain. RPS1 is a component of the small ribosomal subunit thought to be involved in the recognition and binding of mRNA's during translation initiation. The bacterial RPS1 domain architecture consists...; Region: S1_RPS1_repeat_hs4; cd05692
261594004267	RNA binding site [nucleotide binding]; other site
261594004268	isopentenyl pyrophosphate isomerase; Provisional; Region: PRK05437
261594004269	Isopentenyl-diphosphate:dimethylallyl diphosphate isomerase type 2 (IDI-2) FMN-binding domain. Two types of IDIs have been characterized at present. The long known IDI-1 is only dependent on divalent metals for activity, whereas IDI-2 requires a metal; Region: IDI-2_FMN; cd02811
261594004270	homotetramer interface [polypeptide binding]; other site
261594004271	FMN binding site [chemical binding]; other site
261594004272	homodimer contacts [polypeptide binding]; other site
261594004273	putative active site [active]
261594004274	putative substrate binding site [chemical binding]; other site
261594004275	YpzI-like protein; Region: YpzI; pfam14140
261594004276	YIEGIA protein; Region: YIEGIA; pfam14045
261594004277	GTP-binding protein Der; Reviewed; Region: PRK00093
261594004278	EngA1 GTPase contains the first domain of EngA; Region: EngA1; cd01894
261594004279	G1 box; other site
261594004280	GTP/Mg2+ binding site [chemical binding]; other site
261594004281	Switch I region; other site
261594004282	G2 box; other site
261594004283	Switch II region; other site
261594004284	G3 box; other site
261594004285	G4 box; other site
261594004286	G5 box; other site
261594004287	EngA2 GTPase contains the second domain of EngA; Region: EngA2; cd01895
261594004288	G1 box; other site
261594004289	GTP/Mg2+ binding site [chemical binding]; other site
261594004290	Switch I region; other site
261594004291	G2 box; other site
261594004292	G3 box; other site
261594004293	Switch II region; other site
261594004294	G4 box; other site
261594004295	G5 box; other site
261594004296	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase; Validated; Region: gpsA; PRK00094
261594004297	NAD-dependent glycerol-3-phosphate dehydrogenase N-terminus; Region: NAD_Gly3P_dh_N; pfam01210
261594004298	NAD-dependent glycerol-3-phosphate dehydrogenase C-terminus; Region: NAD_Gly3P_dh_C; pfam07479
261594004299	Stage VI sporulation protein F; Region: SpoVIF; pfam14069
261594004300	Protein of unknown function (DUF2768); Region: DUF2768; pfam10966
261594004301	Stage IV sporulation protein A (spore_IV_A); Region: Spore_IV_A; pfam09547
261594004302	stage IV sporulation protein A; Region: spore_IV_A; TIGR02836
261594004303	Integration host factor (IHF) and HU are small heterodimeric members of the DNABII protein family that bind and bend DNA, functioning as architectural factors in many cellular processes including transcription, site-specific recombination, and...; Region: HU_IHF; cd00591
261594004304	IHF dimer interface [polypeptide binding]; other site
261594004305	IHF - DNA interface [nucleotide binding]; other site
261594004306	GTP cyclohydrolase I (GTP-CH-I) catalyzes the conversion of GTP into dihydroneopterin triphosphate.  The enzyme product is the precursor of tetrahydrofolate in eubacteria, fungi, and plants and of the folate analogs in methanogenic bacteria.  In...; Region: GTP_cyclohydro1; cd00642
261594004307	homodecamer interface [polypeptide binding]; other site
261594004308	GTP cyclohydrolase I; Provisional; Region: PLN03044
261594004309	active site
261594004310	putative catalytic site residues [active]
261594004311	zinc binding site [ion binding]; other site
261594004312	GTP-CH-I/GFRP interaction surface; other site
261594004313	Heptaprenyl diphosphate synthase (HEPPP synthase) subunit 1; Region: HEPPP_synt_1; pfam07307
261594004314	ubiE/COQ5 methyltransferase family; Region: Ubie_methyltran; pfam01209
261594004315	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594004316	S-adenosylmethionine binding site [chemical binding]; other site
261594004317	Geranylgeranyl pyrophosphate synthase [Coenzyme metabolism]; Region: IspA; COG0142
261594004318	Trans-Isoprenyl Diphosphate Synthases, head-to-tail; Region: Trans_IPPS_HT; cd00685
261594004319	substrate binding pocket [chemical binding]; other site
261594004320	chain length determination region; other site
261594004321	substrate-Mg2+ binding site; other site
261594004322	catalytic residues [active]
261594004323	aspartate-rich region 1; other site
261594004324	active site lid residues [active]
261594004325	aspartate-rich region 2; other site
261594004326	Nucleoside diphosphate kinase Group I (NDPk_I)-like: NDP kinase domains are present in a large family of structurally and functionally conserved proteins from bacteria to humans that generally catalyze the transfer of gamma-phosphates of a nucleoside...; Region: NDPk_I; cd04413
261594004327	active site
261594004328	multimer interface [polypeptide binding]; other site
261594004329	Chorismate synthase [Amino acid transport and metabolism]; Region: AroC; COG0082
261594004330	Chorismase synthase, the enzyme catalyzing the final step of the shikimate pathway; Region: Chorismate_synthase; cd07304
261594004331	Tetramer interface [polypeptide binding]; other site
261594004332	active site
261594004333	FMN-binding site [chemical binding]; other site
261594004334	Dehydroquinate synthase (DHQS) catalyzes the conversion of DAHP to DHQ in shikimate pathway for aromatic compounds synthesis; Region: DHQS; cd08195
261594004335	active site
261594004336	dimer interface [polypeptide binding]; other site
261594004337	metal binding site [ion binding]; metal-binding site
261594004338	histidinol-phosphate aminotransferase; Provisional; Region: PRK03158
261594004339	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
261594004340	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594004341	homodimer interface [polypeptide binding]; other site
261594004342	catalytic residue [active]
261594004343	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cd00189
261594004344	binding surface
261594004345	TPR motif; other site
261594004346	Anaphase-promoting complex, cyclosome, subunit 3; Region: Apc3; pfam12895
261594004347	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cd00189
261594004348	binding surface
261594004349	TPR motif; other site
261594004350	Tetratricopeptide repeat; Region: TPR_12; pfam13424
261594004351	TPR repeat; Region: TPR_11; pfam13414
261594004352	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cd00189
261594004353	binding surface
261594004354	TPR motif; other site
261594004355	hypothetical protein; Provisional; Region: PRK03636
261594004356	UPF0302 domain; Region: UPF0302; pfam08864
261594004357	IDEAL domain; Region: IDEAL; pfam08858
261594004358	Protein of unknown function (DUF2487); Region: DUF2487; pfam10673
261594004359	Rieske Fe-S protein [Energy production and conversion]; Region: QcrA; COG0723
261594004360	Rieske domain; a [2Fe-2S] cluster binding domain commonly found in Rieske non-heme iron oxygenase (RO) systems such as naphthalene and biphenyl dioxygenases, as well as in plant/cyanobacterial chloroplast b6f and mitochondrial cytochrome bc(1) complexes; Region: Rieske; cd03467
261594004361	iron-sulfur cluster [ion binding]; other site
261594004362	[2Fe-2S] cluster binding site [ion binding]; other site
261594004363	Cytochrome b subunit of the bc complex [Energy production and conversion]; Region: QcrB; COG1290
261594004364	Cytochrome b (N-terminus)/b6/petB:  Cytochrome b is a subunit of cytochrome bc1, an 11-subunit mitochondrial respiratory enzyme. Cytochrome b spans the mitochondrial membrane with 8 transmembrane helices (A-H) in eukaryotes. In plants and cyanobacteria; Region: Cytochrome_b_N; cd00284
261594004365	interchain domain interface [polypeptide binding]; other site
261594004366	intrachain domain interface; other site
261594004367	heme bH binding site [chemical binding]; other site
261594004368	Qi binding site; other site
261594004369	heme bL binding site [chemical binding]; other site
261594004370	Qo binding site; other site
261594004371	Cytochrome b subunit of the bc complex [Energy production and conversion]; Region: QcrB; COG1290
261594004372	Cytochrome b(C-terminus)/b6/petD:  Cytochrome b is a subunit of cytochrome bc1, an 11-subunit mitochondrial respiratory enzyme. Cytochrome b spans the mitochondrial membrane with 8 transmembrane helices (A-H) in eukaryotes. In plants and cyanobacteria; Region: cytochrome_b_C; cl00193
261594004373	interchain domain interface [polypeptide binding]; other site
261594004374	intrachain domain interface; other site
261594004375	Qi binding site; other site
261594004376	Qo binding site; other site
261594004377	Cytochrome c, mono- and diheme variants [Energy production and conversion]; Region: CccA; COG2010
261594004378	Cytochrome C oxidase, cbb3-type, subunit III; Region: Cytochrome_CBB3; pfam13442
261594004379	Protein of unknown function (DUF1405); Region: DUF1405; pfam07187
261594004380	Protein of unknown function (DUF1461); Region: DUF1461; pfam07314
261594004381	sporulation protein YpjB; Region: spore_ypjB; TIGR02878
261594004382	Putative neutral zinc metallopeptidase; Region: Zn_peptidase_2; pfam04298
261594004383	Family 4 Uracil-DNA glycosylase (UDG), found exclusively in thermophilic organisms; Region: UDG_F4_TTUDGA_like; cd10030
261594004384	active site
261594004385	Fe-S cluster binding site [ion binding]; other site
261594004386	Uncharacterized conserved protein [Function unknown]; Region: COG1284
261594004387	Uncharacterized BCR, YitT family COG1284; Region: DUF161; pfam02588
261594004388	Uncharacterized BCR, YitT family COG1284; Region: DUF161; pfam02588
261594004389	Uncharacterized protein conserved in bacteria (DUF2179); Region: DUF2179; pfam10035
261594004390	Nucleoside Triphosphate Pyrophosphohydrolase (EC 3.6.1.8) MazG-like domain putative pyrophosphatase YpjD from Bacillus subtilis and its bacterial homologs; Region: NTP-PPase_BsYpjD; cd11531
261594004391	homodimer interface [polypeptide binding]; other site
261594004392	metal binding site [ion binding]; metal-binding site
261594004393	dihydrodipicolinate reductase; Provisional; Region: PRK00048
261594004394	Dihydrodipicolinate reductase, N-terminus; Region: DapB_N; pfam01113
261594004395	Dihydrodipicolinate reductase, C-terminus; Region: DapB_C; pfam05173
261594004396	Methylglyoxal synthase catalyzes the enolization of dihydroxyacetone phosphate (DHAP) to produce methylglyoxal. The first part of the catalytic mechanism is believed to be similar to TIM (triosephosphate isomerase) in that both enzymes utilize DHAP to...; Region: MGS; cd01422
261594004397	active site
261594004398	dimer interfaces [polypeptide binding]; other site
261594004399	catalytic residues [active]
261594004400	bacillithiol biosynthesis deacetylase BshB1; Region: thiol_BshB1; TIGR04001
261594004401	N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA; Region: thiol_BshA; TIGR03999
261594004402	This family is most closely related to the GT1 family of glycosyltransferases. Glycosyltransferases catalyze the transfer of sugar moieties from activated donor molecules to specific acceptor molecules, forming glycosidic bonds. The acceptor molecule can...; Region: GT1_like_5; cd04962
261594004403	tRNA CCA-pyrophosphorylase; Provisional; Region: PRK13299
261594004404	Nucleotidyltransferase (NT) domain of ClassII CCA-adding enzymes; Region: NT_ClassII-CCAase; cd05398
261594004405	active site
261594004406	NTP binding site [chemical binding]; other site
261594004407	metal binding triad [ion binding]; metal-binding site
261594004408	Probable RNA and SrmB- binding site of polymerase A; Region: PolyA_pol_RNAbd; pfam12627
261594004409	tRNA nucleotidyltransferase domain 2 putative; Region: tRNA_NucTran2_2; pfam13735
261594004410	Biotin operon repressor [Transcription]; Region: BirA; COG1654
261594004411	Biotin-(acetyl-CoA carboxylase) ligase [Coenzyme metabolism]; Region: BirA; COG0340
261594004412	Biotin/lipoate A/B protein ligase family; Region: BPL_LplA_LipB; pfam03099
261594004413	Biotin protein ligase C terminal domain; Region: BPL_C; pfam02237
261594004414	Cupredoxin-like domain; Region: Cupredoxin_1; pfam13473
261594004415	Ketopantoate hydroxymethyltransferase (KPHMT) is the first enzyme in the pantothenate biosynthesis pathway. Ketopantoate hydroxymethyltransferase (KPHMT) catalyzes the first committed step in the biosynthesis of pantothenate (vitamin B5), which is a...; Region: KPHMT-like; cd06557
261594004416	oligomerization interface [polypeptide binding]; other site
261594004417	active site
261594004418	metal binding site [ion binding]; metal-binding site
261594004419	pantoate--beta-alanine ligase; Region: panC; TIGR00018
261594004420	Pantoate-beta-alanine ligase; Region: PanC; cd00560
261594004421	active site
261594004422	ATP-binding site [chemical binding]; other site
261594004423	pantoate-binding site; other site
261594004424	HXXH motif; other site
261594004425	Aspartate alpha-decarboxylase or L-aspartate 1-decarboxylase, a pyruvoyl group-dependent  decarboxylase in beta-alanine production; Region: Asp_decarbox; cd06919
261594004426	tetramerization interface [polypeptide binding]; other site
261594004427	active site
261594004428	bifunctional ATP-dependent DNA helicase/DNA polymerase III subunit epsilon; Validated; Region: PRK08074
261594004429	DEDDh 3'-5' exonuclease domain family; Region: DEDDh; cd06127
261594004430	active site
261594004431	catalytic site [active]
261594004432	substrate binding site [chemical binding]; other site
261594004433	CRISPR/Cas system-associated DinG family helicase Csf4; Region: Csf4_U; cl17460
261594004434	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
261594004435	nucleotide binding region [chemical binding]; other site
261594004436	Protein of unknown function (DUF4264); Region: DUF4264; pfam14084
261594004437	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG5353
261594004438	aspartate aminotransferase; Provisional; Region: PRK05764
261594004439	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
261594004440	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594004441	homodimer interface [polypeptide binding]; other site
261594004442	catalytic residue [active]
261594004443	Putative primosome component and related proteins [DNA replication, recombination, and repair]; Region: DnaD; COG3935
261594004444	Sugar-specific transcriptional regulator TrmB; Region: TrmB; cl17775
261594004445	Replication initiation and membrane attachment; Region: DnaB_2; pfam07261
261594004446	Predicted EndoIII-related endonuclease [DNA replication, recombination, and repair]; Region: Nth; COG0177
261594004447	endonuclease III; includes endonuclease III (DNA-(apurinic or apyrimidinic site) lyase), alkylbase DNA glycosidases (Alka-family) and other DNA glycosidases; Region: ENDO3c; cd00056
261594004448	minor groove reading motif; other site
261594004449	helix-hairpin-helix signature motif; other site
261594004450	substrate binding pocket [chemical binding]; other site
261594004451	active site
261594004452	iron-sulpphur binding domain in DNA-(apurinic or apyrimidinic site) lyase (subfamily of ENDO3); Region: FES; smart00525
261594004453	Transglycosylase; Region: Transgly; pfam00912
261594004454	penicillin-binding protein, 1A family; Region: PBP_1a_fam; TIGR02074
261594004455	Penicillin binding protein transpeptidase domain; Region: Transpeptidase; cl17760
261594004456	Fibronectin type 3 domain; One of three types of internal repeats found in the plasma protein fibronectin. Its tenth fibronectin type III repeat contains an RGD cell recognition sequence in a flexible loop between 2 strands. Approximately 2% of all...; Region: FN3; cd00063
261594004457	Interdomain contacts; other site
261594004458	Cytokine receptor motif; other site
261594004459	Holliday junction-specific endonuclease; Reviewed; Region: recU; PRK02234
261594004460	Protein of unknown function (DUF2515); Region: DUF2515; pfam10720
261594004461	Bacterial domain of unknown function (DUF1798); Region: DUF1798; pfam08807
261594004462	YppF-like protein; Region: YppF; pfam14178
261594004463	YppG-like protein; Region: YppG; pfam14179
261594004464	Inner spore coat protein D; Region: Spore-coat_CotD; pfam11122
261594004465	hypothetical protein; Provisional; Region: PRK13660
261594004466	cell division protein GpsB; Provisional; Region: PRK14127
261594004467	DivIVA domain; Region: DivI1A_domain; TIGR03544
261594004468	Predicted N6-adenine-specific DNA methylase [DNA replication, recombination, and repair]; Region: COG0116
261594004469	THUMP domain associated with S-adenosylmethionine-dependent methyltransferases; Region: THUMP_AdoMetMT; cd11715
261594004470	Putative RNA methylase family UPF0020; Region: UPF0020; pfam01170
261594004471	Protein of unknown function (DUF3921); Region: DUF3921; pfam13060
261594004472	Rad3-related DNA helicases [Transcription / DNA replication, recombination, and repair]; Region: DinG; COG1199
261594004473	CRISPR/Cas system-associated DinG family helicase Csf4; Region: Csf4_U; cl17460
261594004474	Helicase C-terminal domain; Region: Helicase_C_2; pfam13307
261594004475	Zn-dependent carboxypeptidase [Amino acid transport and metabolism]; Region: COG2317
261594004476	Peptidase family M32 includes thermostable carboxypeptidases TaqCP and PfuCP; Region: M32_Taq; cd06460
261594004477	active site
261594004478	Zn binding site [ion binding]; other site
261594004479	Acetyltransferase (GNAT) domain; Region: Acetyltransf_3; pfam13302
261594004480	Acetyltransferase (GNAT) family; Region: Acetyltransf_1; pfam00583
261594004481	Coenzyme A binding pocket [chemical binding]; other site
261594004482	Macrolide 2'-Phosphotransferase (MPH2'). MPH2' is part of a larger superfamily that includes the catalytic domains of other kinases, such as the typical serine/threonine/tyrosine protein kinases (PKs), RIO kinases, actin-fragmin kinase; Region: MPH2' cd05152
261594004483	Phosphotransferase enzyme family; Region: APH; pfam01636
261594004484	putative active site [active]
261594004485	putative substrate binding site [chemical binding]; other site
261594004486	ATP binding site [chemical binding]; other site
261594004487	Methionine Aminopeptidase 1. E.C. 3.4.11.18. Also known as methionyl aminopeptidase and Peptidase M. Catalyzes release of N-terminal amino acids, preferentially methionine, from peptides and arylamides; Region: MetAP1; cd01086
261594004488	active site
261594004489	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
261594004490	active site
261594004491	xanthine permease; Region: pbuX; TIGR03173
261594004492	Predicted membrane protein [Function unknown]; Region: COG2311
261594004493	Protein of unknown function (DUF418); Region: DUF418; cl12135
261594004494	Protein of unknown function (DUF418); Region: DUF418; pfam04235
261594004495	Dynamin-like protein including dynamins, mitofusins, and guanylate-binding proteins; Region: DLP_2; cd09912
261594004496	Dynamin family; Region: Dynamin_N; pfam00350
261594004497	G1 box; other site
261594004498	GTP/Mg2+ binding site [chemical binding]; other site
261594004499	G2 box; other site
261594004500	Switch I region; other site
261594004501	G3 box; other site
261594004502	Switch II region; other site
261594004503	G4 box; other site
261594004504	G5 box; other site
261594004505	Rat sarcoma (Ras)-like superfamily of small guanosine triphosphatases (GTPases); Region: Ras_like_GTPase; cl17170
261594004506	Dynamin family; Region: Dynamin_N; pfam00350
261594004507	G1 box; other site
261594004508	GTP/Mg2+ binding site [chemical binding]; other site
261594004509	G2 box; other site
261594004510	Dynamin-like protein including dynamins, mitofusins, and guanylate-binding proteins; Region: DLP_2; cd09912
261594004511	G3 box; other site
261594004512	Switch II region; other site
261594004513	GTP/Mg2+ binding site [chemical binding]; other site
261594004514	G4 box; other site
261594004515	G5 box; other site
261594004516	Protein of unknown function (DUF3931); Region: DUF3931; pfam13082
261594004517	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594004518	Coenzyme A binding pocket [chemical binding]; other site
261594004519	Ribosomal protein S11; Region: Ribosomal_S11; cl00332
261594004520	Protein of unknown function (DUF2533); Region: DUF2533; pfam10752
261594004521	Rhodanese-related sulfurtransferase [Inorganic ion transport and metabolism]; Region: SseA; COG2897
261594004522	Thiosulfate sulfurtransferase (TST), N-terminal, inactive domain. TST contains 2 copies of the Rhodanese Homology Domain; this is the 1st repeat, which does not contain the catalytically active Cys residue. The role of the 1st repeat is uncertain, but it...; Region: TST_Repeat_1; cd01448
261594004523	active site residue [active]
261594004524	Thiosulfate sulfurtransferase (TST), C-terminal, catalytic domain. TST contains 2 copies of the Rhodanese Homology Domain; this is the second repeat. Only the second repeat contains the catalytically active Cys residue; Region: TST_Repeat_2; cd01449
261594004525	active site residue [active]
261594004526	Glutathionylspermidine synthase preATP-grasp; Region: GSP_synth; cl00503
261594004527	Predicted membrane protein [Function unknown]; Region: COG3766
261594004528	Domain of Unknown Function (DUF350); Region: DUF350; pfam03994
261594004529	Domain of Unknown Function (DUF350); Region: DUF350; pfam03994
261594004530	Cation transporter/ATPase, N-terminus; Region: Cation_ATPase_N; pfam00690
261594004531	E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122
261594004532	5'-3' exonuclease; Region: 53EXOc; smart00475
261594004533	PIN domain of the 5'-3' exonuclease of Taq DNA polymerase I and homologs; Region: PIN_53EXO; cd09859
261594004534	active site
261594004535	metal binding site 1 [ion binding]; metal-binding site
261594004536	putative 5' ssDNA interaction site; other site
261594004537	metal binding site 3; metal-binding site
261594004538	metal binding site 2 [ion binding]; metal-binding site
261594004539	H3TH domain of the 5'-3' exonuclease of Taq DNA polymerase I and homologs; Region: H3TH_53EXO; cd09898
261594004540	putative DNA binding site [nucleotide binding]; other site
261594004541	putative metal binding site [ion binding]; other site
261594004542	Protein of unknown function (DUF3901); Region: DUF3901; pfam13040
261594004543	Predicted acyltransferases [Lipid metabolism]; Region: COG1835
261594004544	Capsular polysaccharide biosynthesis protein [Cell envelope biogenesis, outer membrane]; Region: COG3944
261594004545	Chain length determinant protein; Region: Wzz; cl15801
261594004546	Bacterial sugar transferase; Region: Bac_transf; pfam02397
261594004547	Membrane protein involved in the export of O-antigen and teichoic acid [General function prediction only]; Region: RfbX; COG2244
261594004548	Wzx, a subfamily of the multidrug and toxic compound extrusion (MATE)-like proteins; Region: MATE_Wzx_like; cd13128
261594004549	Lipid A core - O-antigen ligase and related enzymes [Cell envelope biogenesis, outer membrane]; Region: RfaL; COG3307
261594004550	O-Antigen ligase; Region: Wzy_C; pfam04932
261594004551	Glycosyltransferases involved in cell wall biogenesis [Cell envelope biogenesis, outer membrane]; Region: WcaA; COG0463
261594004552	Glycosyltransferase family A (GT-A) includes diverse families of glycosyl transferases with a common GT-A type structural fold; Region: Glyco_tranf_GTA_type; cd00761
261594004553	active site
261594004554	Pectate lyase superfamily protein; Region: Pectate_lyase_3; pfam12708
261594004555	conserved repeat domain; Region: B_ant_repeat; TIGR01451
261594004556	conserved repeat domain; Region: B_ant_repeat; TIGR01451
261594004557	conserved repeat domain; Region: B_ant_repeat; TIGR01451
261594004558	conserved repeat domain; Region: B_ant_repeat; TIGR01451
261594004559	conserved repeat domain; Region: B_ant_repeat; TIGR01451
261594004560	conserved repeat domain; Region: B_ant_repeat; TIGR01451
261594004561	conserved repeat domain; Region: B_ant_repeat; TIGR01451
261594004562	conserved repeat domain; Region: B_ant_repeat; TIGR01451
261594004563	Domain of unknown function DUF11; Region: DUF11; cl17728
261594004564	conserved repeat domain; Region: B_ant_repeat; TIGR01451
261594004565	conserved repeat domain; Region: B_ant_repeat; TIGR01451
261594004566	conserved repeat domain; Region: B_ant_repeat; TIGR01451
261594004567	conserved repeat domain; Region: B_ant_repeat; TIGR01451
261594004568	conserved repeat domain; Region: B_ant_repeat; TIGR01451
261594004569	conserved repeat domain; Region: B_ant_repeat; TIGR01451
261594004570	conserved repeat domain; Region: B_ant_repeat; TIGR01451
261594004571	conserved repeat domain; Region: B_ant_repeat; TIGR01451
261594004572	conserved repeat domain; Region: B_ant_repeat; TIGR01451
261594004573	conserved repeat domain; Region: B_ant_repeat; TIGR01451
261594004574	conserved repeat domain; Region: B_ant_repeat; TIGR01451
261594004575	conserved repeat domain; Region: B_ant_repeat; TIGR01451
261594004576	conserved repeat domain; Region: B_ant_repeat; TIGR01451
261594004577	conserved repeat domain; Region: B_ant_repeat; TIGR01451
261594004578	Domain of unknown function DUF11; Region: DUF11; cl17728
261594004579	conserved repeat domain; Region: B_ant_repeat; TIGR01451
261594004580	conserved repeat domain; Region: B_ant_repeat; TIGR01451
261594004581	conserved repeat domain; Region: B_ant_repeat; TIGR01451
261594004582	Acetyltransferase (GNAT) domain; Region: Acetyltransf_10; pfam13673
261594004583	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594004584	Coenzyme A binding pocket [chemical binding]; other site
261594004585	Nicotinamidase_ related amidohydrolases.  Cysteine hydrolases of unknown function that share the catalytic triad with other amidohydrolases, like nicotinamidase, which converts nicotinamide to nicotinic acid and ammonia; Region: nicotinamidase_related; cd01014
261594004586	Isochorismatase family; Region: Isochorismatase; pfam00857
261594004587	catalytic triad [active]
261594004588	conserved cis-peptide bond; other site
261594004589	Permeases of the drug/metabolite transporter (DMT) superfamily [Carbohydrate transport and metabolism / Amino acid transport and metabolism / General function prediction only]; Region: RhaT; COG0697
261594004590	EamA-like transporter family; Region: EamA; pfam00892
261594004591	EamA-like transporter family; Region: EamA; cl17759
261594004592	RNAse HI family that includes Archaeal RNase HI; Region: RNase_HI_archaeal_like; cd09279
261594004593	RNA/DNA hybrid binding site [nucleotide binding]; other site
261594004594	active site
261594004595	Aldose 1-epimerase, similar to Lactococcus lactis lacX; Region: Aldose_epim_lacX; cd09024
261594004596	active site
261594004597	catalytic residues [active]
261594004598	QueT transporter; Region: QueT; pfam06177
261594004599	hypothetical protein; Validated; Region: PRK07708
261594004600	RNAse HI family that includes Archaeal RNase HI; Region: RNase_HI_archaeal_like; cd09279
261594004601	RNA/DNA hybrid binding site [nucleotide binding]; other site
261594004602	active site
261594004603	Protein of unknown function (DUF2602); Region: DUF2602; pfam10782
261594004604	Protein of unknown function (DUF2564); Region: DUF2564; pfam10819
261594004605	Cold-Shock Protein (CSP) contains an S1-like cold-shock domain (CSD) that is found in eukaryotes, prokaryotes, and archaea.  CSP's include the major cold-shock proteins CspA and CspB in bacteria and the eukaryotic gene regulatory factor Y-box...; Region: CSP_CDS; cd04458
261594004606	DNA-binding site [nucleotide binding]; DNA binding site
261594004607	RNA-binding motif; other site
261594004608	YqcI/YcgG family; Region: YqcI_YcgG; pfam08892
261594004609	LysE type translocator; Region: LysE; pfam01810
261594004610	Fatty acid hydroxylase superfamily; Region: FA_hydroxylase; cl01132
261594004611	Protein of unknown function, DUF485; Region: DUF485; pfam04341
261594004612	Predicted symporter [General function prediction only]; Region: DhlC; COG4147
261594004613	Uncharacterized bacterial solute carrier 5 subfamily; putative solute-binding domain; Region: SLC5sbd_u4; cd11480
261594004614	Na binding site [ion binding]; other site
261594004615	aminotransferase; Validated; Region: PRK07678
261594004616	Acetyl ornithine aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to ornithine aminotransferase, acetylornithine aminotransferase; Region: OAT_like; cd00610
261594004617	inhibitor-cofactor binding pocket; inhibition site
261594004618	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594004619	catalytic residue [active]
261594004620	Protein of unknown function (DUF3986); Region: DUF3986; pfam13143
261594004621	Kef-type K+ transport systems, membrane components [Inorganic ion transport and metabolism]; Region: KefB; COG0475
261594004622	Sodium/hydrogen exchanger family; Region: Na_H_Exchanger; pfam00999
261594004623	Predicted transcriptional regulators [Transcription]; Region: SoxR; COG0789
261594004624	Helix-Turn-Helix DNA binding domain of the BmrR transcription regulator; Region: HTH_BmrR; cd01107
261594004625	DNA binding residues [nucleotide binding]
261594004626	drug binding residues [chemical binding]; other site
261594004627	dimer interface [polypeptide binding]; other site
261594004628	Transcriptional regulator, effector-binding domain/component [Transcription / Signal transduction mechanisms]; Region: COG4978
261594004629	Subfamily of the multidrug and toxic compound extrusion (MATE)-like proteins similar to Streptococcus aureus MepA; Region: MATE_MepA_like; cd13143
261594004630	multidrug efflux pump VmrA; Reviewed; Region: vmrA; PRK09575
261594004631	Predicted membrane protein [Function unknown]; Region: COG2323
261594004632	Uncharacterized conserved protein [Function unknown]; Region: COG1434
261594004633	YdcF-like. YdcF-like is a large family of mainly bacterial proteins, with a few members found in fungi, plants, and archaea. Escherichia coli YdcF has been shown to bind S-adenosyl-L-methionine (AdoMet), but a biochemical function has not been...; Region: YdcF-like; cd06259
261594004634	putative active site [active]
261594004635	Tic20-like protein; Region: Tic20; pfam09685
261594004636	This family contains NADPH-dependent flavin reductase and oxygen-insensitive nitroreductase. These enzymes are homodimeric flavoproteins that contain one FMN per monomer as a cofactor. Flavin reductase catalyzes the reduction of flavin by using NADPH as...; Region: NfsA_FRP; cd02146
261594004637	dimer interface [polypeptide binding]; other site
261594004638	FMN binding site [chemical binding]; other site
261594004639	NADPH bind site [chemical binding]; other site
261594004640	DJ-1 family protein; Region: not_thiJ; TIGR01383
261594004641	Type 1 glutamine amidotransferase (GATase1)-like domain found in a subgroup of proteins similar to PfpI from Pyrococcus furiosus; Region: GATase1_PfpI_3; cd03140
261594004642	conserved cys residue [active]
261594004643	Sulfite exporter TauE/SafE; Region: TauE; pfam01925
261594004644	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594004645	H+ Antiporter protein; Region: 2A0121; TIGR00900
261594004646	putative substrate translocation pore; other site
261594004647	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
261594004648	dimerization interface [polypeptide binding]; other site
261594004649	putative DNA binding site [nucleotide binding]; other site
261594004650	putative Zn2+ binding site [ion binding]; other site
261594004651	H+ Antiporter protein; Region: 2A0121; TIGR00900
261594004652	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594004653	putative substrate translocation pore; other site
261594004654	This domain superfamily is found in a variety of structurally related metalloproteins, including the type I extradiol dioxygenases, glyoxalase I and a group of antibiotic resistance proteins; Region: Glo_EDI_BRP_like; cl14632
261594004655	active site
261594004656	metal binding site [ion binding]; metal-binding site
261594004657	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
261594004658	Spo0E like sporulation regulatory protein; Region: SpoOE-like; pfam09388
261594004659	bacterial Hfq-like; Region: Hfq; cd01716
261594004660	hexamer interface [polypeptide binding]; other site
261594004661	Sm1 motif; other site
261594004662	RNA binding site [nucleotide binding]; other site
261594004663	Sm2 motif; other site
261594004664	HD domain; Region: HD_3; pfam13023
261594004665	flagellar motor protein MotP; Reviewed; Region: PRK06743
261594004666	MotA/TolQ/ExbB proton channel family; Region: MotA_ExbB; cl00568
261594004667	flagellar motor protein MotS; Reviewed; Region: PRK06742
261594004668	Peptidoglycan binding domains similar to the C-terminal domain of outer-membrane protein OmpA; Region: OmpA_C-like; cd07185
261594004669	ligand binding site [chemical binding]; other site
261594004670	Response regulator receiver domain; Region: Response_reg; pfam00072
261594004671	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594004672	active site
261594004673	phosphorylation site [posttranslational modification]
261594004674	intermolecular recognition site; other site
261594004675	dimerization interface [polypeptide binding]; other site
261594004676	flagellar motor switch protein; Reviewed; Region: PRK06782
261594004677	CheC-like family; Region: CheC; pfam04509
261594004678	CheC-like family; Region: CheC; pfam04509
261594004679	CheC-like family; Region: CheC; pfam04509
261594004680	CheC-like family; Region: CheC; pfam04509
261594004681	Surface presentation of antigens (SPOA); Region: SpoA; pfam01052
261594004682	Methylase of chemotaxis methyl-accepting proteins [Cell motility and secretion / Signal transduction mechanisms]; Region: CheR; COG1352
261594004683	CheR methyltransferase, all-alpha domain; Region: CheR_N; pfam03705
261594004684	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594004685	Protein of unknown function (DUF327); Region: DUF327; pfam03885
261594004686	Glutamate-cysteine ligase; Region: GshA; pfam08886
261594004687	flagellar hook-associated protein FlgK; Validated; Region: flgK; PRK06799
261594004688	Flagellar basal body rod FlgEFG protein C-terminal; Region: Flg_bbr_C; pfam06429
261594004689	flagellar capping protein; Validated; Region: fliD; PRK06798
261594004690	Flagellar hook-associated protein 2 C-terminus; Region: FliD_N; pfam02465
261594004691	Flagellar hook-associated protein 2 C-terminus; Region: FliD_C; pfam07195
261594004692	Flagellar protein FliS; Region: FliS; cl00654
261594004693	flagellar basal body rod protein FlgB; Reviewed; Region: flgB; PRK06797
261594004694	flagellar basal body rod protein FlgB; Reviewed; Region: flgB; PRK07182
261594004695	flagellar basal body rod protein FlgC; Reviewed; Region: flgC; PRK05681
261594004696	Flagellar basal body rod FlgEFG protein C-terminal; Region: Flg_bbr_C; pfam06429
261594004697	flagellar hook-basal body protein FliE; Reviewed; Region: fliE; PRK01699
261594004698	flagellar motor switch protein G; Validated; Region: fliG; PRK05686
261594004699	FliG C-terminal domain; Region: FliG_C; pfam01706
261594004700	flagellar assembly protein H; Validated; Region: fliH; PRK06800
261594004701	Flagellar assembly protein FliH; Region: FliH; pfam02108
261594004702	flagellum-specific ATP synthase; Validated; Region: fliI; PRK06793
261594004703	RecA-like NTPases. This family includes the NTP binding domain of F1 and V1 H+ATPases, DnaB and related helicases as well as bacterial RecA and related eukaryotic and archaeal recombinases. This group also includes bacterial conjugation proteins and...; Region: RecA-like_NTPases; cl17233
261594004704	Walker A motif; other site
261594004705	ATP binding site [chemical binding]; other site
261594004706	Walker B motif; other site
261594004707	flagellar basal body rod modification protein; Validated; Region: flgD; PRK06792
261594004708	Flagellar hook capping protein - N-terminal region; Region: FlgD; pfam03963
261594004709	flagellar hook protein FlgE; Validated; Region: flgE; PRK05682
261594004710	Flagella basal body rod protein; Region: Flg_bb_rod; pfam00460
261594004711	Flagellar basal body rod FlgEFG protein C-terminal; Region: Flg_bbr_C; pfam06429
261594004712	Protein of unknown function (DUF3964); Region: DUF3964; pfam13107
261594004713	DNA binding domain of the motility gene repressor (MogR); Region: MogR_DNAbind; pfam12181
261594004714	Glycosyltransferases involved in cell wall biogenesis [Cell envelope biogenesis, outer membrane]; Region: WcaA; COG0463
261594004715	Glycosyltransferase family A (GT-A) includes diverse families of glycosyl transferases with a common GT-A type structural fold; Region: Glyco_tranf_GTA_type; cl11394
261594004716	active site
261594004717	Glycosyltransferases catalyze the transfer of sugar moieties from activated donor molecules to specific acceptor molecules, forming glycosidic bonds. The acceptor molecule can be a lipid, a protein, a heterocyclic compound, or another carbohydrate...; Region: Glycosyltransferase_GTB_type; cl10013
261594004718	Glycosyltransferase [Cell envelope biogenesis, outer membrane]; Region: RfaG; COG0438
261594004719	TPR repeat; Region: TPR_11; pfam13414
261594004720	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cd00189
261594004721	binding surface
261594004722	TPR motif; other site
261594004723	flagellin; Provisional; Region: PRK12807
261594004724	Bacterial flagellin N-terminal helical region; Region: Flagellin_N; pfam00669
261594004725	Bacterial flagellin C-terminal helical region; Region: Flagellin_C; pfam00700
261594004726	Soluble lytic murein transglycosylase and related regulatory proteins (some contain LysM/invasin domains) [Cell envelope biogenesis, outer membrane]; Region: MltE; COG0741
261594004727	Lytic Transglycosylase (LT)  and Goose Egg White Lysozyme (GEWL) domain. Members include the soluble and insoluble membrane-bound LTs in bacteria, the LTs in bacteriophage lambda, as well as, the eukaryotic "goose-type" lysozymes (GEWL).  LTs...; Region: LT_GEWL; cd00254
261594004728	N-acetyl-D-glucosamine binding site [chemical binding]; other site
261594004729	catalytic residue [active]
261594004730	flagellar motor switch protein; Validated; Region: PRK06788
261594004731	flagellar biosynthesis protein FliP; Reviewed; Region: fliP; PRK05699
261594004732	flagellar biosynthesis protein FliQ; Validated; Region: fliQ; PRK05700
261594004733	flagellar biosynthesis protein FliR; Reviewed; Region: fliR; PRK05701
261594004734	flagellar biosynthesis protein FlhB; Reviewed; Region: flhB; PRK05702
261594004735	Uncharacterized homolog of the cytoplasmic domain of flagellar protein FhlB [Function unknown]; Region: COG2257; cl15822
261594004736	flagellar biosynthesis protein FlhA; Validated; Region: flhA; PRK06012
261594004737	FHIPEP family; Region: FHIPEP; pfam00771
261594004738	flagellar basal body rod protein FlgG; Reviewed; Region: flgG; PRK12819
261594004739	Flagellar basal body rod FlgEFG protein C-terminal; Region: Flg_bbr_C; cl15855
261594004740	Predicted metal-dependent hydrolases related to alanyl-tRNA synthetase HxxxH domain [General function prediction only]; Region: COG2872
261594004741	Threonyl and Alanyl tRNA synthetase second additional domain; Region: tRNA_SAD; pfam07973
261594004742	Predicted transcriptional regulators [Transcription]; Region: COG1378
261594004743	Sugar-specific transcriptional regulator TrmB; Region: TrmB; pfam01978
261594004744	Middle phospholipase D-like domain of the transcriptional regulator TrmB and similar proteins; Region: PLDc_like_TrmB_middle; cd09124
261594004745	C-terminal domain interface [polypeptide binding]; other site
261594004746	sugar binding site [chemical binding]; other site
261594004747	Predicted branched-chain amino acid permease (azaleucine resistance) [Amino acid transport and metabolism]; Region: AzlC; COG1296
261594004748	Branched-chain amino acid transport protein (AzlD); Region: AzlD; pfam05437
261594004749	Protein of unknown function (DUF3951); Region: DUF3951; pfam13131
261594004750	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
261594004751	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
261594004752	Dienelactone hydrolase family; Region: DLH; pfam01738
261594004753	Uncharacterized enzyme involved in biosynthesis of extracellular polysaccharides [General function prediction only]; Region: COG2329
261594004754	small acid-soluble spore protein, H-type; Region: SASP_H; TIGR02861
261594004755	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
261594004756	non-specific DNA binding site [nucleotide binding]; other site
261594004757	salt bridge; other site
261594004758	sequence-specific DNA binding site [nucleotide binding]; other site
261594004759	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594004760	H+ Antiporter protein; Region: 2A0121; TIGR00900
261594004761	putative substrate translocation pore; other site
261594004762	Domain of unknown function (DUF4398); Region: DUF4398; pfam14346
261594004763	Transcriptional regulator [Transcription]; Region: LysR; COG0583
261594004764	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
261594004765	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cd05466
261594004766	dimerization interface [polypeptide binding]; other site
261594004767	ABC-type spermidine/putrescine transport systems, ATPase components [Amino acid transport and metabolism]; Region: PotA; COG3842
261594004768	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
261594004769	Walker A/P-loop; other site
261594004770	ATP binding site [chemical binding]; other site
261594004771	Q-loop/lid; other site
261594004772	ABC transporter signature motif; other site
261594004773	Walker B; other site
261594004774	D-loop; other site
261594004775	H-loop/switch region; other site
261594004776	2-aminoethylphosphonate ABC transporter substrate-binding protein; Provisional; Region: PRK15046
261594004777	ABC-type Fe3+ transport system, periplasmic component [Inorganic ion transport and metabolism]; Region: AfuA; COG1840
261594004778	ABC-type Fe3+ transport system, permease component [Inorganic ion transport and metabolism]; Region: ThiP; COG1178
261594004779	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
261594004780	dimer interface [polypeptide binding]; other site
261594004781	conserved gate region; other site
261594004782	putative PBP binding loops; other site
261594004783	ABC-ATPase subunit interface; other site
261594004784	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
261594004785	dimer interface [polypeptide binding]; other site
261594004786	conserved gate region; other site
261594004787	putative PBP binding loops; other site
261594004788	ABC-ATPase subunit interface; other site
261594004789	Predicted exonuclease of the beta-lactamase fold involved in RNA processing [Translation, ribosomal structure and biogenesis]; Region: YSH1; COG1236
261594004790	Metallo-beta-lactamase superfamily; Region: Lactamase_B; pfam00753
261594004791	Beta-Casp domain; Region: Beta-Casp; pfam10996
261594004792	RNA-metabolising metallo-beta-lactamase; Region: RMMBL; pfam07521
261594004793	Cupin; Region: Cupin_1; smart00835
261594004794	Beta-lactamase enzyme family; Region: Beta-lactamase2; pfam13354
261594004795	Domain of unknown function (DUF3885); Region: DUF3885; pfam13021
261594004796	Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067
261594004797	catalytic core [active]
261594004798	Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596
261594004799	hypothetical protein; Provisional; Region: PRK09272
261594004800	Glutamine amidotransferases class-II (GATase) asparagine synthase_B type.  Asparagine synthetase B catalyses the ATP-dependent conversion of aspartate to asparagine. This enzyme is a homodimer, with each monomer composed of a  glutaminase domain and a...; Region: AsnB; cd00712
261594004801	active site
261594004802	asparagine synthase (glutamine-hydrolyzing); Region: asn_synth_AEB; TIGR01536
261594004803	dimer interface [polypeptide binding]; other site
261594004804	The C-terminal domain of Asparagine Synthase B. This domain is always found associated n-terminal amidotransferase domain. Family members that contain this domain catalyse the conversion of aspartate to asparagine. Asparagine synthetase B  catalyzes the...; Region: Asn_Synthase_B_C; cd01991
261594004805	Ligand Binding Site [chemical binding]; other site
261594004806	Molecular Tunnel; other site
261594004807	RNA polymerase factor sigma-70; Validated; Region: PRK06811
261594004808	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
261594004809	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
261594004810	DNA binding residues [nucleotide binding]
261594004811	Domain of unknown function (DUF4179); Region: DUF4179; pfam13786
261594004812	VPS10 domain; Region: VPS10; smart00602
261594004813	VPS10 domain; Region: VPS10; smart00602
261594004814	Co/Zn/Cd efflux system component [Inorganic ion transport and metabolism]; Region: CzcD; COG1230
261594004815	Protein of unknown function (DUF3940); Region: DUF3940; pfam13076
261594004816	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
261594004817	DNA-binding transcriptional regulator CsiR; Provisional; Region: PRK11534
261594004818	DNA-binding site [nucleotide binding]; DNA binding site
261594004819	FCD domain; Region: FCD; pfam07729
261594004820	Permeases of the drug/metabolite transporter (DMT) superfamily [Carbohydrate transport and metabolism / Amino acid transport and metabolism / General function prediction only]; Region: RhaT; COG0697
261594004821	EamA-like transporter family; Region: EamA; pfam00892
261594004822	EamA-like transporter family; Region: EamA; pfam00892
261594004823	Putative GTPases (G3E family) [General function prediction only]; Region: COG0523
261594004824	CobW/HypB/UreG, nucleotide-binding domain; Region: cobW; pfam02492
261594004825	Cobalamin synthesis protein cobW C-terminal domain; Region: CobW_C; smart00833
261594004826	Predicted permeases [General function prediction only]; Region: COG0701
261594004827	TIGR03943 family protein; Region: TIGR03943
261594004828	Methyltransferase domain; Region: Methyltransf_24; pfam13578
261594004829	Na+/H+ antiporter NhaC; Region: antiport_nhaC; TIGR00931
261594004830	fumarate hydratase; Reviewed; Region: fumC; PRK00485
261594004831	Class II fumarases; Region: Fumarase_classII; cd01362
261594004832	active site
261594004833	tetramer interface [polypeptide binding]; other site
261594004834	Domain of unknown function (DUF1200); Region: DUF1200; pfam06713
261594004835	Uncharacterized protein conserved in bacteria (DUF2087); Region: DUF2087; pfam09860
261594004836	Type 1 glutamine amidotransferase (GATase1)-like domain found in peptidase E; Region: GAT1_Peptidase_E; cd03146
261594004837	active site pocket [active]
261594004838	oxyanion hole [active]
261594004839	catalytic triad [active]
261594004840	active site nucleophile [active]
261594004841	Protein of unknown function (DUF3942); Region: DUF3942; pfam13078
261594004842	Penicillinase repressor; Region: Pencillinase_R; pfam03965
261594004843	Zn-dependent protease with chaperone function [Posttranslational modification, protein turnover, chaperones]; Region: HtpX; COG0501
261594004844	Cytochrome c biogenesis protein [Posttranslational modification, protein turnover, chaperones]; Region: CcdA; COG0785
261594004845	Cytochrome C biogenesis protein transmembrane region; Region: DsbD; pfam02683
261594004846	TlpA-like family; composed of  TlpA, ResA, DsbE and similar proteins. TlpA, ResA and DsbE are bacterial protein disulfide reductases with important roles in cytochrome maturation. They are membrane-anchored proteins with a soluble TRX domain containing a...; Region: TlpA_like_family; cd02966
261594004847	Thioredoxin-like; Region: Thioredoxin_8; pfam13905
261594004848	catalytic residues [active]
261594004849	Prolipoprotein diacylglyceryl transferase; Region: LGT; cl00478
261594004850	DNA-binding transcriptional repressor PuuR; Provisional; Region: PRK09943
261594004851	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
261594004852	non-specific DNA binding site [nucleotide binding]; other site
261594004853	salt bridge; other site
261594004854	sequence-specific DNA binding site [nucleotide binding]; other site
261594004855	Cupin domain; Region: Cupin_2; pfam07883
261594004856	transposase, putative, N-terminal domain; Region: tspaseT_teng_N; TIGR01765
261594004857	transposase, IS605 OrfB family, central region; Region: tspaseT_teng_C; TIGR01766
261594004858	D-Serine dehydratase is a pyridoxal phosphate (PLP)-dependent enzyme which catalyzes the conversion of L- or D-serine  to pyruvate and ammonia.  D-serine dehydratase serves as a detoxifying enzyme in most E. coli strains where D-serine is a competitive...; Region: D-Ser-dehyd; cd06447
261594004859	Pyridoxal-phosphate dependent enzyme; Region: PALP; pfam00291
261594004860	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
261594004861	catalytic residue [active]
261594004862	Protein of unknown function (DUF445); Region: DUF445; pfam04286
261594004863	RNA polymerase sigma factor SigW; Reviewed; Region: PRK09642
261594004864	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
261594004865	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
261594004866	DNA binding residues [nucleotide binding]
261594004867	Response regulator containing a CheY-like receiver domain and an HTH DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: CitB; COG2197
261594004868	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594004869	active site
261594004870	phosphorylation site [posttranslational modification]
261594004871	intermolecular recognition site; other site
261594004872	dimerization interface [polypeptide binding]; other site
261594004873	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
261594004874	DNA binding residues [nucleotide binding]
261594004875	dimerization interface [polypeptide binding]; other site
261594004876	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: COG4585
261594004877	Histidine kinase; Region: HisKA_3; pfam07730
261594004878	ABC-type multidrug transport system, ATPase component [Defense mechanisms]; Region: CcmA; COG1131
261594004879	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
261594004880	Walker A/P-loop; other site
261594004881	ATP binding site [chemical binding]; other site
261594004882	Q-loop/lid; other site
261594004883	ABC transporter signature motif; other site
261594004884	Walker B; other site
261594004885	D-loop; other site
261594004886	H-loop/switch region; other site
261594004887	ABC-type multidrug transport system, permease component [Defense mechanisms]; Region: COG0842
261594004888	ABC-2 type transporter; Region: ABC2_membrane; pfam01061
261594004889	ABC-2 family transporter protein; Region: ABC2_membrane_3; pfam12698
261594004890	ABC-2 type transporter; Region: ABC2_membrane; pfam01061
261594004891	Catalytic domain, repeat 1, of bacterial cardiolipin synthase and similar proteins; Region: PLDc_CLS_1; cd09110
261594004892	PLD-like domain; Region: PLDc_2; pfam13091
261594004893	putative active site [active]
261594004894	catalytic site [active]
261594004895	catalytic domain repeat 2 of bacterial cardiolipin synthase and similar proteins; Region: PLDc_CLS_2; cd09112
261594004896	PLD-like domain; Region: PLDc_2; pfam13091
261594004897	putative active site [active]
261594004898	catalytic site [active]
261594004899	UMP kinase (UMPK)-Ec, the microbial/chloroplast uridine monophosphate kinase (uridylate kinase) enzyme that catalyzes UMP phosphorylation and plays a key role in pyrimidine nucleotide biosynthesis; regulation of this process is via feed-back control and...; Region: AAK_UMPK-PyrH-Ec; cd04254
261594004900	putative nucleotide binding site [chemical binding]; other site
261594004901	uridine monophosphate binding site [chemical binding]; other site
261594004902	homohexameric interface [polypeptide binding]; other site
261594004903	Na+/H+-dicarboxylate symporters [Energy production and conversion]; Region: GltP; COG1301
261594004904	Sodium:dicarboxylate symporter family; Region: SDF; cl00573
261594004905	aspartate ammonia-lyase; Provisional; Region: PRK14515
261594004906	Aspartase; Region: Aspartase; cd01357
261594004907	active sites [active]
261594004908	tetramer interface [polypeptide binding]; other site
261594004909	malate dehydrogenase; Provisional; Region: PRK13529
261594004910	Malic enzyme, N-terminal domain; Region: malic; pfam00390
261594004911	NAD(P) binding domain of malic enzyme (ME), subgroup 1; Region: NAD_bind_1_malic_enz; cd05312
261594004912	NAD(P) binding site [chemical binding]; other site
261594004913	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
261594004914	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594004915	ATP binding site [chemical binding]; other site
261594004916	Mg2+ binding site [ion binding]; other site
261594004917	G-X-G motif; other site
261594004918	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594004919	Response regulator receiver domain; Region: Response_reg; pfam00072
261594004920	active site
261594004921	phosphorylation site [posttranslational modification]
261594004922	intermolecular recognition site; other site
261594004923	dimerization interface [polypeptide binding]; other site
261594004924	YcbB domain; Region: YcbB; pfam08664
261594004925	SWIM zinc finger; Region: SWIM; pfam04434
261594004926	Bacterial SNF2 helicase associated; Region: SNF2_assoc; pfam08455
261594004927	SNF2 family N-terminal domain; Region: SNF2_N; pfam00176
261594004928	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
261594004929	ATP binding site [chemical binding]; other site
261594004930	putative Mg++ binding site [ion binding]; other site
261594004931	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
261594004932	nucleotide binding region [chemical binding]; other site
261594004933	ATP-binding site [chemical binding]; other site
261594004934	Asparagine synthetase (aspartate-ammonia ligase) (AsnA) catalyses the conversion of L-aspartate to L-asparagine in the presence of ATP and ammonia.  AsnA is a homodimeric enzyme which is structurally similiar to the catalytic core domain of class II...; Region: AsnA; cd00645
261594004935	dimer interface [polypeptide binding]; other site
261594004936	active site
261594004937	This conserved domain belongs to a superfamily including the bleomycin resistance protein, glyoxalase I, and type I ring-cleaving dioxygenases; Region: Glo_EDI_BRP_like_7; cd08353
261594004938	putative dimer interface [polypeptide binding]; other site
261594004939	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
261594004940	aspartate kinase; Reviewed; Region: PRK06635
261594004941	AAK_AKii-LysC-BS: Amino Acid Kinase Superfamily (AAK), AKii; this CD includes the N-terminal catalytic aspartokinase (AK) domain of the lysine-sensitive aspartokinase isoenzyme AKII of Bacillus subtilis 168, and the lysine plus threonine-sensitive...; Region: AAK_AKii-LysC-BS; cd04261
261594004942	putative nucleotide binding site [chemical binding]; other site
261594004943	putative catalytic residues [active]
261594004944	putative Mg ion binding site [ion binding]; other site
261594004945	putative aspartate binding site [chemical binding]; other site
261594004946	ACT domains of the lysine-sensitive aspartokinase isoenzyme AKII of Bacillus subtilis (BS) strain 168 and related proteins; Region: ACT_AKii-LysC-BS-like_1; cd04913
261594004947	putative allosteric regulatory site; other site
261594004948	ACT domains of the lysine-sensitive, aspartokinase (AK) isoenzyme AKII of Bacillus subtilis (BS) strain 168 and related domains; Region: ACT_AKii-LysC-BS-like_2; cd04936
261594004949	putative allosteric regulatory residue; other site
261594004950	Domain of unknown function (DUF4166); Region: DUF4166; pfam13761
261594004951	YndJ-like protein; Region: YndJ; pfam14158
261594004952	MutT homolog-1 (MTH1) is a member of the Nudix hydrolase superfamily. MTH1, the mammalian counterpart of MutT, hydrolyzes oxidized purine nucleoside triphosphates, such as 8-oxo-dGTP and 2-hydroxy-ATP, to monophosphates, thereby preventing the...; Region: MTH1; cd03427
261594004953	putative active site [active]
261594004954	nucleotide binding site [chemical binding]; other site
261594004955	nudix motif; other site
261594004956	putative metal binding site [ion binding]; other site
261594004957	S-layer homology domain; Region: SLH; pfam00395
261594004958	S-layer homology domain; Region: SLH; pfam00395
261594004959	S-layer homology domain; Region: SLH; pfam00395
261594004960	N-acetylmuramoyl-L-alanine amidase [Cell envelope biogenesis, outer membrane]; Region: AmiC; COG0860
261594004961	N-acetylmuramoyl-L-alanine amidase or MurNAc-LAA (also known as peptidoglycan aminohydrolase, NAMLA amidase, NAMLAA, Amidase 3, and peptidoglycan amidase; EC 3.5.1.28) is an autolysin that hydrolyzes the amide bond between N-acetylmuramoyl and L-amino...; Region: MurNAc-LAA; cd02696
261594004962	active site
261594004963	metal binding site [ion binding]; metal-binding site
261594004964	S-layer homology domain; Region: SLH; pfam00395
261594004965	S-layer homology domain; Region: SLH; pfam00395
261594004966	S-layer homology domain; Region: SLH; pfam00395
261594004967	Mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase; Region: Glucosaminidase; pfam01832
261594004968	H+ Antiporter protein; Region: 2A0121; TIGR00900
261594004969	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594004970	putative substrate translocation pore; other site
261594004971	Carbon starvation protein, predicted membrane protein [Signal transduction mechanisms]; Region: CstA; COG1966
261594004972	Carbon starvation protein CstA; Region: CstA; pfam02554
261594004973	C-terminal domain on CstA (DUF4161); Region: DUF4161; pfam13722
261594004974	Polyphosphate kinase 2 (PPK2); Region: PPK2; cl11971
261594004975	3-oxoacyl-(acyl carrier protein) synthase III; Reviewed; Region: PRK12879
261594004976	Ketoacyl-acyl carrier protein synthase III (KASIII) initiates the elongation in type II fatty acid synthase systems. It is found in bacteria and plants. Elongation of fatty acids in the type II systems occurs by Claisen condensation of malonyl-acyl...; Region: KAS_III; cd00830
261594004977	dimer interface [polypeptide binding]; other site
261594004978	active site
261594004979	CoA binding pocket [chemical binding]; other site
261594004980	NTR_like domain; a beta barrel with an oligosaccharide/oligonucleotide-binding fold found in netrins, complement proteins, tissue inhibitors of metalloproteases (TIMP), and procollagen C-proteinase enhancers (PCOLCE), amongst others. In netrins, the...; Region: NTR_like; cl02512
261594004981	GTP-binding protein HflX; Region: GTP_HflX; TIGR03156
261594004982	GTP-binding GTPase N-terminal; Region: GTP-bdg_N; pfam13167
261594004983	HflX GTPase family; Region: HflX; cd01878
261594004984	G1 box; other site
261594004985	GTP/Mg2+ binding site [chemical binding]; other site
261594004986	Switch I region; other site
261594004987	G2 box; other site
261594004988	G3 box; other site
261594004989	Switch II region; other site
261594004990	G4 box; other site
261594004991	G5 box; other site
261594004992	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594004993	Major Facilitator Superfamily; Region: MFS_1; pfam07690
261594004994	putative substrate translocation pore; other site
261594004995	Cysteine synthase [Amino acid transport and metabolism]; Region: CysK; COG0031
261594004996	CBS_like: This subgroup includes Cystathionine beta-synthase (CBS) and Cysteine synthase. CBS is a unique heme-containing enzyme that catalyzes a pyridoxal 5'-phosphate (PLP)-dependent condensation of serine and homocysteine to give cystathionine; Region: CBS_like; cd01561
261594004997	dimer interface [polypeptide binding]; other site
261594004998	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594004999	catalytic residue [active]
261594005000	Acetyltransferase (GNAT) domain; Region: Acetyltransf_3; pfam13302
261594005001	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594005002	Coenzyme A binding pocket [chemical binding]; other site
261594005003	Domain of unknown function (DUF4037); Region: DUF4037; pfam13228
261594005004	Membrane protein involved in the export of O-antigen and teichoic acid [General function prediction only]; Region: RfbX; COG2244
261594005005	Stage V sporulation protein B, also known as Stage III sporulation protein F, and related proteins; Region: MATE_SpoVB_like; cd13124
261594005006	solute carrier 6 subfamily, Fusobacterium nucleatum Tyt1-like; solute-binding domain; Region: SLC6sbd_Tyt1-Like; cd10336
261594005007	Na2 binding site [ion binding]; other site
261594005008	putative substrate binding site 1 [chemical binding]; other site
261594005009	Na binding site 1 [ion binding]; other site
261594005010	putative substrate binding site 2 [chemical binding]; other site
261594005011	Predicted xylanase/chitin deacetylase [Carbohydrate transport and metabolism]; Region: CDA1; COG0726
261594005012	Putative catalytic NodB homology domain of uncharacterized BH1302 protein from Bacillus halodurans and its bacterial homologs; Region: CE4_BH1302_like; cd10956
261594005013	NodB motif; other site
261594005014	putative active site [active]
261594005015	putative catalytic site [active]
261594005016	putative Zn binding site [ion binding]; other site
261594005017	Mor transcription activator family; Region: Mor; cl02360
261594005018	Predicted membrane protein [Function unknown]; Region: COG2323
261594005019	Fibronectin-binding protein (FBP); Region: FBP; pfam07299
261594005020	3-hydroxyisobutyrate dehydrogenase and related beta-hydroxyacid dehydrogenases [Lipid metabolism]; Region: MmsB; COG2084
261594005021	NADP oxidoreductase coenzyme F420-dependent; Region: F420_oxidored; pfam03807
261594005022	Regulator of chromosome condensation (RCC1) repeat; Region: RCC1_2; pfam13540
261594005023	Regulator of chromosome condensation (RCC1) repeat; Region: RCC1_2; pfam13540
261594005024	methionine sulfoxide reductase A; Provisional; Region: PRK14054
261594005025	short chain dehydrogenase; Provisional; Region: PRK12747
261594005026	tetrahydroxynaphthalene/trihydroxynaphthalene reductase-like, classical (c) SDRs; Region: THN_reductase-like_SDR_c; cd05362
261594005027	NADP binding site [chemical binding]; other site
261594005028	homodimer interface [polypeptide binding]; other site
261594005029	active site
261594005030	substrate binding site [chemical binding]; other site
261594005031	Branched-chain amino acid aminotransferase/4-amino-4-deoxychorismate lyase [Amino acid transport and metabolism / Coenzyme metabolism]; Region: IlvE; COG0115
261594005032	D-Alanine aminotransferase (D-AAT_like): D-amino acid aminotransferase catalyzes transamination between D-amino acids and their respective alpha-keto acids. It plays a major role in the synthesis of bacterial cell wall components like D-alanine and...; Region: D-AAT_like; cd01558
261594005033	homodimer interface [polypeptide binding]; other site
261594005034	substrate-cofactor binding pocket; other site
261594005035	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594005036	catalytic residue [active]
261594005037	acetolactate synthase 3 catalytic subunit; Validated; Region: PRK06725
261594005038	Pyrimidine (PYR) binding domain of POX and related proteins; Region: TPP_PYR_POX_like; cd07035
261594005039	PYR/PP interface [polypeptide binding]; other site
261594005040	dimer interface [polypeptide binding]; other site
261594005041	TPP binding site [chemical binding]; other site
261594005042	Thiamine pyrophosphate enzyme, central domain; Region: TPP_enzyme_M; pfam00205
261594005043	Thiamine pyrophosphate (TPP) family, Acetohydroxyacid synthase (AHAS) subfamily, TPP-binding module; composed of proteins similar to the large catalytic subunit of AHAS. AHAS catalyzes the condensation of two molecules of pyruvate to give the...; Region: TPP_AHAS; cd02015
261594005044	TPP-binding site [chemical binding]; other site
261594005045	dimer interface [polypeptide binding]; other site
261594005046	ketol-acid reductoisomerase; Provisional; Region: PRK05479
261594005047	Acetohydroxy acid isomeroreductase, catalytic domain; Region: IlvN; pfam07991
261594005048	Acetohydroxy acid isomeroreductase, catalytic domain; Region: IlvC; pfam01450
261594005049	dihydroxy-acid dehydratase; Provisional; Region: PRK00911
261594005050	threonine dehydratase; Validated; Region: PRK08639
261594005051	Threonine dehydratase: The first step in amino acid degradation is the removal of nitrogen. Although the nitrogen atoms of most amino acids are transferred to alpha-ketoglutarate before removal, the alpha-amino group of threonine can be directly...; Region: Thr-dehyd; cd01562
261594005052	tetramer interface [polypeptide binding]; other site
261594005053	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594005054	catalytic residue [active]
261594005055	Second of two tandem C-terminal ACT domains of threonine dehydratase I (ThrD-I; L-threonine hydrolyase); Region: ACT_ThrD-I_2; cd04907
261594005056	putative Ile/Val binding site [chemical binding]; other site
261594005057	Bacterial capsule synthesis protein PGA_cap; Region: PGA_cap; smart00854
261594005058	CapA and related proteins, metallophosphatase domain; Region: MPP_CapA; cd07381
261594005059	putative active site [active]
261594005060	putative metal binding site [ion binding]; other site
261594005061	Protein of unknown function (DUF554); Region: DUF554; pfam04474
261594005062	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cl17182
261594005063	Coenzyme A binding pocket [chemical binding]; other site
261594005064	drug efflux system protein MdtG; Provisional; Region: PRK09874
261594005065	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594005066	putative substrate translocation pore; other site
261594005067	The Class III extradiol dioxygenase, 4,5-DOPA Dioxygenase, catalyzes the incorporation of both atoms of molecular oxygen into 4,5-dihydroxy-phenylalanine; Region: 45_DOPA_Dioxygenase; cd07363
261594005068	Catalytic LigB subunit of aromatic ring-opening dioxygenase; Region: LigB; pfam02900
261594005069	putative active site [active]
261594005070	metal binding site [ion binding]; metal-binding site
261594005071	Lysophospholipase [Lipid metabolism]; Region: PldB; COG2267
261594005072	Putative lysophospholipase; Region: Hydrolase_4; pfam12146
261594005073	LytTr DNA-binding domain; Region: LytTR; pfam04397
261594005074	Response regulator of the LytR/AlgR family [Transcription / Signal transduction mechanisms]; Region: LytT; COG3279
261594005075	Acetyl-CoA hydrolase/transferase N-terminal domain; Region: AcetylCoA_hydro; pfam02550
261594005076	succinate CoA transferase; Region: YgfH_subfam; TIGR03458
261594005077	Acetyl-CoA hydrolase/transferase C-terminal domain; Region: AcetylCoA_hyd_C; pfam13336
261594005078	Acetyltransferase (GNAT) domain; Region: Acetyltransf_10; pfam13673
261594005079	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594005080	Coenzyme A binding pocket [chemical binding]; other site
261594005081	5-methylthioadenosine/S-adenosylhomocysteine deaminase; Provisional; Region: PRK15493
261594005082	TRZ/ATZ family contains enzymes from the atrazine degradation pathway and related hydrolases. Atrazine, a chlorinated herbizide, can be catabolized by a variety of different bacteria. The first three steps of the atrazine dehalogenation pathway are...; Region: ATZ_TRZ_like; cd01298
261594005083	active site
261594005084	putative substrate binding pocket [chemical binding]; other site
261594005085	Alpha/beta hydrolase family; Region: Abhydrolase_6; pfam12697
261594005086	Early set domain associated with the catalytic domain of sugar utilizing enzymes at either the N or C terminus; Region: E_set; cl09101
261594005087	hypothetical protein; Provisional; Region: PRK06922
261594005088	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594005089	S-adenosylmethionine binding site [chemical binding]; other site
261594005090	radical SAM protein, BA_1875 family; Region: sam_11; TIGR04053
261594005091	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
261594005092	FeS/SAM binding site; other site
261594005093	radical SAM additional 4Fe4S-binding SPASM domain; Region: rSAM_more_4Fe4S; TIGR04085
261594005094	Acetyltransferases, including N-acetylases of ribosomal proteins [Translation, ribosomal structure and biogenesis]; Region: RimL; COG1670
261594005095	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594005096	Coenzyme A binding pocket [chemical binding]; other site
261594005097	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
261594005098	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594005099	active site
261594005100	phosphorylation site [posttranslational modification]
261594005101	intermolecular recognition site; other site
261594005102	dimerization interface [polypeptide binding]; other site
261594005103	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
261594005104	DNA binding site [nucleotide binding]
261594005105	manganese transport protein MntH; Reviewed; Region: PRK00701
261594005106	Natural resistance-associated macrophage protein; Region: Nramp; pfam01566
261594005107	putative rhodanese-related sulfurtransferase; Provisional; Region: PRK00142
261594005108	Member of the Rhodanese Homology Domain superfamily. This CD includes Escherichia coli YceA, Bacillus subtilis YbfQ, and similar uncharacterized proteins; Region: RHOD_YceA; cd01518
261594005109	active site residue [active]
261594005110	Protein of unknown function (DUF3650); Region: DUF3650; pfam12368
261594005111	2-dehydropantoate 2-reductase; Provisional; Region: PRK12921
261594005112	Ketopantoate reductase PanE/ApbA; Region: ApbA; pfam02558
261594005113	Ketopantoate reductase PanE/ApbA C terminal; Region: ApbA_C; pfam08546
261594005114	Bacillus haemolytic enterotoxin (HBL); Region: Bacillus_HBL; pfam05791
261594005115	Bacillus haemolytic enterotoxin (HBL); Region: Bacillus_HBL; pfam05791
261594005116	Putative threonine efflux protein [Amino acid transport and metabolism]; Region: RhtB; COG1280
261594005117	Transcriptional regulator, contains sigma factor-related N-terminal domain [Transcription]; Region: DeoR; COG2390
261594005118	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
261594005119	DNA binding residues [nucleotide binding]
261594005120	Putative sugar-binding domain; Region: Sugar-bind; pfam04198
261594005121	2-deoxyribose-5-phosphate aldolase (DERA) of the DeoC family; Region: DeoC; cd00959
261594005122	intersubunit interface [polypeptide binding]; other site
261594005123	active site
261594005124	catalytic residue [active]
261594005125	Nucleoside permease [Nucleotide transport and metabolism]; Region: NupC; COG1972
261594005126	Na+ dependent nucleoside transporter N-terminus; Region: Nucleos_tra2_N; pfam01773
261594005127	Nucleoside recognition; Region: Gate; pfam07670
261594005128	Na+ dependent nucleoside transporter C-terminus; Region: Nucleos_tra2_C; pfam07662
261594005129	pyrimidine-nucleoside phosphorylase; Reviewed; Region: PRK06078
261594005130	Glycosyl transferase family, helical bundle domain; Region: Glycos_trans_3N; pfam02885
261594005131	Glycosyl transferase family, a/b domain; Region: Glycos_transf_3; pfam00591
261594005132	Pyrimidine nucleoside phosphorylase C-terminal domain; Region: PYNP_C; pfam07831
261594005133	Cytidine deaminase zinc-binding domain. These enzymes are Zn dependent. The zinc ion in the active site plays a central role in the proposed catalytic mechanism, activating a water molecule to form a hydroxide ion that performs a nucleophilic attack on...; Region: cytidine_deaminase; cd01283
261594005134	active site
261594005135	catalytic motif [active]
261594005136	Zn binding site [ion binding]; other site
261594005137	hypothetical protein; Provisional; Region: PRK01631
261594005138	Family description; Region: DsbD_2; pfam13386
261594005139	VPS10 domain; Region: VPS10; smart00602
261594005140	proline aminopeptidase P II; Provisional; Region: PRK10879
261594005141	Aminopeptidase P, N-terminal domain; Region: AMP_N; smart01011
261594005142	Prolidase. E.C. 3.4.13.9. Also known as Xaa-Pro dipeptidase, X-Pro dipeptidase, proline dipeptidase., imidodipeptidase, peptidase D, gamma-peptidase. Catalyses hydrolysis of Xaa-Pro dipeptides; also acts on aminoacyl-hydroxyproline analogs. No action on...; Region: Prolidase; cd01087
261594005143	active site
261594005144	Putative multicopper oxidases [Secondary metabolites biosynthesis, transport, and catabolism]; Region: SufI; COG2132
261594005145	Multicopper oxidase; Region: Cu-oxidase_3; pfam07732
261594005146	Putative multicopper oxidases [Secondary metabolites biosynthesis, transport, and catabolism]; Region: SufI; COG2132
261594005147	Multicopper oxidase; Region: Cu-oxidase; pfam00394
261594005148	Multicopper oxidase; Region: Cu-oxidase_2; pfam07731
261594005149	Bacterial SH3 domain; Region: SH3_3; pfam08239
261594005150	Bacterial SH3 domain; Region: SH3_3; pfam08239
261594005151	Bacterial SH3 domain; Region: SH3_3; pfam08239
261594005152	Bacterial SH3 domain; Region: SH3_3; pfam08239
261594005153	Membrane proteins related to metalloendopeptidases [Cell envelope biogenesis, outer membrane]; Region: NlpD; COG0739
261594005154	Bacterial SH3 domain; Region: SH3_3; pfam08239
261594005155	Peptidase family M23; Region: Peptidase_M23; pfam01551
261594005156	DNA topoisomerase III; Provisional; Region: PRK07726
261594005157	TOPRIM_TopoIA_TopoIII: The topoisomerase-primase (TORPIM) domain found in members of the type IA family of DNA topoisomerases (Topo IA) similar to topoisomerase III. Type IA DNA topoisomerases remove (relax) negative supercoils in the DNA by: cleaving...; Region: TOPRIM_TopoIA_TopoIII; cd03362
261594005158	active site
261594005159	putative interdomain interaction site [polypeptide binding]; other site
261594005160	putative metal-binding site [ion binding]; other site
261594005161	putative nucleotide binding site [chemical binding]; other site
261594005162	DNA Topoisomerase, subtype IA; DNA-binding, ATP-binding and catalytic domain of bacterial DNA topoisomerases I and III, and eukaryotic DNA topoisomerase III and eubacterial and archael reverse gyrases. Topoisomerases clevage single or double stranded DNA...; Region: TOP1Ac; cd00186
261594005163	domain I; other site
261594005164	DNA binding groove [nucleotide binding]
261594005165	phosphate binding site [ion binding]; other site
261594005166	domain II; other site
261594005167	domain III; other site
261594005168	nucleotide binding site [chemical binding]; other site
261594005169	catalytic site [active]
261594005170	domain IV; other site
261594005171	Topoisomerase DNA binding C4 zinc finger; Region: zf-C4_Topoisom; pfam01396
261594005172	C-terminal repeat of topoisomerase; Region: Toprim_Crpt; pfam13342
261594005173	Arsenite efflux pump ACR3 and related permeases [Inorganic ion transport and metabolism]; Region: ACR3; COG0798
261594005174	Sodium Bile acid symporter family; Region: SBF; cl17470
261594005175	azoreductase; Provisional; Region: PRK13555
261594005176	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
261594005177	Methylmalonyl-CoA epimerase (MMCE); Region: MMCE; cd07249
261594005178	dimer interface [polypeptide binding]; other site
261594005179	substrate binding site [chemical binding]; other site
261594005180	metal binding site [ion binding]; metal-binding site
261594005181	CopC domain; Region: CopC; pfam04234
261594005182	Putative copper export protein [Inorganic ion transport and metabolism]; Region: PcoD; COG1276
261594005183	YtkA-like; Region: YtkA; pfam13115
261594005184	Reeler-like domain of YcnI and similar proteins; Region: YcnI_like; cd08545
261594005185	Alpha/beta hydrolase family; Region: Abhydrolase_6; pfam12697
261594005186	methyl indole-3-acetate methyltransferase; Region: PLN02211; cl17657
261594005187	EamA-like transporter family; Region: EamA; pfam00892
261594005188	EamA-like transporter family; Region: EamA; pfam00892
261594005189	Transcriptional regulator [Transcription]; Region: LysR; COG0583
261594005190	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
261594005191	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cd05466
261594005192	dimerization interface [polypeptide binding]; other site
261594005193	Predicted transcriptional regulator [Transcription]; Region: COG1959
261594005194	Transcriptional regulator; Region: Rrf2; pfam02082
261594005195	Predicted dithiol-disulfide isomerase involved in polyketide biosynthesis [Secondary metabolites biosynthesis, transport, and catabolism]; Region: FrnE; COG2761
261594005196	DsbA family, FrnE subfamily; FrnE is a DsbA-like protein containing a CXXC motif. It is presumed to be a thiol oxidoreductase involved in polyketide biosynthesis, specifically in the production of the aromatic antibiotics frenolicin and nanaomycins; Region: DsbA_FrnE; cd03024
261594005197	catalytic residues [active]
261594005198	Nitroreductase-like family 4.  A subfamily of the nitroreductase family containing uncharacterized proteins that are similar to nitroreductase. Nitroreductase catalyzes the reduction of nitroaromatic compounds such as nitrotoluenes, nitrofurans and...; Region: Nitroreductase_4; cd02140
261594005199	dimer interface [polypeptide binding]; other site
261594005200	FMN binding site [chemical binding]; other site
261594005201	amidase; Provisional; Region: PRK06707
261594005202	Amidase; Region: Amidase; cl11426
261594005203	Predicted permease, member of the PurR regulon [General function prediction only]; Region: yhhT; COG0628
261594005204	L-lactate dehydrogenase; Reviewed; Region: ldh; PRK00066
261594005205	L-2-hydroxyisocapronate dehydrogenases and some bacterial L-lactate dehydrogenases; Region: HicDH_like; cd05291
261594005206	tetramer (dimer of dimers) interface [polypeptide binding]; other site
261594005207	NAD binding site [chemical binding]; other site
261594005208	dimer interface [polypeptide binding]; other site
261594005209	substrate binding site [chemical binding]; other site
261594005210	Monoamine oxidase [Amino acid transport and metabolism]; Region: COG1231
261594005211	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; pfam13450
261594005212	Putative GTPases (G3E family) [General function prediction only]; Region: COG0523
261594005213	CobW/HypB/UreG, nucleotide-binding domain; Region: cobW; pfam02492
261594005214	Cobalamin synthesis protein cobW C-terminal domain; Region: CobW_C; pfam07683
261594005215	S-layer homology domain; Region: SLH; pfam00395
261594005216	S-layer homology domain; Region: SLH; pfam00395
261594005217	S-layer homology domain; Region: SLH; pfam00395
261594005218	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
261594005219	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
261594005220	acyl-CoA synthetase; Validated; Region: PRK06839
261594005221	Adenylate forming domain, Class I; Region: AFD_class_I; cl17068
261594005222	Bacterial Bile acid CoA ligases and similar proteins; Region: BACL_like; cd05929
261594005223	acyl-activating enzyme (AAE) consensus motif; other site
261594005224	putative AMP binding site [chemical binding]; other site
261594005225	putative active site [active]
261594005226	putative CoA binding site [chemical binding]; other site
261594005227	(R)-hydratase [(R)-specific enoyl-CoA hydratase] catalyzes the hydration of trans-2-enoyl CoA to (R)-3-hydroxyacyl-CoA as part of the PHA (polyhydroxyalkanoate) biosynthetic pathway. (R)-hydratase contains a hot-dog fold similar to those of thioesterase...; Region: R_hydratase; cd03449
261594005228	dimer interaction site [polypeptide binding]; other site
261594005229	substrate-binding tunnel; other site
261594005230	active site
261594005231	catalytic site [active]
261594005232	substrate binding site [chemical binding]; other site
261594005233	hypothetical protein; Validated; Region: PRK06840
261594005234	Condensing enzymes; Family of enzymes that catalyze a (decarboxylating or non-decarboxylating) Claisen-like condensation reaction. Members are share strong structural similarity, and are involved in the synthesis and degradation of fatty acids, and the...; Region: cond_enzymes; cl09938
261594005235	active site
261594005236	Periplasmic binding protein; Region: Peripla_BP_6; pfam13458
261594005237	Periplasmic solute-binding domain of active transport proteins found in gram-negative and gram-positive bacteria; Region: PBP1_SBP_like_2; cd06328
261594005238	putative ligand binding site [chemical binding]; other site
261594005239	ABC-type branched-chain amino acid transport systems, ATPase component [Amino acid transport and metabolism]; Region: LivG; COG0411
261594005240	ATP-binding cassette component of branched chain amino acids transport system; Region: ABC_Mj1267_LivG_branched; cd03219
261594005241	Walker A/P-loop; other site
261594005242	ATP binding site [chemical binding]; other site
261594005243	Q-loop/lid; other site
261594005244	ABC transporter signature motif; other site
261594005245	Walker B; other site
261594005246	D-loop; other site
261594005247	H-loop/switch region; other site
261594005248	ABC-type branched-chain amino acid transport systems, ATPase component [Amino acid transport and metabolism]; Region: LivF; COG0410
261594005249	ATP-binding cassette domain of branched-chain amino acid transporter; Region: ABC_TM1139_LivF_branched; cd03224
261594005250	Walker A/P-loop; other site
261594005251	ATP binding site [chemical binding]; other site
261594005252	Q-loop/lid; other site
261594005253	ABC transporter signature motif; other site
261594005254	Walker B; other site
261594005255	D-loop; other site
261594005256	H-loop/switch region; other site
261594005257	Branched-chain amino acid transport system / permease component; Region: BPD_transp_2; pfam02653
261594005258	Transmembrane subunit (TM) of Escherichia coli LivH and related proteins. LivH is one of two TMs of the E. coli LIV-1/LS transporter, a Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporter involved in the uptake of...; Region: TM_PBP1_LivH_like; cd06582
261594005259	TM-ABC transporter signature motif; other site
261594005260	ABC-type branched-chain amino acid transport system, permease component [Amino acid transport and metabolism]; Region: LivM; COG4177
261594005261	Transmembrane subunit (TM) of Escherichia coli LivM and related proteins. LivM is one of two TMs of the E. coli LIV-1/LS transporter, a Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporter involved in the uptake of...; Region: TM_PBP1_LivM_like; cd06581
261594005262	TM-ABC transporter signature motif; other site
261594005263	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
261594005264	LysR transcriptional regulator; Provisional; Region: rbcR; CHL00180
261594005265	LysR substrate binding domain; Region: LysR_substrate; pfam03466
261594005266	dimerization interface [polypeptide binding]; other site
261594005267	Uncharacterized homolog of gamma-carboxymuconolactone decarboxylase subunit [Function unknown]; Region: COG0599
261594005268	helix_turn_helix multiple antibiotic resistance protein; Region: HTH_MARR; smart00347
261594005269	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
261594005270	putative Zn2+ binding site [ion binding]; other site
261594005271	putative DNA binding site [nucleotide binding]; other site
261594005272	putative luciferase-like monooxygenase, FMN-dependent, CE1758 family; Region: LLM_CE1758_fam; TIGR04036
261594005273	Flavin-utilizing monoxygenases; Region: Flavin_utilizing_monoxygenases; cl07892
261594005274	Flavin-utilizing monoxygenases; Region: Flavin_utilizing_monoxygenases; cd00347
261594005275	cytochrome d terminal oxidase subunit 1; Provisional; Region: PRK15097
261594005276	Bacterial Cytochrome Ubiquinol Oxidase; Region: Bac_Ubq_Cox; pfam01654
261594005277	cytochrome d ubiquinol oxidase subunit 2; Provisional; Region: PRK15003; cl12219
261594005278	Cytochrome oxidase subunit II; Region: Cyto_ox_2; pfam02322
261594005279	ABC-type transport system involved in cytochrome bd biosynthesis, ATPase and permease components [Energy production and conversion / Posttranslational modification, protein turnover, chaperones]; Region: CydD; COG4988
261594005280	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
261594005281	ATP-binding cassette domain of multidrug resistance protein-like transporters; Region: ABCC_MRP_Like; cd03228
261594005282	Walker A/P-loop; other site
261594005283	ATP binding site [chemical binding]; other site
261594005284	Q-loop/lid; other site
261594005285	ABC transporter signature motif; other site
261594005286	Walker B; other site
261594005287	D-loop; other site
261594005288	H-loop/switch region; other site
261594005289	thiol reductant ABC exporter, CydC subunit; Region: CydC; TIGR02868
261594005290	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
261594005291	ATP-binding cassette domain of CydCD, subfamily C; Region: ABCC_cytochrome_bd; cd03247
261594005292	Walker A/P-loop; other site
261594005293	ATP binding site [chemical binding]; other site
261594005294	Q-loop/lid; other site
261594005295	ABC transporter signature motif; other site
261594005296	Walker B; other site
261594005297	D-loop; other site
261594005298	H-loop/switch region; other site
261594005299	Microcin C7 self-immunity protein determines resistance to exogenous microcin C7; Region: Peptidase_S66_mccF_like; cd07062
261594005300	putative dimer interface [polypeptide binding]; other site
261594005301	catalytic triad [active]
261594005302	Beta-lactamase enzyme family; Region: Beta-lactamase2; cl17872
261594005303	D-alanyl-D-alanine carboxypeptidase; Region: Peptidase_S11; pfam00768
261594005304	Nitroreductase-like family 4.  A subfamily of the nitroreductase family containing uncharacterized proteins that are similar to nitroreductase. Nitroreductase catalyzes the reduction of nitroaromatic compounds such as nitrotoluenes, nitrofurans and...; Region: Nitroreductase_4; cd02140
261594005305	dimer interface [polypeptide binding]; other site
261594005306	FMN binding site [chemical binding]; other site
261594005307	Bacterial SH3 domain; Region: SH3_3; pfam08239
261594005308	Bacterial SH3 domain; Region: SH3_3; pfam08239
261594005309	Bacterial SH3 domain; Region: SH3_3; pfam08239
261594005310	Cell wall-associated hydrolases (invasion-associated proteins) [Cell envelope biogenesis, outer membrane]; Region: Spr; COG0791
261594005311	NlpC/P60 family; Region: NLPC_P60; pfam00877
261594005312	Alpha/beta hydrolase family; Region: Abhydrolase_6; pfam12697
261594005313	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
261594005314	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594005315	active site
261594005316	phosphorylation site [posttranslational modification]
261594005317	intermolecular recognition site; other site
261594005318	dimerization interface [polypeptide binding]; other site
261594005319	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
261594005320	DNA binding site [nucleotide binding]
261594005321	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
261594005322	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
261594005323	dimerization interface [polypeptide binding]; other site
261594005324	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
261594005325	dimer interface [polypeptide binding]; other site
261594005326	phosphorylation site [posttranslational modification]
261594005327	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594005328	ATP binding site [chemical binding]; other site
261594005329	Mg2+ binding site [ion binding]; other site
261594005330	G-X-G motif; other site
261594005331	Protein of unknown function (DUF3139); Region: DUF3139; pfam11337
261594005332	3-ketoacyl-(acyl-carrier-protein) reductase; Provisional; Region: fabG; PRK07666
261594005333	classical (c) SDRs; Region: SDR_c; cd05233
261594005334	NAD(P) binding site [chemical binding]; other site
261594005335	active site
261594005336	Streptomycin adenylyltransferase; Region: Adenyl_transf; pfam04439
261594005337	Predicted xylanase/chitin deacetylase [Carbohydrate transport and metabolism]; Region: CDA1; COG0726
261594005338	Catalytic NodB homology domain of rhizobial NodB-like proteins; Region: CE4_NodB_like_6s_7s; cd10917
261594005339	NodB motif; other site
261594005340	active site
261594005341	catalytic site [active]
261594005342	metal binding site [ion binding]; metal-binding site
261594005343	Nudix hydrolase is a superfamily of enzymes found in all three kingdoms of life, and it catalyzes the hydrolysis of NUcleoside DIphosphates linked to other moieties, X. Enzymes belonging to this superfamily require a divalent cation, such as Mg2+ or Mn2+...; Region: Nudix_Hydrolase; cl00447
261594005344	nudix motif; other site
261594005345	PPOX class probable FMN-dependent enzyme, DR_2398 family; Region: PPOX_FMN_DR2398; TIGR04025
261594005346	homoserine dehydrogenase; Provisional; Region: PRK06349
261594005347	Homoserine dehydrogenase, NAD binding domain; Region: NAD_binding_3; pfam03447
261594005348	Homoserine dehydrogenase; Region: Homoserine_dh; pfam00742
261594005349	ACT_HSDH_Hom CD includes the C-terminal ACT domain of the NAD(P)H-dependent, homoserine dehydrogenase (HSDH) and related domains; Region: ACT_HSDH-Hom; cd04881
261594005350	threonine synthase; Reviewed; Region: PRK06721
261594005351	Threonine synthase is a pyridoxal phosphate (PLP) dependent enzyme that catalyses the last reaction in the synthesis of  threonine from aspartate. It proceeds by converting O-phospho-L-homoserine (OPH) into threonine and inorganic phosphate. In plants; Region: Thr-synth_1; cd01563
261594005352	homodimer interface [polypeptide binding]; other site
261594005353	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594005354	catalytic residue [active]
261594005355	homoserine kinase; Provisional; Region: PRK01212
261594005356	GHMP kinases N terminal domain; Region: GHMP_kinases_N; pfam00288
261594005357	GHMP kinases C terminal; Region: GHMP_kinases_C; pfam08544
261594005358	Glycosyl hydrolases related to GH101 family; Region: GHL; pfam11308
261594005359	Cell envelope-related transcriptional attenuator domain; Region: LytR_cpsA_psr; cl00581
261594005360	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
261594005361	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594005362	active site
261594005363	phosphorylation site [posttranslational modification]
261594005364	intermolecular recognition site; other site
261594005365	dimerization interface [polypeptide binding]; other site
261594005366	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
261594005367	DNA binding site [nucleotide binding]
261594005368	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
261594005369	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
261594005370	dimerization interface [polypeptide binding]; other site
261594005371	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
261594005372	dimer interface [polypeptide binding]; other site
261594005373	phosphorylation site [posttranslational modification]
261594005374	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594005375	ATP binding site [chemical binding]; other site
261594005376	Mg2+ binding site [ion binding]; other site
261594005377	G-X-G motif; other site
261594005378	Predicted xylanase/chitin deacetylase [Carbohydrate transport and metabolism]; Region: CDA1; COG0726
261594005379	Catalytic NodB homology domain of Streptococcus mutans polysaccharide deacetylase PgdA, Bacillus subtilis YheN, and similar proteins; Region: CE4_SmPgdA_like; cd10944
261594005380	NodB motif; other site
261594005381	active site
261594005382	catalytic site [active]
261594005383	Zn binding site [ion binding]; other site
261594005384	Putative cell-wall binding lipoprotein; Region: YkyA; pfam10368
261594005385	Uncharacterized membrane protein [Function unknown]; Region: SapB; COG1285
261594005386	MgtC family; Region: MgtC; pfam02308
261594005387	Acetyltransferase (GNAT) domain; Region: Acetyltransf_10; pfam13673
261594005388	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594005389	Coenzyme A binding pocket [chemical binding]; other site
261594005390	Siderophore synthetase component [Secondary metabolites biosynthesis, transport, and catabolism]; Region: RhbC; COG4264
261594005391	IucA / IucC family; Region: IucA_IucC; pfam04183
261594005392	Ferric iron reductase FhuF-like transporter; Region: FhuF; pfam06276
261594005393	Siderophore synthetase component [Secondary metabolites biosynthesis, transport, and catabolism]; Region: RhbC; COG4264
261594005394	IucA / IucC family; Region: IucA_IucC; pfam04183
261594005395	Ferric iron reductase FhuF-like transporter; Region: FhuF; pfam06276
261594005396	acyl-CoA synthetase; Validated; Region: PRK08308
261594005397	Adenylate forming domain, Class I; Region: AFD_class_I; cl17068
261594005398	acyl-activating enzyme (AAE) consensus motif; other site
261594005399	AMP binding site [chemical binding]; other site
261594005400	active site
261594005401	CoA binding site [chemical binding]; other site
261594005402	acyl carrier protein; Provisional; Region: PRK07639
261594005403	Sugar phosphate isomerases/epimerases [Carbohydrate transport and metabolism]; Region: IolE; COG1082
261594005404	Small, acid-soluble spore proteins, alpha/beta type; Region: SASP; pfam00269
261594005405	Lysine efflux permease [General function prediction only]; Region: COG1279
261594005406	Protein of unknown function (DUF3933); Region: DUF3933; pfam13069
261594005407	Predicted esterase of the alpha-beta hydrolase superfamily [General function prediction only]; Region: RssA; COG1752
261594005408	ExoU and VipD-like proteins; homologus to patatin, cPLA2, and iPLA2; Region: Pat_ExoU_VipD_like; cd07207
261594005409	active site
261594005410	nucleophile elbow; other site
261594005411	Domain of unknown function (DUF1963); Region: DUF1963; pfam09234
261594005412	Uncharacterized protein involved in cytokinesis, contains TGc (transglutaminase/protease-like) domain [Cell division and chromosome partitioning]; Region: CYK3; COG5279
261594005413	Transglutaminase-like superfamily; Region: Transglut_core; pfam01841
261594005414	Domain of unknown function (DUF4083); Region: DUF4083; pfam13314
261594005415	Members of the Nudix hydrolase superfamily catalyze the hydrolysis of NUcleoside DIphosphates linked to other moieties, X. Enzymes belonging to this superfamily require a divalent cation, such as Mg2+ or Mn2+, for their activity and contain a highly...; Region: Nudix_Hydrolase_18; cd04677
261594005416	nudix motif; other site
261594005417	NAD synthase [Coenzyme metabolism]; Region: NadE; COG0171
261594005418	NAD+ synthase is a homodimer, which catalyzes the final step in de novo nicotinamide adenine dinucleotide (NAD+) biosynthesis, an amide transfer from either ammonia or glutamine to nicotinic acid adenine dinucleotide (NaAD). The conversion of NaAD to NAD...; Region: NAD_synthase; cd00553
261594005419	homodimer interface [polypeptide binding]; other site
261594005420	NAD binding pocket [chemical binding]; other site
261594005421	ATP binding pocket [chemical binding]; other site
261594005422	Mg binding site [ion binding]; other site
261594005423	active-site loop [active]
261594005424	Regulators of stationary/sporulation gene expression [Transcription]; Region: AbrB; COG2002
261594005425	SpoVT / AbrB like domain; Region: SpoVT_AbrB; smart00966
261594005426	Peptidase S8 family domain in Subtilisin proteins; Region: Peptidases_S8_Subtilisin_subset; cd07477
261594005427	active site
261594005428	catalytic residues [active]
261594005429	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
261594005430	dimerization interface [polypeptide binding]; other site
261594005431	putative DNA binding site [nucleotide binding]; other site
261594005432	putative Zn2+ binding site [ion binding]; other site
261594005433	Aldo-keto reductases (AKRs) are a superfamily of soluble NAD(P)(H) oxidoreductases whose chief purpose is to reduce aldehydes and ketones to primary and secondary alcohols. AKRs are present in all phyla and are of importance to both health and industrial...; Region: Aldo_ket_red; cd06660
261594005434	Aldo/keto reductase family; Region: Aldo_ket_red; pfam00248
261594005435	active site
261594005436	catalytic tetrad [active]
261594005437	Arabinose efflux permease [Carbohydrate transport and metabolism]; Region: AraJ; COG2814
261594005438	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594005439	putative substrate translocation pore; other site
261594005440	Protein of unknown function (DUF4257); Region: DUF4257; pfam14074
261594005441	Protein of unknown function (DUF664); Region: DUF664; pfam04978
261594005442	DinB superfamily; Region: DinB_2; pfam12867
261594005443	GTPase RsgA; Reviewed; Region: PRK01889
261594005444	S1_like: Ribosomal protein S1-like RNA-binding domain. Found in a wide variety of RNA-associated proteins. Originally identified in S1 ribosomal protein. This superfamily also contains the Cold Shock Domain (CSD), which is a homolog of the S1 domain; Region: S1_like; cl09927
261594005445	RNA binding site [nucleotide binding]; other site
261594005446	Ribosomal interacting GTPase YjeQ/EngC, a circularly permuted subfamily of the Ras GTPases; Region: YjeQ_EngC; cd01854
261594005447	GTPase/Zn-binding domain interface [polypeptide binding]; other site
261594005448	GTP/Mg2+ binding site [chemical binding]; other site
261594005449	G4 box; other site
261594005450	G5 box; other site
261594005451	G1 box; other site
261594005452	Switch I region; other site
261594005453	G2 box; other site
261594005454	G3 box; other site
261594005455	Switch II region; other site
261594005456	Tar ligand binding domain homologue; Region: TarH; pfam02203
261594005457	Cache domain; Region: Cache_1; pfam02743
261594005458	Methyl-accepting chemotaxis protein [Cell motility and secretion / Signal transduction mechanisms]; Region: Tar; COG0840
261594005459	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
261594005460	dimerization interface [polypeptide binding]; other site
261594005461	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
261594005462	dimer interface [polypeptide binding]; other site
261594005463	putative CheW interface [polypeptide binding]; other site
261594005464	Protein of unknown function (DUF3979); Region: DUF3979; pfam13141
261594005465	Uncharacterized membrane protein [Function unknown]; Region: COG3949
261594005466	DNA-binding ferritin-like protein (oxidative damage protectant) [Inorganic ion transport and metabolism]; Region: Dps; COG0783
261594005467	DPS protein, ferritin-like diiron-binding domain; Region: DPS; cd01043
261594005468	dimerization interface [polypeptide binding]; other site
261594005469	DPS ferroxidase diiron center [ion binding]; other site
261594005470	ion pore; other site
261594005471	Protein of unknown function (DUF3939); Region: DUF3939; pfam13075
261594005472	Alpha/beta hydrolase family; Region: Abhydrolase_5; pfam12695
261594005473	Flavin-utilizing monoxygenases; Region: Flavin_utilizing_monoxygenases; cd00347
261594005474	luciferase family oxidoreductase, group 1; Region: oxido_grp_1; TIGR03558
261594005475	Protein of unknown function (DUF3896); Region: DUF3896; pfam13035
261594005476	Monoamine oxidase [Amino acid transport and metabolism]; Region: COG1231
261594005477	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; pfam13450
261594005478	Acetyltransferase (GNAT) domain; Region: Acetyltransf_3; pfam13302
261594005479	Acetyltransferase (GNAT) family; Region: Acetyltransf_1; pfam00583
261594005480	Aldo-keto reductases (AKRs) are a superfamily of soluble NAD(P)(H) oxidoreductases whose chief purpose is to reduce aldehydes and ketones to primary and secondary alcohols. AKRs are present in all phyla and are of importance to both health and industrial...; Region: Aldo_ket_red; cd06660
261594005481	Aldo/keto reductase family; Region: Aldo_ket_red; pfam00248
261594005482	active site
261594005483	catalytic tetrad [active]
261594005484	Putative GTPases (G3E family) [General function prediction only]; Region: COG0523
261594005485	The function of this protein family is unkown. The amino acid sequence of YjiA protein in E. coli contains several conserved motifs that characterizes it as a P-loop GTPase. YijA gene is among the genes significantly induced in response to DNA-damage...; Region: CobW_like; cd03112
261594005486	P-loop, Walker A motif; other site
261594005487	Base recognition motif; other site
261594005488	Cobalamin synthesis protein cobW C-terminal domain; Region: CobW_C; pfam07683
261594005489	Acetyltransferase (GNAT) domain; Region: Acetyltransf_10; pfam13673
261594005490	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594005491	Coenzyme A binding pocket [chemical binding]; other site
261594005492	DNA polymerase III subunits gamma and tau; Provisional; Region: PRK14959
261594005493	Camelysin metallo-endopeptidase; Region: Peptidase_M73; cl13780
261594005494	Metal binding protein AcdA.  These proteins have been shown to function in the ABC uptake of Zn2+ and Mn2+ and in competence for genetic transformation and adhesion. The AcdA proteins belong to the TroA superfamily of helical backbone metal receptor...; Region: AdcA; cd01017
261594005495	Periplasmic solute binding protein family; Region: SBP_bac_9; pfam01297
261594005496	metal binding site [ion binding]; metal-binding site
261594005497	CC3(TIP30)-like, atypical (a) SDRs; Region: CC3_like_SDR_a; cd05250
261594005498	NADH(P)-binding; Region: NAD_binding_10; pfam13460
261594005499	NAD binding site [chemical binding]; other site
261594005500	active site
261594005501	NADH:flavin oxidoreductases, Old Yellow Enzyme family [Energy production and conversion]; Region: NemA; COG1902
261594005502	Old yellow enzyme (OYE) YqjM-like FMN binding domain. YqjM is involved in the oxidative stress response of Bacillus subtilis.  Like the other OYE members, each monomer of YqjM contains FMN as a non-covalently bound cofactor and uses NADPH as a reducing...; Region: OYE_YqiM_FMN; cd02932
261594005503	active site
261594005504	FMN binding site [chemical binding]; other site
261594005505	substrate binding site [chemical binding]; other site
261594005506	homotetramer interface [polypeptide binding]; other site
261594005507	catalytic residue [active]
261594005508	methylated-DNA--protein-cysteine methyltransferase; Provisional; Region: PRK00901
261594005509	6-O-methylguanine DNA methyltransferase, ribonuclease-like domain; Region: Methyltransf_1N; pfam02870
261594005510	The DNA repair protein O6-alkylguanine-DNA alkyltransferase (ATase; also known as AGT, AGAT and MGMT) reverses O6-alkylation DNA damage by transferring O6-alkyl adducts to an active site cysteine irreversibly, without inducing DNA strand breaks. ATases...; Region: ATase; cd06445
261594005511	DNA binding site [nucleotide binding]
261594005512	active site
261594005513	Protein of unknown function (DUF2628); Region: DUF2628; pfam10947
261594005514	ABC-type oligopeptide transport system, periplasmic component [Amino acid transport and metabolism]; Region: OppA; COG4166
261594005515	The substrate-binding component of an ABC-type oligopetide import system contains the type 2 periplasmic binding fold; Region: PBP2_OppA; cd08504
261594005516	peptide binding site [polypeptide binding]; other site
261594005517	fosfomycin resistance protein FosB; Provisional; Region: PRK04101
261594005518	This domain superfamily is found in a variety of structurally related metalloproteins, including the type I extradiol dioxygenases, glyoxalase I and a group of antibiotic resistance proteins; Region: Glo_EDI_BRP_like; cl14632
261594005519	active site
261594005520	metal binding site [ion binding]; metal-binding site
261594005521	short chain dehydrogenase; Provisional; Region: PRK08309
261594005522	Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067
261594005523	catalytic core [active]
261594005524	CotH protein; Region: CotH; pfam08757
261594005525	Hydrolase of X-linked nucleoside diphosphate N terminal; Region: Nudix_N; pfam12535
261594005526	Members of the Nudix hydrolase superfamily catalyze the hydrolysis of NUcleoside DIphosphates linked to other moieties, X. Enzymes belonging to this superfamily require a divalent cation, such as Mg2+ or Mn2+, for their activity and contain a highly...; Region: Nudix_Hydrolase_14; cd04672
261594005527	nudix motif; other site
261594005528	Uncharacterized membrane-associated protein [Function unknown]; Region: DedA; COG0586
261594005529	SNARE associated Golgi protein; Region: SNARE_assoc; pfam09335
261594005530	Membrane protein involved in the export of O-antigen and teichoic acid [General function prediction only]; Region: RfbX; COG2244
261594005531	Stage V sporulation protein B, also known as Stage III sporulation protein F, and related proteins; Region: MATE_SpoVB_like; cd13124
261594005532	Mg2+ and Co2+ transporters [Inorganic ion transport and metabolism]; Region: CorA; COG0598
261594005533	uncharacterized bacterial subfamily of the Escherichia coli CorA-Salmonella typhimurium ZntB family; Region: EcCorA_ZntB-like_u2; cd12827
261594005534	Cl binding site [ion binding]; other site
261594005535	oligomer interface [polypeptide binding]; other site
261594005536	Predicted permeases [General function prediction only]; Region: COG0701
261594005537	Predicted membrane protein [Function unknown]; Region: COG3689
261594005538	Brown fat-inducible thioesterase (BFIT).  Brain acyl-CoA hydrolase (BACH).  These enzymes deacylate long-chain fatty acids by hydrolyzing acyl-CoA thioesters to free fatty acids and CoA-SH. Eukaryotic members of this family are expressed in brain, testis; Region: BFIT_BACH; cd03442
261594005539	biliverdin IX beta reductase (BVR-B, aka flavin reductase)-like proteins; atypical (a) SDRs; Region: BVR-B_like_SDR_a; cd05244
261594005540	NADH(P)-binding; Region: NAD_binding_10; pfam13460
261594005541	NAD binding site [chemical binding]; other site
261594005542	substrate binding site [chemical binding]; other site
261594005543	putative active site [active]
261594005544	Protein of unknown function (DUF456); Region: DUF456; pfam04306
261594005545	Hemolysins and related proteins containing CBS domains [General function prediction only]; Region: TlyC; COG1253
261594005546	Domain of unknown function DUF21; Region: DUF21; pfam01595
261594005547	This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domains associated with the CorC_HlyC domain. CorC_HlyC is a transporter associated domain. This small domain is found in Na+/H+ antiporters, in proteins involved in...; Region: CBS_pair_CorC_HlyC_assoc; cd04590
261594005548	Transporter associated domain; Region: CorC_HlyC; smart01091
261594005549	FOG: CBS domain [General function prediction only]; Region: COG0517
261594005550	The CBS domain, named after human CBS, is a small domain originally identified in cystathionine beta-synthase and is subsequently found in a wide range of different proteins. CBS domains usually occur in tandem repeats. They associate to form a so-called...; Region: CBS_pair; cd02205
261594005551	Branched-chain amino acid transport protein; Region: Branch_AA_trans; pfam05525
261594005552	tRNA-binding-domain-containing CsaA-like proteins. CsaA is a molecular chaperone with export related activities. CsaA has a putative tRNA binding activity. The functional unit of CsaA is a homodimer and this domain acts as a dimerization domain; Region: tRNA_bind_CsaA; cd02798
261594005553	dimer interface [polypeptide binding]; other site
261594005554	putative tRNA-binding site [nucleotide binding]; other site
261594005555	Protein of unknown function (DUF1572); Region: DUF1572; pfam07609
261594005556	DinB superfamily; Region: DinB_2; pfam12867
261594005557	Stage II sporulation protein P (SpoIIP); Region: SpoIIP; pfam07454
261594005558	stage II sporulation protein P; Region: spore_II_P; TIGR02867
261594005559	Acetyltransferase (GNAT) domain; Region: Acetyltransf_3; pfam13302
261594005560	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594005561	Coenzyme A binding pocket [chemical binding]; other site
261594005562	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cl17182
261594005563	D-alanyl-D-alanine carboxypeptidase [Cell envelope biogenesis, outer membrane]; Region: VanY; COG1876
261594005564	D-alanyl-D-alanine carboxypeptidase; Region: VanY; pfam02557
261594005565	Members of the Nudix hydrolase superfamily catalyze the hydrolysis of NUcleoside DIphosphates linked to other moieties, X. Enzymes belong to this superfamily requires a divalent cation, such as Mg2+ or Mn2+ for their activity and contain a highly...; Region: Nudix_Hydrolase_6; cd04663
261594005566	nudix motif; other site
261594005567	amidase; Provisional; Region: PRK06828
261594005568	Amidase; Region: Amidase; pfam01425
261594005569	H+ Antiporter protein; Region: 2A0121; TIGR00900
261594005570	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594005571	putative substrate translocation pore; other site
261594005572	Membrane protein implicated in regulation of membrane protease activity [Posttranslational modification, protein turnover, chaperones / Intracellular trafficking and secretion]; Region: COG1585
261594005573	Membrane protease subunits, stomatin/prohibitin homologs [Posttranslational modification, protein turnover, chaperones]; Region: HflC; COG0330
261594005574	Band_7_stomatin_like: A subgroup of the band 7 domain of flotillin (reggie) like proteins similar to stomatin and podicin (two lipid raft-associated integral membrane proteins). Individual proteins of this band 7 domain family may cluster to form...; Region: Band_7_stomatin_like; cd03403
261594005575	Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067
261594005576	catalytic core [active]
261594005577	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
261594005578	haloacid dehalogenase-like hydrolase; Region: Hydrolase_3; pfam08282
261594005579	active site
261594005580	motif I; other site
261594005581	motif II; other site
261594005582	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
261594005583	DinB superfamily; Region: DinB_2; pfam12867
261594005584	DinB family; Region: DinB; cl17821
261594005585	Type III Pyridoxal 5-phosphate (PLP)-Dependent Enzyme Alanine Racemase; Region: PLPDE_III_AR; cd00430
261594005586	alanine racemase; Reviewed; Region: alr; PRK00053
261594005587	active site
261594005588	pyridoxal 5'-phosphate (PLP) binding site [chemical binding]; other site
261594005589	dimer interface [polypeptide binding]; other site
261594005590	substrate binding site [chemical binding]; other site
261594005591	catalytic residues [active]
261594005592	Methyltransferase domain; Region: Methyltransf_31; pfam13847
261594005593	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594005594	S-adenosylmethionine binding site [chemical binding]; other site
261594005595	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594005596	Coenzyme A binding pocket [chemical binding]; other site
261594005597	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594005598	Coenzyme A binding pocket [chemical binding]; other site
261594005599	Protein Kinases, catalytic domain; Region: PKc_like; cl09925
261594005600	active site
261594005601	ATP binding site [chemical binding]; other site
261594005602	substrate binding site [chemical binding]; other site
261594005603	This family includes the Gtfs, a group of homologous glycosyltransferases involved in the final stages of the biosynthesis of antibiotics vancomycin and related chloroeremomycin. Gtfs transfer sugar moieties from an activated NDP-sugar donor to the...; Region: GT1_Gtf_like; cd03784
261594005604	glycosyltransferase, MGT family; Region: MGT; TIGR01426
261594005605	active site
261594005606	TDP-binding site; other site
261594005607	acceptor substrate-binding pocket; other site
261594005608	homodimer interface [polypeptide binding]; other site
261594005609	Uncharacterized conserved protein [Function unknown]; Region: COG1284
261594005610	Uncharacterized BCR, YitT family COG1284; Region: DUF161; pfam02588
261594005611	Uncharacterized protein conserved in bacteria (DUF2179); Region: DUF2179; pfam10035
261594005612	Transcriptional regulators containing a DNA-binding HTH domain and an aminotransferase domain (MocR family) and their eukaryotic orthologs [Transcription / Amino acid transport and metabolism]; Region: ARO8; COG1167
261594005613	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
261594005614	DNA-binding site [nucleotide binding]; DNA binding site
261594005615	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
261594005616	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594005617	homodimer interface [polypeptide binding]; other site
261594005618	catalytic residue [active]
261594005619	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594005620	Coenzyme A binding pocket [chemical binding]; other site
261594005621	Protein of unknown function (DUF1648); Region: DUF1648; pfam07853
261594005622	Acetyltransferases, including N-acetylases of ribosomal proteins [Translation, ribosomal structure and biogenesis]; Region: RimL; COG1670
261594005623	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594005624	Coenzyme A binding pocket [chemical binding]; other site
261594005625	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cl17182
261594005626	Acetyltransferase (GNAT) domain; Region: Acetyltransf_10; pfam13673
261594005627	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594005628	Coenzyme A binding pocket [chemical binding]; other site
261594005629	Cupin domain; Region: Cupin_2; cl17218
261594005630	Domain of unknown function (DUF4176); Region: DUF4176; cl01867
261594005631	Sporulation protein YtfJ (Spore_YtfJ); Region: Spore_YtfJ; cl01596
261594005632	Methyltransferase domain; Region: Methyltransf_23; pfam13489
261594005633	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594005634	S-adenosylmethionine binding site [chemical binding]; other site
261594005635	formate--tetrahydrofolate ligase; Provisional; Region: PRK13505
261594005636	Formyltetrahydrofolate synthetase (FTHFS) catalyzes the ATP-dependent activation of formate ion via its addition to the N10 position of tetrahydrofolate. FTHFS is a highly expressed key enzyme in both the Wood-Ljungdahl pathway of autotrophic CO2...; Region: FTHFS; cd00477
261594005637	Potassium binding sites [ion binding]; other site
261594005638	Cesium cation binding sites [ion binding]; other site
261594005639	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cl17251
261594005640	DEAD-like helicases superfamily; Region: DEXDc; smart00487
261594005641	ATP binding site [chemical binding]; other site
261594005642	putative Mg++ binding site [ion binding]; other site
261594005643	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
261594005644	nucleotide binding region [chemical binding]; other site
261594005645	ATP-binding site [chemical binding]; other site
261594005646	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
261594005647	This conserved domain belongs to a superfamily including the bleomycin resistance protein, glyoxalase I, and type I ring-cleaving dioxygenases; Region: Glo_EDI_BRP_like_16; cd07263
261594005648	NADPH:quinone reductase and related Zn-dependent oxidoreductases [Energy production and conversion / General function prediction only]; Region: Qor; COG0604
261594005649	Quinone oxidoreductase (QOR); Region: QOR2; cd05286
261594005650	NADP binding site [chemical binding]; other site
261594005651	dimer interface [polypeptide binding]; other site
261594005652	RNA polymerase sigma factor; Provisional; Region: PRK12543
261594005653	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
261594005654	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
261594005655	DNA binding residues [nucleotide binding]
261594005656	Domain of unknown function (DUF3600); Region: DUF3600; pfam12207
261594005657	Metallo-beta-lactamase superfamily; Region: Lactamase_B; smart00849
261594005658	Protein of unknown function (DUF3925); Region: DUF3925; pfam13063
261594005659	Glutathione (GSH) peroxidase family; tetrameric selenoenzymes that catalyze the reduction of a variety of hydroperoxides including lipid peroxidases, using GSH as a specific electron donor substrate. GSH peroxidase contains one selenocysteine residue per...; Region: GSH_Peroxidase; cd00340
261594005660	catalytic residues [active]
261594005661	dimer interface [polypeptide binding]; other site
261594005662	Transglutaminase-like enzymes, putative cysteine proteases [Amino acid transport and metabolism]; Region: COG1305
261594005663	Transglutaminase-like superfamily; Region: Transglut_core; pfam01841
261594005664	Domain of unknown function (DUF4129); Region: DUF4129; pfam13559
261594005665	Uncharacterized conserved protein (some members contain a von Willebrand factor type A (vWA) domain) [General function prediction only]; Region: COG1721
261594005666	Protein of unknown function DUF58; Region: DUF58; pfam01882
261594005667	MoxR-like ATPases [General function prediction only]; Region: COG0714
261594005668	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
261594005669	Walker A motif; other site
261594005670	ATP binding site [chemical binding]; other site
261594005671	Walker B motif; other site
261594005672	arginine finger; other site
261594005673	F0F1 ATP synthase subunit epsilon; Validated; Region: atpC; PRK00571
261594005674	Nitrate reductase alpha subunit [Energy production and conversion]; Region: NarG; COG5013
261594005675	Respiratory nitrate reductase A (NarGHI), alpha chain (NarG) and related proteins. Under anaerobic conditions in the presence of nitrate, E. coli synthesizes the cytoplasmic membrane-bound quinol-nitrate oxidoreductase (NarGHI), which reduces nitrate to...; Region: MopB_Nitrate-R-NarG-like; cd02750
261594005676	[4Fe-4S] binding site [ion binding]; other site
261594005677	Molybdopterin-Binding (MopB) domain of the MopB superfamily of proteins, a  large, diverse, heterogeneous superfamily of enzymes that, in general, bind molybdopterin as a cofactor. The MopB domain is found in a wide variety of molybdenum- and...; Region: Molybdopterin-Binding; cl09928
261594005678	Molybdopterin-Binding (MopB) domain of the MopB superfamily of proteins, a  large, diverse, heterogeneous superfamily of enzymes that, in general, bind molybdopterin as a cofactor. The MopB domain is found in a wide variety of molybdenum- and...; Region: Molybdopterin-Binding; cl09928
261594005679	Molybdopterin-Binding (MopB) domain of the MopB superfamily of proteins, a  large, diverse, heterogeneous superfamily of enzymes that, in general, bind molybdopterin as a cofactor. The MopB domain is found in a wide variety of molybdenum- and...; Region: Molybdopterin-Binding; cl09928
261594005680	Respiratory nitrate reductase A (NarGHI), alpha chain (NarG) and related proteins. Under anaerobic conditions in the presence of nitrate, E. coli synthesizes the cytoplasmic membrane-bound quinol-nitrate oxidoreductase (NarGHI), which reduces nitrate to...; Region: MopB_CT_Nitrate-R-NarG-like; cd02776
261594005681	molybdopterin cofactor binding site; other site
261594005682	Nitrate reductase beta subunit [Energy production and conversion]; Region: NarY; COG1140
261594005683	RPB11 and RPB3 subunits of RNA polymerase; Region: RNAP_RPB11_RPB3; cl11409
261594005684	Aldo-keto reductases (AKRs) are a superfamily of soluble NAD(P)(H) oxidoreductases whose chief purpose is to reduce aldehydes and ketones to primary and secondary alcohols. AKRs are present in all phyla and are of importance to both health and industrial...; Region: Aldo_ket_red; cl00470
261594005685	Nitrate reductase delta subunit; Region: Nitrate_red_del; cl00958
261594005686	Nitrate reductase gamma subunit; Region: Nitrate_red_gam; pfam02665
261594005687	Predicted transcriptional regulators [Transcription]; Region: COG1725
261594005688	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
261594005689	DNA-binding site [nucleotide binding]; DNA binding site
261594005690	ABC-type multidrug transport system, ATPase component [Defense mechanisms]; Region: CcmA; COG1131
261594005691	ATP-binding cassette domain of the drug resistance transporter and related proteins, subfamily A; Region: ABC_DR_subfamily_A; cd03230
261594005692	Walker A/P-loop; other site
261594005693	ATP binding site [chemical binding]; other site
261594005694	Q-loop/lid; other site
261594005695	ABC transporter signature motif; other site
261594005696	Walker B; other site
261594005697	D-loop; other site
261594005698	H-loop/switch region; other site
261594005699	ABC-2 family transporter protein; Region: ABC2_membrane_5; pfam13346
261594005700	cAMP-binding proteins - catabolite gene activator and regulatory subunit of cAMP-dependent protein kinases [Signal transduction mechanisms]; Region: Crp; COG0664
261594005701	effector domain of the CAP family of transcription factors; members include CAP (or cAMP receptor protein (CRP)), which binds cAMP, FNR (fumarate and nitrate reduction), which uses an iron-sulfur cluster to sense oxygen) and CooA, a heme containing CO...; Region: CAP_ED; cd00038
261594005702	ligand binding site [chemical binding]; other site
261594005703	flexible hinge region; other site
261594005704	helix_turn_helix, cAMP Regulatory protein C-terminus; DNA binding domain of prokaryotic regulatory proteins belonging to the catabolite activator protein family; Region: HTH_CRP; cd00092
261594005705	putative switch regulator; other site
261594005706	non-specific DNA interactions [nucleotide binding]; other site
261594005707	DNA binding site [nucleotide binding]
261594005708	sequence specific DNA binding site [nucleotide binding]; other site
261594005709	putative cAMP binding site [chemical binding]; other site
261594005710	molybdenum cofactor biosynthesis protein A, bacterial; Region: moaA; TIGR02666
261594005711	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
261594005712	FeS/SAM binding site; other site
261594005713	Molybdenum Cofactor Synthesis C; Region: Mob_synth_C; pfam06463
261594005714	thiamine/molybdopterin biosynthesis MoeB-like protein; Provisional; Region: PRK12475
261594005715	ThiF_MoeB_HesA. Family of E1-like enzymes involved in molybdopterin and thiamine biosynthesis family. The common reaction mechanism catalyzed by MoeB and ThiF, like other E1 enzymes, begins with a nucleophilic attack of the C-terminal carboxylate of MoaD...; Region: ThiF_MoeB_HesA_family; cd00757
261594005716	ATP binding site [chemical binding]; other site
261594005717	substrate interface [chemical binding]; other site
261594005718	Molybdopterin biosynthesis enzyme [Coenzyme metabolism]; Region: MoeA; COG0303
261594005719	MoeA family. Members of this family are involved in biosynthesis of the molybdenum cofactor (MoCF), an essential cofactor of a diverse group of redox enzymes. MoCF biosynthesis is an evolutionarily conserved pathway present in eubacteria, archaea and...; Region: MoeA; cd00887
261594005720	dimer interface [polypeptide binding]; other site
261594005721	putative functional site; other site
261594005722	putative MPT binding site; other site
261594005723	MoaE family. Members of this family are involved in biosynthesis of the molybdenum cofactor (Moco), an essential cofactor for a diverse group of redox enzymes. Moco biosynthesis is an evolutionarily conserved pathway present in eubacteria, archaea and...; Region: MoaE; cd00756
261594005724	MoaE homodimer interface [polypeptide binding]; other site
261594005725	MoaD interaction [polypeptide binding]; other site
261594005726	active site residues [active]
261594005727	Ubiquitin domain of MoaD-like proteins; Region: MoaD; cd00754
261594005728	MoaE interaction surface [polypeptide binding]; other site
261594005729	MoeB interaction surface [polypeptide binding]; other site
261594005730	thiocarboxylated glycine; other site
261594005731	Nitrate/nitrite transporter [Inorganic ion transport and metabolism]; Region: NarK; COG2223
261594005732	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594005733	putative substrate translocation pore; other site
261594005734	Predicted permeases [General function prediction only]; Region: COG0679
261594005735	precorrin-2 dehydrogenase; Validated; Region: PRK06719
261594005736	Siroheme synthase (precorrin-2 oxidase/ferrochelatase domain) [Coenzyme metabolism]; Region: CysG; COG1648
261594005737	Sirohydrochlorin ferrochelatase [Inorganic ion transport and metabolism]; Region: COG2138
261594005738	Sirohydrochlorin cobalt chelatase (CbiX) and sirohydrochlorin iron chelatase (SirB), N-terminal domain. SirB catalyzes the ferro-chelation of sirohydrochlorin to siroheme, the prosthetic group of sulfite and nitrite reductases. CbiX is a cobaltochelatase; Region: CbiX_SirB_N; cd03416
261594005739	putative active site [active]
261594005740	Sirohydrochlorin cobalt chelatase (CbiX) and sirohydrochlorin iron chelatase (SirB), C-terminal domain. SirB catalyzes the ferro-chelation of sirohydrochlorin to siroheme, the prosthetic group of sulfite and nitrite reductases. CbiX is a cobaltochelatase; Region: CbiX_SirB_C; cd03414
261594005741	putative active site [active]
261594005742	bifunctional uroporphyrinogen-III methyltransferase/uroporphyrinogen-III synthase; Reviewed; Region: PRK07168
261594005743	Uroporphyrin-III C-methyltransferase (S-Adenosyl-L-methionine:uroporphyrinogen III methyltransferase, SUMT); Region: SUMT; cd11642
261594005744	active site
261594005745	SAM binding site [chemical binding]; other site
261594005746	homodimer interface [polypeptide binding]; other site
261594005747	Uroporphyrinogen-III synthase (HemD) catalyzes the asymmetrical cyclization of tetrapyrrole (linear) to uroporphyrinogen-III, the fourth step in the biosynthesis of heme. This ubiquitous enzyme is present in eukaryotes, bacteria and archaea. Mutations in...; Region: HemD; cd06578
261594005748	Small subunit of nitrite reductase (NirD) family, Rieske domain; composed of proteins similar to the Bacillus subtilis small subunit of assimilatory nitrite reductase containing a Rieske domain. The Rieske domain is a [2Fe-2S] cluster binding domain...; Region: Rieske_NirD_small_Bacillus; cd03530
261594005749	[2Fe-2S] cluster binding site [ion binding]; other site
261594005750	NAD(P)H-nitrite reductase [Energy production and conversion]; Region: NirB; COG1251
261594005751	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
261594005752	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
261594005753	BFD-like [2Fe-2S] binding domain; Region: Fer2_BFD; pfam04324
261594005754	BFD-like [2Fe-2S] binding domain; Region: Fer2_BFD; pfam04324
261594005755	Nitrite/Sulfite reductase ferredoxin-like half domain; Region: NIR_SIR_ferr; pfam03460
261594005756	Domain of Unknown function (DUF542); Region: ScdA_N; pfam04405
261594005757	iron-sulfur cluster repair di-iron protein; Region: FeS_repair_RIC; TIGR03652
261594005758	Hemerythrin-like domain; Region: Hr-like; cd12108
261594005759	Fe binding site [ion binding]; other site
261594005760	Excalibur calcium-binding domain; Region: Excalibur; pfam05901
261594005761	N-acetyltransferase; Region: Acetyltransf_2; cl00949
261594005762	Predicted acetyltransferases and hydrolases with the alpha/beta hydrolase fold [General function prediction only]; Region: LipA; COG1075
261594005763	PGAP1-like protein; Region: PGAP1; pfam07819
261594005764	Stage V sporulation protein S (SpoVS); Region: SpoVS; pfam04232
261594005765	Predicted HD superfamily hydrolase [General function prediction only]; Region: COG1418
261594005766	Metal dependent phosphohydrolases with conserved 'HD' motif; Region: HDc; cd00077
261594005767	Zn2+ binding site [ion binding]; other site
261594005768	Mg2+ binding site [ion binding]; other site
261594005769	Metal dependent phosphohydrolases with conserved 'HD' motif; Region: HDc; cl17215
261594005770	ATPase components of ABC transporters with duplicated ATPase domains [General function prediction only]; Region: Uup; COG0488
261594005771	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
261594005772	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
261594005773	ABC transporter; Region: ABC_tran_2; pfam12848
261594005774	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
261594005775	Bax inhibitor 1 like; Region: BaxI_1; cl17691
261594005776	Domain of unknown function (DUF4318); Region: DUF4318; pfam14201
261594005777	Single-stranded DNA-binding protein [DNA replication, recombination, and repair]; Region: Ssb; COG0629
261594005778	SSB_OBF: A subfamily of OB folds similar to the OB fold of ssDNA-binding protein (SSB). SSBs bind with high affinity to ssDNA. They bind to and protect ssDNA intermediates during DNA metabolic pathways. All bacterial and eukaryotic SSBs studied to date...; Region: SSB_OBF; cd04496
261594005779	dimer interface [polypeptide binding]; other site
261594005780	ssDNA binding site [nucleotide binding]; other site
261594005781	tetramer (dimer of dimers) interface [polypeptide binding]; other site
261594005782	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
261594005783	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
261594005784	Scaffold protein Nfu/NifU N terminal; Region: Nfu_N; smart00932
261594005785	Virulence factor; Region: Virulence_fact; pfam13769
261594005786	HEAT repeats; Region: HEAT_2; pfam13646
261594005787	HEAT repeats; Region: HEAT_2; pfam13646
261594005788	E-Z type HEAT repeats; Region: EZ_HEAT; smart00567
261594005789	Protein of unknown function, DUF393; Region: DUF393; pfam04134
261594005790	Disulphide isomerase; Region: Disulph_isomer; pfam06491
261594005791	Brix domain; Region: Brix; cl00935
261594005792	Putative SAM-dependent methyltransferase; Region: SAM_MT; cl17517
261594005793	arginyl-tRNA synthetase; Reviewed; Region: PRK12451
261594005794	Arginyl tRNA synthetase N terminal dom; Region: Arg_tRNA_synt_N; smart01016
261594005795	catalytic core domain of arginyl-tRNA synthetases; Region: ArgRS_core; cd00671
261594005796	active site
261594005797	HIGH motif; other site
261594005798	KMSK motif region; other site
261594005799	Anticodon-binding domain of arginyl tRNA synthetases; Region: Anticodon_Ia_Arg; cd07956
261594005800	tRNA binding surface [nucleotide binding]; other site
261594005801	anticodon binding site; other site
261594005802	Predicted membrane protein (DUF2085); Region: DUF2085; pfam09858
261594005803	Methyltransferase domain; Region: Methyltransf_31; pfam13847
261594005804	Methyltransferase domain; Region: Methyltransf_12; pfam08242
261594005805	Isoleucyl-tRNA synthetase [Translation, ribosomal structure and biogenesis]; Region: IleS; COG0060
261594005806	catalytic core domain of isoleucyl-tRNA synthetases; Region: IleRS_core; cd00818
261594005807	HIGH motif; other site
261594005808	catalytic core domain of isoleucyl-tRNA synthetases; Region: IleRS_core; cd00818
261594005809	active site
261594005810	KMSKS motif; other site
261594005811	Anticodon-binding domain of archaeal, bacterial, and eukaryotic cytoplasmic isoleucyl tRNA synthetases; Region: Anticodon_Ia_Ile_ABEc; cd07961
261594005812	tRNA binding surface [nucleotide binding]; other site
261594005813	anticodon binding site; other site
261594005814	Zinc metalloprotease (elastase) [Amino acid transport and metabolism]; Region: LasB; COG3227
261594005815	Fungalysin/Thermolysin Propeptide Motif; Region: FTP; pfam07504
261594005816	Peptidase propeptide and YPEB domain; Region: PepSY; pfam03413
261594005817	Peptidase M36 family also known as fungalysin family; Region: M36; cd09596
261594005818	Zn binding site [ion binding]; other site
261594005819	aspartyl-tRNA synthetase; Provisional; Region: aspC; PRK05159
261594005820	Replication protein A, class 2b aminoacyl-tRNA synthetases, and related proteins with oligonucleotide/oligosaccharide (OB) fold; Region: RPA_2b-aaRSs_OBF_like; cl09930
261594005821	Dimer interface [polypeptide binding]; other site
261594005822	anticodon binding site; other site
261594005823	Asx tRNA synthetase (AspRS/AsnRS) class II core domain.  Assignment to class II aminoacyl-tRNA synthetases (aaRS) based upon its structure and the presence of three characteristic sequence motifs in the core domain. This family includes AsnRS as well as...; Region: AsxRS_core; cd00776
261594005824	homodimer interface [polypeptide binding]; other site
261594005825	motif 1; other site
261594005826	motif 2; other site
261594005827	active site
261594005828	motif 3; other site
261594005829	Von Willebrand factor type A (vWA) domain was originally found in the blood coagulation protein von Willebrand factor (vWF). Typically, the vWA domain is made up of approximately 200 amino acid residues folded into a classic a/b para-rossmann type of...; Region: vWFA; cd00198
261594005830	metal ion-dependent adhesion site (MIDAS); other site
261594005831	Serine/threonine phosphatases, family 2C, catalytic domain; The protein architecture and deduced catalytic mechanism of PP2C phosphatases are similar to the PP1, PP2A, PP2B family of protein Ser/Thr phosphatases, with which PP2C shares no sequence...; Region: PP2Cc; cl00120
261594005832	type VII secretion protein EssC, C-terminal domain; Region: T7_EssCb_Firm; TIGR03928
261594005833	FtsK/SpoIIIE family; Region: FtsK_SpoIIIE; pfam01580
261594005834	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
261594005835	Walker A motif; other site
261594005836	ATP binding site [chemical binding]; other site
261594005837	FtsK/SpoIIIE family; Region: FtsK_SpoIIIE; pfam01580
261594005838	WXG100 family type VII secretion target; Region: WXG100_ESAT6; TIGR03930
261594005839	Protein Kinases, catalytic domain; Region: PKc_like; cl09925
261594005840	active site
261594005841	ATP binding site [chemical binding]; other site
261594005842	substrate binding site [chemical binding]; other site
261594005843	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cd00189
261594005844	binding surface
261594005845	TPR motif; other site
261594005846	TPR repeat; Region: TPR_11; pfam13414
261594005847	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cd00189
261594005848	binding surface
261594005849	TPR motif; other site
261594005850	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cd00189
261594005851	binding surface
261594005852	Tetratricopeptide repeat; Region: TPR_12; pfam13424
261594005853	TPR motif; other site
261594005854	SseB protein; Region: SseB; cl06279
261594005855	WXG100 family type VII secretion target; Region: WXG100_ESAT6; TIGR03930
261594005856	A pre-toxin domain with the TG motif; Region: PT-TG; pfam14449
261594005857	The BURPS668_1122 family of deaminases; Region: Toxin-deaminase; pfam14424
261594005858	Immunity protein Imm3; Region: Imm3; pfam14425
261594005859	Site-specific recombinases, DNA invertase Pin homologs [DNA replication, recombination, and repair]; Region: PinR; COG1961
261594005860	Serine Recombinase family, catalytic domain; a DNA binding domain may be present either N- or C-terminal to the catalytic domain. These enzymes perform site-specific recombination of DNA molecules by a concerted, four-strand cleavage and rejoining...; Region: Ser_Recombinase; cd00338
261594005861	catalytic residues [active]
261594005862	catalytic nucleophile [active]
261594005863	Recombinase; Region: Recombinase; pfam07508
261594005864	Transposase; Region: DEDD_Tnp_IS110; pfam01548
261594005865	Transposase IS116/IS110/IS902 family; Region: Transposase_20; pfam02371
261594005866	SMI1 / KNR4 family; Region: SMI1_KNR4; smart00860
261594005867	Bacterial EndoU nuclease; Region: EndoU_bacteria; pfam14436
261594005868	glycerate kinase; Region: TIGR00045
261594005869	Di- and tricarboxylate transporters [Inorganic ion transport and metabolism]; Region: CitT; COG0471
261594005870	Anion permease ArsB/NhaD.  These permeases have been shown to translocate sodium, arsenate, antimonite, sulfate and organic anions across biological membranes in all three kingdoms of life.  A typical anion permease contains 8-13 transmembrane helices...; Region: ArsB_NhaD_permease; cl17221
261594005871	transmembrane helices; other site
261594005872	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
261594005873	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594005874	active site
261594005875	phosphorylation site [posttranslational modification]
261594005876	intermolecular recognition site; other site
261594005877	dimerization interface [polypeptide binding]; other site
261594005878	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
261594005879	DNA binding site [nucleotide binding]
261594005880	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
261594005881	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
261594005882	dimerization interface [polypeptide binding]; other site
261594005883	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
261594005884	dimer interface [polypeptide binding]; other site
261594005885	phosphorylation site [posttranslational modification]
261594005886	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594005887	ATP binding site [chemical binding]; other site
261594005888	Mg2+ binding site [ion binding]; other site
261594005889	G-X-G motif; other site
261594005890	Peptidase propeptide and YPEB domain; Region: PepSY; pfam03413
261594005891	Peptidase propeptide and YPEB domain; Region: PepSY; pfam03413
261594005892	Peptidase propeptide and YPEB domain; Region: PepSY; pfam03413
261594005893	solute carrier 6 subfamily, Fusobacterium nucleatum Tyt1-like; solute-binding domain; Region: SLC6sbd_Tyt1-Like; cd10336
261594005894	Na2 binding site [ion binding]; other site
261594005895	putative substrate binding site 1 [chemical binding]; other site
261594005896	Na binding site 1 [ion binding]; other site
261594005897	putative substrate binding site 2 [chemical binding]; other site
261594005898	Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596
261594005899	Bacterial protein of unknown function (DUF925); Region: DUF925; pfam06042
261594005900	Protein of unknown function (DUF2837); Region: DUF2837; pfam10997
261594005901	Predicted phosphatases [General function prediction only]; Region: Gph; COG0546
261594005902	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
261594005903	motif II; other site
261594005904	H+/gluconate symporter and related permeases [Carbohydrate transport and metabolism / Amino acid transport and metabolism]; Region: GntT; COG2610
261594005905	fructuronate transporter; Provisional; Region: PRK10034; cl15264
261594005906	Alcohol dehydrogenase, class IV [Energy production and conversion]; Region: EutG; COG1454
261594005907	Dehydroquinate synthase-like (DHQ-like) and iron-containing alcohol dehydrogenases (Fe-ADH); Region: DHQ_Fe-ADH; cl02872
261594005908	active site
261594005909	NAD binding site [chemical binding]; other site
261594005910	metal binding site [ion binding]; metal-binding site
261594005911	Aspartate racemase [Cell envelope biogenesis, outer membrane]; Region: RacX; COG1794
261594005912	aspartate racemase; Region: asp_race; TIGR00035
261594005913	Escherichia coli YaeB and related proteins; Region: UPF0066; cd09281
261594005914	homodimer interaction site [polypeptide binding]; other site
261594005915	cofactor binding site; other site
261594005916	Acetyltransferase (GNAT) domain; Region: Acetyltransf_10; pfam13673
261594005917	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594005918	Coenzyme A binding pocket [chemical binding]; other site
261594005919	Acetyltransferases [General function prediction only]; Region: RimI; COG0456
261594005920	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594005921	Coenzyme A binding pocket [chemical binding]; other site
261594005922	ABC-type cobalt transport system, ATPase component [Inorganic ion transport and metabolism]; Region: CbiO; COG1122
261594005923	ATP-binding cassette domain of the drug resistance transporter and related proteins, subfamily A; Region: ABC_DR_subfamily_A; cd03230
261594005924	Walker A/P-loop; other site
261594005925	ATP binding site [chemical binding]; other site
261594005926	Q-loop/lid; other site
261594005927	ABC transporter signature motif; other site
261594005928	Walker B; other site
261594005929	D-loop; other site
261594005930	H-loop/switch region; other site
261594005931	YpjP-like protein; Region: YpjP; pfam14005
261594005932	Predicted phosphatases [General function prediction only]; Region: Gph; COG0546
261594005933	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
261594005934	motif II; other site
261594005935	hypothetical protein; Provisional; Region: PRK06724
261594005936	active site
261594005937	Phosphotransferase enzyme family; Region: APH; pfam01636
261594005938	Aminoglycoside 3'-phosphotransferase (APH) and Choline Kinase (ChoK) family. The APH/ChoK family is part of a larger superfamily that includes the catalytic domains of other kinases, such as the typical serine/threonine/tyrosine protein kinases (PKs)...; Region: APH_ChoK_like; cd05120
261594005939	active site
261594005940	ATP binding site [chemical binding]; other site
261594005941	substrate binding site [chemical binding]; other site
261594005942	Peptidase family S41; Region: Peptidase_S41; pfam03572
261594005943	Active site serine [active]
261594005944	Beta-lactamase class C and other penicillin binding proteins [Defense mechanisms]; Region: AmpC; COG1680
261594005945	Beta-lactamase; Region: Beta-lactamase; pfam00144
261594005946	Domain of unknown function (DUF3471); Region: DUF3471; pfam11954
261594005947	thymidylate synthase; Region: thym_sym; TIGR03284
261594005948	Thymidylate synthase and pyrimidine hydroxymethylase: Thymidylate synthase (TS) and deoxycytidylate hydroxymethylase (dCMP-HMase) are homologs that catalyze analogous alkylation of C5 of pyrimidine nucleotides. Both enzymes are involved in the...; Region: TS_Pyrimidine_HMase; cd00351
261594005949	dimerization interface [polypeptide binding]; other site
261594005950	active site
261594005951	Dihydrofolate reductase [Coenzyme metabolism]; Region: FolA; COG0262
261594005952	Dihydrofolate reductase (DHFR). Reduces 7,8-dihydrofolate to 5,6,7,8-tetrahydrofolate with NADPH as a cofactor. This is an essential step in the biosynthesis of deoxythymidine phosphate since 5,6,7,8-tetrahydrofolate is required to regenerate 5; Region: DHFR; cd00209
261594005953	folate binding site [chemical binding]; other site
261594005954	NADP+ binding site [chemical binding]; other site
261594005955	NTF2-like N-terminal transpeptidase domain; Region: MecA_N; pfam05223
261594005956	Penicillin-binding Protein dimerisation domain; Region: PBP_dimer; pfam03717
261594005957	penicillin-binding protein 2; Region: pbp2_mrdA; TIGR03423
261594005958	Penicillin binding protein transpeptidase domain; Region: Transpeptidase; pfam00905
261594005959	azoreductase; Reviewed; Region: PRK00170
261594005960	NADPH-dependent FMN reductase; Region: FMN_red; pfam03358
261594005961	1-acyl-sn-glycerol-3-phosphate acyltransferase [Lipid metabolism]; Region: PlsC; COG0204
261594005962	Lysophospholipid Acyltransferases (LPLATs) of Glycerophospholipid Biosynthesis: AGPAT-like; Region: LPLAT_AGPAT-like; cd07989
261594005963	putative acyl-acceptor binding pocket; other site
261594005964	Haemolysin-III related; Region: HlyIII; cl03831
261594005965	channel protein, hemolysin III family; Region: hlyIII; TIGR01065
261594005966	twin arginine translocase protein A; Provisional; Region: tatA; PRK14861
261594005967	Sec-independent protein secretion pathway component TatC [Intracellular trafficking and secretion]; Region: TatC; COG0805
261594005968	Protein of unknown function (DUF2535); Region: DUF2535; pfam10751
261594005969	EDD domain protein, DegV family; Region: DegV; TIGR00762
261594005970	Uncharacterized protein, DegV family COG1307; Region: DegV; pfam02645
261594005971	Predicted Zn-dependent hydrolases of the beta-lactamase fold [General function prediction only]; Region: COG2220
261594005972	Beta-lactamase superfamily domain; Region: Lactamase_B_2; pfam12706
261594005973	Uncharacterized protein SCO1/SenC/PrrC, involved in biogenesis of respiratory and photosynthetic systems [General function prediction only]; Region: COG1999
261594005974	SCO (an acronym for Synthesis of Cytochrome c Oxidase) family; composed of proteins similar to Sco1, a membrane-anchored protein possessing a soluble domain with a TRX fold. Members of this family are required for the proper assembly of cytochrome c...; Region: SCO; cd02968
261594005975	Cu(I) binding site [ion binding]; other site
261594005976	Molecular chaperone (small heat shock protein) [Posttranslational modification, protein turnover, chaperones]; Region: IbpA; COG0071
261594005977	Alpha-crystallin domain (ACD) of alpha-crystallin-type small(s) heat shock proteins (Hsps). sHsps are small stress induced proteins with monomeric masses between 12 -43 kDa, whose common feature is the Alpha-crystallin domain  (ACD). sHsps are generally...; Region: ACD_sHsps-like; cd06464
261594005978	putative dimer interface [polypeptide binding]; other site
261594005979	Asparagine synthase (glutamine-hydrolyzing) [Amino acid transport and metabolism]; Region: AsnB; COG0367
261594005980	Glutamine amidotransferases class-II (GATase) asparagine synthase_B type.  Asparagine synthetase B catalyses the ATP-dependent conversion of aspartate to asparagine. This enzyme is a homodimer, with each monomer composed of a  glutaminase domain and a...; Region: AsnB; cd00712
261594005981	active site
261594005982	dimer interface [polypeptide binding]; other site
261594005983	The C-terminal domain of Asparagine Synthase B. This domain is always found associated n-terminal amidotransferase domain. Family members that contain this domain catalyse the conversion of aspartate to asparagine. Asparagine synthetase B  catalyzes the...; Region: Asn_Synthase_B_C; cd01991
261594005984	Ligand Binding Site [chemical binding]; other site
261594005985	Molecular Tunnel; other site
261594005986	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cl17182
261594005987	ABC-type Fe3+-hydroxamate transport system, periplasmic component [Inorganic ion transport and metabolism]; Region: FepB; COG0614
261594005988	Fe3+-siderophore binding domain FhuD.  These proteins have been shown to function as initial receptors in ABC transport of Fe3+-siderophores in many eubacterial species. They belong to the TroA-like superfamily of helical backbone metal receptor proteins...; Region: FhuD; cd01146
261594005989	siderophore binding site; other site
261594005990	Branched-chain amino acid aminotransferase/4-amino-4-deoxychorismate lyase [Amino acid transport and metabolism / Coenzyme metabolism]; Region: IlvE; COG0115
261594005991	D-Alanine aminotransferase (D-AAT_like): D-amino acid aminotransferase catalyzes transamination between D-amino acids and their respective alpha-keto acids. It plays a major role in the synthesis of bacterial cell wall components like D-alanine and...; Region: D-AAT_like; cd01558
261594005992	homodimer interface [polypeptide binding]; other site
261594005993	substrate-cofactor binding pocket; other site
261594005994	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594005995	catalytic residue [active]
261594005996	Proteins of this family catalyze the reduction of flavin or nitrocompounds using NAD(P)H as electron donor in a obligatory two-electron transfer,  utilizing FMN or FAD as cofactor. They are often found to be homodimers. Enzymes of this family are...; Region: Nitro_FMN_reductase; cd02062
261594005997	FMN binding site [chemical binding]; other site
261594005998	dimer interface [polypeptide binding]; other site
261594005999	Molecular chaperone (small heat shock protein) [Posttranslational modification, protein turnover, chaperones]; Region: IbpA; COG0071
261594006000	Group of bacterial proteins containing an alpha crystallin domain (ACD) similar to Lactobacillus plantarum (Lp) small heat shock proteins (sHsp) HSP 18.5, HSP 18.55 and HSP 19.3. sHsps are molecular chaperones that suppress protein aggregation and...; Region: ACD_LpsHSP_like; cd06471
261594006001	putative dimer interface [polypeptide binding]; other site
261594006002	Small-conductance mechanosensitive channel [Cell envelope biogenesis, outer membrane]; Region: MscS; COG0668
261594006003	Mechanosensitive ion channel; Region: MS_channel; pfam00924
261594006004	FOG: GAF domain [Signal transduction mechanisms]; Region: FhlA; COG2203
261594006005	GAF domain; Region: GAF; pfam01590
261594006006	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: COG4585
261594006007	Histidine kinase; Region: HisKA_3; pfam07730
261594006008	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594006009	ATP binding site [chemical binding]; other site
261594006010	Mg2+ binding site [ion binding]; other site
261594006011	G-X-G motif; other site
261594006012	Response regulator containing a CheY-like receiver domain and an HTH DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: CitB; COG2197
261594006013	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594006014	active site
261594006015	phosphorylation site [posttranslational modification]
261594006016	intermolecular recognition site; other site
261594006017	dimerization interface [polypeptide binding]; other site
261594006018	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
261594006019	DNA binding residues [nucleotide binding]
261594006020	dimerization interface [polypeptide binding]; other site
261594006021	ethanol-active dehydrogenase/acetaldehyde-active reductase; Provisional; Region: PRK09422
261594006022	Cinnamyl alcohol dehydrogenases (CAD); Region: CAD3; cd08297
261594006023	NAD binding site [chemical binding]; other site
261594006024	substrate binding site [chemical binding]; other site
261594006025	catalytic Zn binding site [ion binding]; other site
261594006026	tetramer interface [polypeptide binding]; other site
261594006027	structural Zn binding site [ion binding]; other site
261594006028	ABC-type dipeptide/oligopeptide/nickel transport systems, permease components [Amino acid transport and metabolism / Inorganic ion transport and metabolism]; Region: DppC; COG1173
261594006029	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
261594006030	dimer interface [polypeptide binding]; other site
261594006031	conserved gate region; other site
261594006032	ABC-ATPase subunit interface; other site
261594006033	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cl00427
261594006034	ABC-type dipeptide/oligopeptide/nickel transport systems, permease components [Amino acid transport and metabolism / Inorganic ion transport and metabolism]; Region: DppB; COG0601
261594006035	Glycosyltransferases involved in cell wall biogenesis [Cell envelope biogenesis, outer membrane]; Region: WcaA; COG0463
261594006036	Glycosyltransferase family A (GT-A) includes diverse families of glycosyl transferases with a common GT-A type structural fold; Region: Glyco_tranf_GTA_type; cl11394
261594006037	active site
261594006038	Predicted flavoprotein [General function prediction only]; Region: COG0431
261594006039	NADPH-dependent FMN reductase; Region: FMN_red; pfam03358
261594006040	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594006041	H+ Antiporter protein; Region: 2A0121; TIGR00900
261594006042	putative substrate translocation pore; other site
261594006043	YdcF-like. YdcF-like is a large family of mainly bacterial proteins, with a few members found in fungi, plants, and archaea. Escherichia coli YdcF has been shown to bind S-adenosyl-L-methionine (AdoMet), but a biochemical function has not been...; Region: YdcF-like; cd06259
261594006044	Uncharacterized conserved protein [Function unknown]; Region: COG1434
261594006045	putative active site [active]
261594006046	ABC-type proline/glycine betaine transport systems, ATPase components [Amino acid transport and metabolism]; Region: OpuBA; COG1125
261594006047	ATP-binding cassette domain of the osmoprotectant transporter; Region: ABC_OpuCA_Osmoprotection; cd03295
261594006048	Walker A/P-loop; other site
261594006049	ATP binding site [chemical binding]; other site
261594006050	Q-loop/lid; other site
261594006051	ABC transporter signature motif; other site
261594006052	Walker B; other site
261594006053	D-loop; other site
261594006054	H-loop/switch region; other site
261594006055	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
261594006056	dimer interface [polypeptide binding]; other site
261594006057	conserved gate region; other site
261594006058	ABC-ATPase subunit interface; other site
261594006059	Substrate binding domain of ABC-type glycine betaine transport system; Region: OpuAC; pfam04069
261594006060	ABC-type proline/glycine betaine transport systems, periplasmic components [Amino acid transport and metabolism]; Region: ProX; cl17891
261594006061	arginine-ornithine antiporter; Region: arg_ornith_anti; TIGR03810
261594006062	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cl17189
261594006063	Protein of unknown function (DUF524); Region: DUF524; pfam04411
261594006064	polar chromosome segregation protein; Reviewed; Region: racA; PRK13182
261594006065	Helix-turn-helix domain; Region: HTH_17; cl17695
261594006066	Hemolysins and related proteins containing CBS domains [General function prediction only]; Region: TlyC; COG1253
261594006067	Domain of unknown function DUF21; Region: DUF21; pfam01595
261594006068	This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domains associated with the CorC_HlyC domain. CorC_HlyC is a transporter associated domain. This small domain is found in Na+/H+ antiporters, in proteins involved in...; Region: CBS_pair_CorC_HlyC_assoc; cd04590
261594006069	Transporter associated domain; Region: CorC_HlyC; smart01091
261594006070	Uncharacterized ALDH (y4uC) with similarity to Tortula ruralis aldehyde dehydrogenase ALDH21A1; Region: ALDH_y4uC; cd07149
261594006071	Aldehyde dehydrogenase family; Region: Aldedh; pfam00171
261594006072	NAD(P) binding site [chemical binding]; other site
261594006073	catalytic residues [active]
261594006074	Protein of unknown function (DUF1694); Region: DUF1694; pfam07997
261594006075	Histidine kinase N terminal; Region: HisK_N; pfam09385
261594006076	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
261594006077	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
261594006078	dimer interface [polypeptide binding]; other site
261594006079	phosphorylation site [posttranslational modification]
261594006080	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594006081	ATP binding site [chemical binding]; other site
261594006082	Mg2+ binding site [ion binding]; other site
261594006083	G-X-G motif; other site
261594006084	Domain of unknown function (DUF4397); Region: DUF4397; pfam14344
261594006085	Domain of unknown function (DUF4397); Region: DUF4397; pfam14344
261594006086	hypothetical protein; Provisional; Region: PRK06917
261594006087	Acetyl ornithine aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to ornithine aminotransferase, acetylornithine aminotransferase; Region: OAT_like; cd00610
261594006088	inhibitor-cofactor binding pocket; inhibition site
261594006089	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594006090	catalytic residue [active]
261594006091	Acyl CoA:acetate/3-ketoacid CoA transferase, alpha subunit [Lipid metabolism]; Region: AtoD; COG1788
261594006092	3-oxoacid CoA-transferase, B subunit; Region: pcaJ_scoB_fam; TIGR02428
261594006093	acetylornithine deacetylase; Validated; Region: PRK06915
261594006094	M20 Peptidases with similarity to acetylornithine deacetylases and succinyl-diaminopimelate desuccinylases; Region: M20_ArgE_DapE_like2; cd03895
261594006095	metal binding site [ion binding]; metal-binding site
261594006096	dimer interface [polypeptide binding]; other site
261594006097	putative beta-lysine N-acetyltransferase; Region: GNAT_ablB; TIGR03827
261594006098	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cl17182
261594006099	PAS fold; Region: PAS_4; pfam08448
261594006100	psp operon transcriptional activator PspF; Region: phageshock_pspF; TIGR02974
261594006101	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
261594006102	Walker A motif; other site
261594006103	ATP binding site [chemical binding]; other site
261594006104	Walker B motif; other site
261594006105	arginine finger; other site
261594006106	Bacterial regulatory protein, Fis family; Region: HTH_8; pfam02954
261594006107	lysine-2,3-aminomutase; Region: lys_2_3_AblA; TIGR03820
261594006108	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
261594006109	FeS/SAM binding site; other site
261594006110	Lysine-2,3-aminomutase; Region: LAM_C; pfam12544
261594006111	antitoxin MqsA for MqsR toxin; Region: MqsA; cd12870
261594006112	toxin interface [polypeptide binding]; other site
261594006113	Zn binding site [ion binding]; other site
261594006114	hypothetical protein; Provisional; Region: PRK13672
261594006115	Protein of unknown function (DUF3930); Region: DUF3930; pfam13067
261594006116	Protein of unknown function (DUF3930); Region: DUF3930; pfam13067
261594006117	YozD-like protein; Region: YozD; pfam14162
261594006118	Serine/Threonine protein kinases, catalytic domain; Region: S_TKc; smart00220
261594006119	Catalytic domain of Protein Kinases; Region: PKc; cd00180
261594006120	active site
261594006121	ATP binding site [chemical binding]; other site
261594006122	substrate binding site [chemical binding]; other site
261594006123	activation loop (A-loop); other site
261594006124	Sporulation control protein [General function prediction only]; Region: Spo0M; COG4326
261594006125	SpoOM protein; Region: Spo0M; pfam07070
261594006126	Membrane-associated phospholipid phosphatase [Lipid metabolism]; Region: PgpB; COG0671
261594006127	PAP2_like_2 proteins. PAP2 is a super-family of phosphatases and haloperoxidases. This subgroup, which is specific to bacteria, lacks functional characterization and may act as a membrane-associated lipid phosphatase; Region: PAP2_like_2; cd03392
261594006128	active site
261594006129	Predicted Co/Zn/Cd cation transporters [Inorganic ion transport and metabolism]; Region: MMT1; COG0053
261594006130	cation diffusion facilitator family transporter; Region: CDF; TIGR01297
261594006131	TRX family; composed of two groups: Group I, which includes proteins that exclusively encode a TRX domain; and Group II, which are composed of fusion proteins of TRX and additional domains. Group I TRX is a small ancient protein that alter the redox...; Region: TRX_family; cd02947
261594006132	catalytic residues [active]
261594006133	DNA breaking-rejoining enzymes, C-terminal catalytic domain. The DNA breaking-rejoining enzyme superfamily includes type IB topoisomerases and tyrosine recombinases that share the same fold in their catalytic domain containing six conserved active site...; Region: DNA_BRE_C; cl00213
261594006134	Integrase [DNA replication, recombination, and repair]; Region: XerC; COG0582
261594006135	DNA binding site [nucleotide binding]
261594006136	active site
261594006137	Int/Topo IB signature motif; other site
261594006138	SMI1 / KNR4 family (SUKH-1); Region: SMI1_KNR4; pfam09346
261594006139	WXG100 family type VII secretion target; Region: WXG100_ESAT6; TIGR03930
261594006140	S-layer homology domain; Region: SLH; pfam00395
261594006141	S-layer homology domain; Region: SLH; pfam00395
261594006142	S-layer homology domain; Region: SLH; pfam00395
261594006143	Catalytic domain of phospholipase D superfamily proteins; Region: PLDc_SF; cd00138
261594006144	Catalytic domain of phospholipase D superfamily proteins; Region: PLDc_SF; cl15239
261594006145	putative active site [active]
261594006146	putative active site [active]
261594006147	catalytic site [active]
261594006148	catalytic site [active]
261594006149	Restriction endonuclease; Region: Mrr_cat; pfam04471
261594006150	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
261594006151	non-specific DNA binding site [nucleotide binding]; other site
261594006152	salt bridge; other site
261594006153	sequence-specific DNA binding site [nucleotide binding]; other site
261594006154	FtsK/SpoIIIE family; Region: FtsK_SpoIIIE; pfam01580
261594006155	Replication-relaxation; Region: Replic_Relax; pfam13814
261594006156	YjgF, YER057c, and UK114 belong to a large family of proteins present in bacteria, archaea, and eukaryotes with no definitive function. The conserved domain is similar in structure to chorismate mutase but there is no sequence similarity and no...; Region: YjgF_YER057c_UK114_family; cd00448
261594006157	homotrimer interaction site [polypeptide binding]; other site
261594006158	putative active site [active]
261594006159	Protein of unknown function (DUF3956); Region: DUF3956; pfam13104
261594006160	CHRD domain; Region: CHRD; pfam07452
261594006161	C1q domain; Region: C1q; cl17543
261594006162	peptidylprolyl isomerase; Reviewed; Region: prsA; PRK02998
261594006163	PPIC-type PPIASE domain; Region: Rotamase; pfam00639
261594006164	YolD-like protein; Region: YolD; pfam08863
261594006165	Spore germination protein gerPA/gerPF; Region: gerPA; pfam10676
261594006166	Proteolipid membrane potential modulator; Region: Pmp3; pfam01679
261594006167	KTSC domain; Region: KTSC; pfam13619
261594006168	Transglycosylase; Region: Transgly; pfam00912
261594006169	penicillin-binding protein, 1A family; Region: PBP_1a_fam; TIGR02074
261594006170	Penicillin binding protein transpeptidase domain; Region: Transpeptidase; pfam00905
261594006171	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594006172	Major Facilitator Superfamily; Region: MFS_1; pfam07690
261594006173	putative substrate translocation pore; other site
261594006174	Iron-sulphur cluster biosynthesis; Region: Fe-S_biosyn; cl00400
261594006175	Citrate synthase (CS) catalyzes the condensation of acetyl coenzyme A (AcCoA) and oxalacetate (OAA) to form citrate and coenzyme A (CoA), the first step in the oxidative citric acid cycle (TCA or Krebs cycle). Peroxisomal CS is involved in the glyoxylate...; Region: citrate_synt_like_1; cd06118
261594006176	dimer interface [polypeptide binding]; other site
261594006177	Citrate synthase; Region: Citrate_synt; pfam00285
261594006178	active site
261594006179	coenzyme A binding site [chemical binding]; other site
261594006180	citrylCoA binding site [chemical binding]; other site
261594006181	oxalacetate/citrate binding site [chemical binding]; other site
261594006182	catalytic triad [active]
261594006183	2-methylcitrate dehydratase; Provisional; Region: prpD; PRK09425
261594006184	2-methylcitrate dehydratase; Region: prpD; TIGR02330
261594006185	Members of the ICL/PEPM enzyme family catalyze either P-C or C-C bond formation/cleavage. Known members are phosphoenolpyruvate mutase (PEPM), phosphonopyruvate hydrolase (PPH), carboxyPEP mutase (CPEP mutase), oxaloacetate hydrolase (OAH), isocitrate...; Region: ICL_PEPM; cd00377
261594006186	Phosphoenolpyruvate phosphomutase; Region: PEP_mutase; pfam13714
261594006187	tetramer interface [polypeptide binding]; other site
261594006188	active site
261594006189	Mg2+/Mn2+ binding site [ion binding]; other site
261594006190	Acyl-CoA dehydrogenase; Region: ACAD; cl09933
261594006191	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
261594006192	active site
261594006193	3-hydroxyisobutyrate dehydrogenase and related beta-hydroxyacid dehydrogenases [Lipid metabolism]; Region: MmsB; COG2084
261594006194	6-phosphogluconate dehydrogenase-like protein; Reviewed; Region: PRK09599
261594006195	Methylmalonate semialdehyde dehydrogenase and ALDH family members 6A1 and 6B2; Region: ALDH_F6_MMSDH; cd07085
261594006196	methylmalonic acid semialdehyde dehydrogenase; Region: MMSDH; TIGR01722
261594006197	tetrameric interface [polypeptide binding]; other site
261594006198	NAD binding site [chemical binding]; other site
261594006199	catalytic residues [active]
261594006200	Putative threonine efflux protein [Amino acid transport and metabolism]; Region: RhtB; COG1280
261594006201	3-hydroxyisobutyryl-CoA hydrolase; Provisional; Region: PRK05617
261594006202	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
261594006203	substrate binding site [chemical binding]; other site
261594006204	oxyanion hole (OAH) forming residues; other site
261594006205	trimer interface [polypeptide binding]; other site
261594006206	2-enoyl-CoA Hydratase C-terminal region; Region: ECH_C; pfam13766
261594006207	Protein of unknown function (DUF2584); Region: DUF2584; pfam10763
261594006208	DNA repair exonuclease [DNA replication, recombination, and repair]; Region: SbcD; COG0420
261594006209	Mre11 nuclease, N-terminal metallophosphatase domain; Region: MPP_Mre11_N; cd00840
261594006210	active site
261594006211	metal binding site [ion binding]; metal-binding site
261594006212	DNA binding site [nucleotide binding]
261594006213	Type 5 capsule protein repressor C-terminal domain; Region: SbcD_C; pfam12320
261594006214	ATPase involved in DNA repair [DNA replication, recombination, and repair]; Region: SbcC; COG0419
261594006215	ATP-binding cassette domain of sbcCD; Region: ABC_sbcCD; cd03279
261594006216	Walker A/P-loop; other site
261594006217	ATP binding site [chemical binding]; other site
261594006218	Q-loop/lid; other site
261594006219	ATP-binding cassette domain of sbcCD; Region: ABC_sbcCD; cd03279
261594006220	ABC transporter signature motif; other site
261594006221	Walker B; other site
261594006222	D-loop; other site
261594006223	H-loop/switch region; other site
261594006224	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
261594006225	dimerization interface [polypeptide binding]; other site
261594006226	putative DNA binding site [nucleotide binding]; other site
261594006227	putative Zn2+ binding site [ion binding]; other site
261594006228	oxalate/formate antiporter family transporter; Region: 2A0111; TIGR00890
261594006229	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594006230	putative substrate translocation pore; other site
261594006231	2,3-dihydroxybenzoate-2,3-dehydrogenase; Validated; Region: PRK08220
261594006232	2,3 dihydro-2,3 dihydrozybenzoate dehydrogenases, classical (c) SDRs; Region: DH-DHB-DH_SDR_c; cd05331
261594006233	putative NAD(P) binding site [chemical binding]; other site
261594006234	active site
261594006235	isochorismate synthase DhbC; Validated; Region: PRK06923
261594006236	chorismate binding enzyme; Region: Chorismate_bind; pfam00425
261594006237	Peptide arylation enzymes [Secondary metabolites biosynthesis, transport, and catabolism]; Region: EntE; COG1021
261594006238	2,3-dihydroxybenzoate-AMP ligase; Region: 23DHB-AMP_lg; cd05920
261594006239	acyl-activating enzyme (AAE) consensus motif; other site
261594006240	active site
261594006241	AMP binding site [chemical binding]; other site
261594006242	substrate binding site [chemical binding]; other site
261594006243	Isochorismatase, also known as 2,3 dihydro-2,3 dihydroxybenzoate synthase, catalyses the conversion of isochorismate, in the presence of water, to 2,3-dihydroxybenzoate and pyruvate, via the hydrolysis of a vinyl ether, an uncommon reaction in biological...; Region: isochorismatase; cd01013
261594006244	hydrophobic substrate binding pocket; other site
261594006245	Isochorismatase family; Region: Isochorismatase; pfam00857
261594006246	active site
261594006247	conserved cis-peptide bond; other site
261594006248	Aryl carrier domain [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3433
261594006249	Condensation domain; Region: Condensation; pfam00668
261594006250	The adenylation domain of nonribosomal peptide synthetases (NRPS), including salinosporamide A polyketide synthase; Region: A_NRPS_Ta1_like; cd12116
261594006251	amino acid adenylation domain; Region: AA-adenyl-dom; TIGR01733
261594006252	acyl-activating enzyme (AAE) consensus motif; other site
261594006253	AMP binding site [chemical binding]; other site
261594006254	Phosphopantetheine attachment site; Region: PP-binding; pfam00550
261594006255	enterobactin synthase subunit F; Provisional; Region: entF; PRK10252
261594006256	HxxPF-repeated domain; Region: HxxPF_rpt; pfam13745
261594006257	The adenylation domain of nonribosomal peptide synthetases (NRPS); Region: A_NRPS; cd05930
261594006258	acyl-activating enzyme (AAE) consensus motif; other site
261594006259	AMP binding site [chemical binding]; other site
261594006260	Phosphopantetheine attachment site; Region: PP-binding; pfam00550
261594006261	MbtH-like protein; Region: MbtH; cl01279
261594006262	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594006263	Major Facilitator Superfamily; Region: MFS_1; pfam07690
261594006264	putative substrate translocation pore; other site
261594006265	Phosphopantetheinyl transferase [Coenzyme metabolism]; Region: Sfp; COG2091
261594006266	4'-phosphopantetheinyl transferase superfamily; Region: ACPS; pfam01648
261594006267	Chorismate lyase; Region: Chor_lyase; cl01230
261594006268	Integration host factor (IHF) and HU are small heterodimeric members of the DNABII protein family that bind and bend DNA, functioning as architectural factors in many cellular processes including transcription, site-specific recombination, and...; Region: HU_IHF; cd00591
261594006269	IHF dimer interface [polypeptide binding]; other site
261594006270	IHF - DNA interface [nucleotide binding]; other site
261594006271	Protein of unknown function (DUF3891); Region: DUF3891; pfam13030
261594006272	DinB family; Region: DinB; cl17821
261594006273	DinB superfamily; Region: DinB_2; pfam12867
261594006274	Peptidase inhibitor I9; Region: Inhibitor_I9; pfam05922
261594006275	Peptidase S8 family domain in Thermitase-like proteins; Region: Peptidases_S8_Thermitase_like; cd07484
261594006276	active site
261594006277	catalytic triad [active]
261594006278	Na+/alanine symporter [Amino acid transport and metabolism]; Region: AlsT; COG1115
261594006279	Sodium:alanine symporter family; Region: Na_Ala_symp; cl00548
261594006280	Antibiotic biosynthesis monooxygenase; Region: ABM; cl10022
261594006281	16S rRNA uridine-516 pseudouridylate synthase and related pseudouridylate synthases [Translation, ribosomal structure and biogenesis]; Region: RsuA; COG1187
261594006282	S4/Hsp/ tRNA synthetase RNA-binding domain; The domain surface is populated by conserved, charged residues that define a likely RNA-binding site;  Found in stress proteins, ribosomal proteins and tRNA synthetases; This may imply a hitherto unrecognized...; Region: S4; cd00165
261594006283	RNA binding surface [nucleotide binding]; other site
261594006284	Pseudouridine synthase, Escherichia coli RluF like; Region: PseudoU_synth_RluF; cd02554
261594006285	probable active site [active]
261594006286	threonyl-tRNA synthetase; Reviewed; Region: PRK12444
261594006287	TGS _ThrRS_N:  ThrRS (threonyl-tRNA Synthetase)  is a class II tRNA synthetase that couples threonine to its cognate tRNA.  In addition to its catalytic and anticodon-binding domains, ThrRS has an N-terminal TGS domain, named after the ThrRS, GTPase, and...; Region: TGS_ThrRS_N; cd01667
261594006288	Threonyl and Alanyl tRNA synthetase second additional domain; Region: tRNA_SAD; smart00863
261594006289	Threonyl-tRNA synthetase (ThrRS) class II core catalytic domain. ThrRS is a homodimer. It is responsible for the attachment of threonine to the 3' OH group of ribose of the appropriate tRNA. This domain is primarily responsible for ATP-dependent...; Region: ThrRS_core; cd00771
261594006290	active site
261594006291	dimer interface [polypeptide binding]; other site
261594006292	motif 1; other site
261594006293	motif 2; other site
261594006294	motif 3; other site
261594006295	ThrRS Threonyl-anticodon binding domain. ThrRS belongs to class II aminoacyl-tRNA synthetases (aaRS). This alignment contains the anticodon binding domain, which is responsible for specificity in tRNA-binding, so that the activated amino acid is...; Region: ThrRS_anticodon; cd00860
261594006296	anticodon binding site; other site
261594006297	FtsX-like permease family; Region: FtsX; pfam02687
261594006298	Protein of unknown function (DUF867); Region: DUF867; cl01713
261594006299	Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596
261594006300	Putative lysophospholipase; Region: Hydrolase_4; pfam12146
261594006301	Novel bacterial esterase that cleaves esters on halogenated cyclic compounds; Region: Esterase_713_like; cl17303
261594006302	H+ Antiporter protein; Region: 2A0121; TIGR00900
261594006303	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594006304	Predicted divalent heavy-metal cations transporter [Inorganic ion transport and metabolism]; Region: COG0428; cl00437
261594006305	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594006306	S-adenosylmethionine binding site [chemical binding]; other site
261594006307	Protein of unknown function (DUF2185); Region: DUF2185; pfam09951
261594006308	Metallo-beta-lactamase superfamily; Region: Lactamase_B; smart00849
261594006309	nuc_hydro_ TvIAG:  Nucleoside hydrolases similar to the Inosine-adenosine-guanosine-preferring nucleoside hydrolase from Trypanosoma vivax.   Nucleoside hydrolases cleave the N-glycosidic bond in nucleosides generating ribose and the respective base; Region: nuc_hydro_TvIAG; cd02647
261594006310	active site
261594006311	dimerization interface [polypeptide binding]; other site
261594006312	Protein of unknown function (DUF2441); Region: DUF2441; pfam10386
261594006313	Acetyltransferase (GNAT) domain; Region: Acetyltransf_7; pfam13508
261594006314	Metallo-beta-lactamase superfamily; Region: Lactamase_B; smart00849
261594006315	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
261594006316	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
261594006317	MMPL family; Region: MMPL; pfam03176
261594006318	MMPL family; Region: MMPL; pfam03176
261594006319	Protein of unknown function (DUF4021); Region: DUF4021; pfam13213
261594006320	Chloramphenicol acetyltransferase; Region: CAT; pfam00302
261594006321	Chloramphenicol O-acetyltransferase [Defense mechanisms]; Region: COG4845
261594006322	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594006323	Acetyltransferases [General function prediction only]; Region: RimI; COG0456
261594006324	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cl17182
261594006325	Coenzyme A binding pocket [chemical binding]; other site
261594006326	Acetyltransferase (GNAT) domain; Region: Acetyltransf_10; pfam13673
261594006327	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594006328	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cl17182
261594006329	Coenzyme A binding pocket [chemical binding]; other site
261594006330	Pentapeptide repeats (9 copies); Region: Pentapeptide_4; pfam13599
261594006331	Pentapeptide repeats (8 copies); Region: Pentapeptide; pfam00805
261594006332	Pentapeptide repeats (9 copies); Region: Pentapeptide_4; pfam13599
261594006333	putative acetyltransferase YhhY; Provisional; Region: PRK10140
261594006334	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594006335	Coenzyme A binding pocket [chemical binding]; other site
261594006336	Permeases of the drug/metabolite transporter (DMT) superfamily [Carbohydrate transport and metabolism / Amino acid transport and metabolism / General function prediction only]; Region: RhaT; COG0697
261594006337	EamA-like transporter family; Region: EamA; pfam00892
261594006338	EamA-like transporter family; Region: EamA; pfam00892
261594006339	DNA-binding transcriptional repressor PuuR; Provisional; Region: PRK09943
261594006340	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
261594006341	non-specific DNA binding site [nucleotide binding]; other site
261594006342	salt bridge; other site
261594006343	sequence-specific DNA binding site [nucleotide binding]; other site
261594006344	Cupin domain; Region: Cupin_2; pfam07883
261594006345	Spo0E like sporulation regulatory protein; Region: SpoOE-like; pfam09388
261594006346	Alpha/beta hydrolase family; Region: Abhydrolase_6; pfam12697
261594006347	Putative lysophospholipase; Region: Hydrolase_4; pfam12146
261594006348	protoporphyrinogen oxidase; Provisional; Region: PRK12416
261594006349	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; pfam13450
261594006350	Acetyltransferases, including N-acetylases of ribosomal proteins [Translation, ribosomal structure and biogenesis]; Region: RimL; COG1670
261594006351	Acetyltransferase (GNAT) family; Region: Acetyltransf_1; pfam00583
261594006352	Cold-inducible protein YdjO; Region: YdjO; pfam14169
261594006353	Cold-Shock Protein (CSP) contains an S1-like cold-shock domain (CSD) that is found in eukaryotes, prokaryotes, and archaea.  CSP's include the major cold-shock proteins CspA and CspB in bacteria and the eukaryotic gene regulatory factor Y-box...; Region: CSP_CDS; cd04458
261594006354	DNA-binding site [nucleotide binding]; DNA binding site
261594006355	RNA-binding motif; other site
261594006356	AAA domain; Region: AAA_17; pfam13207
261594006357	AAA domain; Region: AAA_18; pfam13238
261594006358	Arginase-like and histone-like hydrolases; Region: Arginase_HDAC; cl17011
261594006359	active site
261594006360	metal binding site [ion binding]; metal-binding site
261594006361	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
261594006362	haloacid dehalogenase-like hydrolase; Region: Hydrolase_3; pfam08282
261594006363	active site
261594006364	motif I; other site
261594006365	motif II; other site
261594006366	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
261594006367	motif II; other site
261594006368	hypothetical protein; Provisional; Region: PRK06770
261594006369	Domain of unknown function (DUF4183); Region: DUF4183; pfam13799
261594006370	Protein of unknown function (DUF3956); Region: DUF3956; pfam13104
261594006371	Transcriptional regulator [Transcription]; Region: LysR; COG0583
261594006372	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
261594006373	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cd05466
261594006374	dimerization interface [polypeptide binding]; other site
261594006375	aspartate-semialdehyde dehydrogenase; Provisional; Region: PRK06728
261594006376	Semialdehyde dehydrogenase, NAD binding domain; Region: Semialdhyde_dh; smart00859
261594006377	Glyceraldehyde 3-phosphate dehydrogenase, C-terminal domain; Region: Gp_dh_C; pfam02800
261594006378	Choloylglycine hydrolase (CGH)_like. This family of choloylglycine hydrolase-like proteins includes conjugated bile acid hydrolase (CBAH), penicillin V acylase (PVA), acid ceramidase (AC), and N-acylethanolamine-hydrolyzing acid amidase (NAAA) which...; Region: Ntn_CGH_like; cd01935
261594006379	active site
261594006380	Acyl-coenzyme A:6-aminopenicillanic acid acyl-transferase; Region: AAT; pfam03417
261594006381	DNA-binding transcriptional regulator CynR; Provisional; Region: PRK11242
261594006382	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
261594006383	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cd05466
261594006384	dimerization interface [polypeptide binding]; other site
261594006385	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2258
261594006386	MOSC domain; Region: MOSC; pfam03473
261594006387	3-alpha domain; Region: 3-alpha; pfam03475
261594006388	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594006389	Coenzyme A binding pocket [chemical binding]; other site
261594006390	Protein of unknown function (DUF1349); Region: DUF1349; pfam07081
261594006391	ABC-type multidrug transport system, ATPase and permease components [Defense mechanisms]; Region: MdlB; COG1132
261594006392	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
261594006393	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
261594006394	Walker A/P-loop; other site
261594006395	ATP binding site [chemical binding]; other site
261594006396	Q-loop/lid; other site
261594006397	ABC transporter signature motif; other site
261594006398	Walker B; other site
261594006399	D-loop; other site
261594006400	H-loop/switch region; other site
261594006401	ABC-type multidrug transport system, ATPase and permease components [Defense mechanisms]; Region: MdlB; COG1132
261594006402	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
261594006403	ATP-binding cassette domain of glucan transporter and related proteins, subfamily C; Region: ABCC_Glucan_exporter_like; cd03254
261594006404	Walker A/P-loop; other site
261594006405	ATP binding site [chemical binding]; other site
261594006406	Q-loop/lid; other site
261594006407	ABC transporter signature motif; other site
261594006408	Walker B; other site
261594006409	D-loop; other site
261594006410	H-loop/switch region; other site
261594006411	N-acetylmuramoyl-L-alanine amidase or MurNAc-LAA (also known as peptidoglycan aminohydrolase, NAMLA amidase, NAMLAA, Amidase 3, and peptidoglycan amidase; EC 3.5.1.28) is an autolysin that hydrolyzes the amide bond between N-acetylmuramoyl and L-amino...; Region: MurNAc-LAA; cd02696
261594006412	N-acetylmuramoyl-L-alanine amidase [Cell envelope biogenesis, outer membrane]; Region: AmiC; COG0860
261594006413	active site
261594006414	metal binding site [ion binding]; metal-binding site
261594006415	N-acetylmuramoyl-l-alanine amidase; Region: Amidase02_C; pfam12123
261594006416	LysE type translocator; Region: LysE; cl00565
261594006417	DNA-binding transcriptional repressor PuuR; Provisional; Region: PRK09943
261594006418	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
261594006419	non-specific DNA binding site [nucleotide binding]; other site
261594006420	salt bridge; other site
261594006421	sequence-specific DNA binding site [nucleotide binding]; other site
261594006422	Cupin domain; Region: Cupin_2; pfam07883
261594006423	BclB C-terminal domain; Region: exospore_TM; TIGR03721
261594006424	Phytoene dehydrogenase and related proteins [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG1233
261594006425	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; pfam13450
261594006426	RNA polymerase sigma factor SigJ; Provisional; Region: PRK09636
261594006427	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
261594006428	Sigma-70, region 4; Region: Sigma70_r4_2; pfam08281
261594006429	Methyltransferase domain; Region: Methyltransf_31; pfam13847
261594006430	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594006431	S-adenosylmethionine binding site [chemical binding]; other site
261594006432	Toxic anion resistance protein (TelA); Region: TelA; pfam05816
261594006433	Domain of unknown function (DUF3974); Region: DUF3974; pfam13120
261594006434	PTS_IIB_chitobiose_lichenan: subunit IIB of enzyme II (EII) of the N,N-diacetylchitobiose-specific and lichenan-specific phosphoenolpyruvate:carbohydrate phosphotransferase system (PTS). In these systems, EII is either a lichenan- or an N; Region: PTS_IIB_chitobiose_lichenan; cd05564
261594006435	active site
261594006436	P-loop; other site
261594006437	phosphorylation site [posttranslational modification]
261594006438	Phosphotransferase system cellobiose-specific component IIC [Carbohydrate transport and metabolism]; Region: CelB; COG1455
261594006439	cellobiose phosphotransferase system IIC component; Reviewed; Region: celD; PRK09592
261594006440	anhydro-N-acetylmuramic acid kinase; Reviewed; Region: anmK; PRK09585
261594006441	Transcriptional regulator/sugar kinase [Transcription / Carbohydrate transport and metabolism]; Region: NagC; COG1940
261594006442	Predicted N-acetylglucosamine kinase [Carbohydrate transport and metabolism]; Region: COG2971
261594006443	putative glycerol-3-phosphate acyltransferase PlsY; Provisional; Region: PRK00220
261594006444	Acetyltransferase (GNAT) domain; Region: Acetyltransf_5; pfam13444
261594006445	Serine-pyruvate aminotransferase/archaeal aspartate aminotransferase [Amino acid transport and metabolism]; Region: COG0075
261594006446	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
261594006447	catalytic residue [active]
261594006448	Threonine dehydratase [Amino acid transport and metabolism]; Region: IlvA; COG1171
261594006449	Threonine dehydratase: The first step in amino acid degradation is the removal of nitrogen. Although the nitrogen atoms of most amino acids are transferred to alpha-ketoglutarate before removal, the alpha-amino group of threonine can be directly...; Region: Thr-dehyd; cd01562
261594006450	tetramer interface [polypeptide binding]; other site
261594006451	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594006452	catalytic residue [active]
261594006453	Zn-dependent hydrolases, including glyoxylases [General function prediction only]; Region: GloB; COG0491
261594006454	ATP-dependent RNA helicase SrmB; Provisional; Region: PRK11192
261594006455	DEAD-box helicases. A diverse family of proteins involved in ATP-dependent RNA unwinding, needed in a variety of cellular processes including splicing, ribosome biogenesis and RNA degradation. The name derives from the sequence of the Walker  B motif; Region: DEADc; cd00268
261594006456	ATP binding site [chemical binding]; other site
261594006457	Mg++ binding site [ion binding]; other site
261594006458	motif III; other site
261594006459	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
261594006460	nucleotide binding region [chemical binding]; other site
261594006461	ATP-binding site [chemical binding]; other site
261594006462	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
261594006463	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
261594006464	H+ Antiporter protein; Region: 2A0121; TIGR00900
261594006465	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cl17904
261594006466	FtsX-like permease family; Region: FtsX; pfam02687
261594006467	ABC-type antimicrobial peptide transport system, ATPase component [Defense mechanisms]; Region: SalX; COG1136
261594006468	ATP-binding cassette domain of the transporters involved in export of lipoprotein and macrolide, and cell division protein; Region: ABC_MJ0796_LolCDE_FtsE; cd03255
261594006469	Walker A/P-loop; other site
261594006470	ATP binding site [chemical binding]; other site
261594006471	Q-loop/lid; other site
261594006472	ABC transporter signature motif; other site
261594006473	Walker B; other site
261594006474	D-loop; other site
261594006475	H-loop/switch region; other site
261594006476	Methyltransferase domain; Region: Methyltransf_23; pfam13489
261594006477	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594006478	S-adenosylmethionine binding site [chemical binding]; other site
261594006479	Escherichia coli PhnB and similar proteins; the E. coli phnB gene is found next to an operon involved in the cleavage of carbon-phosphorus bonds in unactivated alkylphosphonates; Region: PhnB_like; cd06588
261594006480	dimer interface [polypeptide binding]; other site
261594006481	Methyltransferase domain; Region: Methyltransf_31; pfam13847
261594006482	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594006483	S-adenosylmethionine binding site [chemical binding]; other site
261594006484	Pyruvate decarboxylase and related thiamine pyrophosphate-requiring enzymes [Carbohydrate transport and metabolism / Coenzyme metabolism / General function prediction only]; Region: COG3961
261594006485	Pyrimidine (PYR) binding domain of pyruvate decarboxylase (PDC), indolepyruvate decarboxylase (IPDC) and related proteins; Region: TPP_PYR_PDC_IPDC_like; cd07038
261594006486	dimer interface [polypeptide binding]; other site
261594006487	PYR/PP interface [polypeptide binding]; other site
261594006488	TPP binding site [chemical binding]; other site
261594006489	Thiamine pyrophosphate enzyme, central domain; Region: TPP_enzyme_M; pfam00205
261594006490	Thiamine pyrophosphate (TPP) family, PDC_IPDC subfamily, TPP-binding module; composed of proteins similar to pyruvate decarboxylase (PDC) and indolepyruvate decarboxylase (IPDC). PDC, a key enzyme in alcoholic fermentation, catalyzes the conversion of...; Region: TPP_PDC_IPDC; cd02005
261594006491	TPP-binding site [chemical binding]; other site
261594006492	dimer interface [polypeptide binding]; other site
261594006493	helix_turn_helix multiple antibiotic resistance protein; Region: HTH_MARR; smart00347
261594006494	MarR family; Region: MarR_2; pfam12802
261594006495	Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067
261594006496	catalytic core [active]
261594006497	Histidine phosphatase domain found in a functionally diverse set of proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP; cd07040
261594006498	Toxin SpoIISA, type II toxin-antitoxin system; Region: SpoIISA_toxin; pfam14171
261594006499	Xaa-His dipeptidase; Region: aa-his-dipept; TIGR01893
261594006500	M20 Peptidase D has specificity for beta-alanyl-L-histidine dipeptide; Region: M20_pepD; cd03890
261594006501	metal binding site [ion binding]; metal-binding site
261594006502	dimer interface [polypeptide binding]; other site
261594006503	Members of the SGNH-hydrolase superfamily, a diverse family of lipases and esterases. The tertiary fold of the enzyme is substantially different from that of the alpha/beta hydrolase family and unique among all known hydrolases; its active site closely...; Region: SGNH_hydrolase_like_1; cd01832
261594006504	active site
261594006505	catalytic triad [active]
261594006506	oxyanion hole [active]
261594006507	RNA polymerase sigma factor, sigma-70 family; Region: sigma70-ECF; TIGR02937
261594006508	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
261594006509	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
261594006510	DNA binding residues [nucleotide binding]
261594006511	penicillin-binding protein 2; Region: pbp2_mrdA; TIGR03423
261594006512	Penicillin-binding Protein dimerisation domain; Region: PBP_dimer; pfam03717
261594006513	Penicillin binding protein transpeptidase domain; Region: Transpeptidase; pfam00905
261594006514	beta-lactamase TEM; Provisional; Region: PRK15442
261594006515	Beta-lactamase enzyme family; Region: Beta-lactamase2; pfam13354
261594006516	PAP2_like proteins, BcrC_like subfamily. Several members of this family have been annotated as bacitracin transport permeases, as it was suspected that they form the permease component of an ABC transporter system. It was shown, however, that BcrC from...; Region: PAP2_BcrC_like; cd03385
261594006517	active site
261594006518	Transcriptional regulators [Transcription]; Region: PurR; COG1609
261594006519	Helix-turn-helix (HTH) DNA binding domain of the LacI family of transcriptional regulators; Region: HTH_LacI; cd01392
261594006520	DNA binding site [nucleotide binding]
261594006521	domain linker motif; other site
261594006522	Ligand binding domain of the LacI tanscriptional regulator family belonging to the type I periplasmic-binding fold protein superfamily; Region: PBP1_LacI_sugar_binding_like; cd06267
261594006523	ligand binding site [chemical binding]; other site
261594006524	dimerization interface [polypeptide binding]; other site
261594006525	polyol permease family; Region: 2A0118; TIGR00897
261594006526	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594006527	putative substrate translocation pore; other site
261594006528	Oxidoreductase family, NAD-binding Rossmann fold; Region: GFO_IDH_MocA; pfam01408
261594006529	Predicted dehydrogenases and related proteins [General function prediction only]; Region: MviM; COG0673
261594006530	Oxidoreductase family, C-terminal alpha/beta domain; Region: GFO_IDH_MocA_C; pfam02894
261594006531	Sugar kinases, ribokinase family [Carbohydrate transport and metabolism]; Region: RbsK; COG0524
261594006532	2-keto-3-deoxygluconate kinase (KdgK) phosphorylates 2-keto-3-deoxygluconate (KDG) to form 2-keto-3-deoxy-6-phosphogluconate (KDGP). KDG is the common intermediate product, that allows organisms to channel D-glucuronate and/or D-galacturinate into the...; Region: KdgK; cd01166
261594006533	substrate binding site [chemical binding]; other site
261594006534	ATP binding site [chemical binding]; other site
261594006535	Methylmalonate semialdehyde dehydrogenase and ALDH family members 6A1 and 6B2; Region: ALDH_F6_MMSDH; cd07085
261594006536	methylmalonic acid semialdehyde dehydrogenase; Region: MMSDH; TIGR01722
261594006537	tetrameric interface [polypeptide binding]; other site
261594006538	NAD binding site [chemical binding]; other site
261594006539	catalytic residues [active]
261594006540	Acetolactate synthase [Amino acid transport and metabolism]; Region: COG3962
261594006541	Pyrimidine (PYR) binding domain of POX and related proteins; Region: TPP_PYR_POX_like; cd07035
261594006542	PYR/PP interface [polypeptide binding]; other site
261594006543	dimer interface [polypeptide binding]; other site
261594006544	TPP binding site [chemical binding]; other site
261594006545	Thiamine pyrophosphate enzyme, central domain; Region: TPP_enzyme_M; pfam00205
261594006546	Thiamine pyrophosphate (TPP) family, IolD subfamily, TPP-binding module; composed of proteins similar to Rhizobium leguminosarum bv. viciae IolD. IolD plays an important role in myo-inositol catabolism; Region: TPP_IolD; cd02003
261594006547	TPP-binding site; other site
261594006548	Tagatose-1,6-bisphosphate (TBP) aldolase and related Type B Class II aldolases. TBP aldolase is a tetrameric class II aldolase that catalyzes the reversible condensation of dihydroxyacetone phosphate with glyceraldehyde 3-phsophate to produce tagatose 1; Region: TBP_aldolase_IIB; cd00947
261594006549	intersubunit interface [polypeptide binding]; other site
261594006550	active site
261594006551	zinc binding site [ion binding]; other site
261594006552	Na+ binding site [ion binding]; other site
261594006553	KduI/IolB family; Region: KduI; pfam04962
261594006554	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cd00189
261594006555	TPR motif; other site
261594006556	binding surface
261594006557	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
261594006558	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
261594006559	salt bridge; other site
261594006560	non-specific DNA binding site [nucleotide binding]; other site
261594006561	sequence-specific DNA binding site [nucleotide binding]; other site
261594006562	D-alanyl-D-alanine carboxypeptidase [Cell envelope biogenesis, outer membrane]; Region: VanY; COG1876
261594006563	D-alanyl-D-alanine carboxypeptidase; Region: VanY; pfam02557
261594006564	S-layer homology domain; Region: SLH; pfam00395
261594006565	S-layer homology domain; Region: SLH; pfam00395
261594006566	N-acetylmuramoyl-L-alanine amidase [Cell envelope biogenesis, outer membrane]; Region: AmiC; COG0860
261594006567	N-acetylmuramoyl-L-alanine amidase or MurNAc-LAA (also known as peptidoglycan aminohydrolase, NAMLA amidase, NAMLAA, Amidase 3, and peptidoglycan amidase; EC 3.5.1.28) is an autolysin that hydrolyzes the amide bond between N-acetylmuramoyl and L-amino...; Region: MurNAc-LAA; cd02696
261594006568	active site
261594006569	metal binding site [ion binding]; metal-binding site
261594006570	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
261594006571	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
261594006572	ATPase components of ABC transporters with duplicated ATPase domains [General function prediction only]; Region: Uup; COG0488
261594006573	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
261594006574	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
261594006575	PAS fold; Region: PAS_4; pfam08448
261594006576	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
261594006577	putative active site [active]
261594006578	heme pocket [chemical binding]; other site
261594006579	c-di-GMP synthetase (diguanylate cyclase, GGDEF domain) [Signal    transduction mechanisms]; Region: COG2199
261594006580	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
261594006581	metal binding site [ion binding]; metal-binding site
261594006582	active site
261594006583	I-site; other site
261594006584	EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2).  The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cd01948
261594006585	Acetyltransferases, including N-acetylases of ribosomal proteins [Translation, ribosomal structure and biogenesis]; Region: RimL; COG1670
261594006586	Acetyltransferase (GNAT) family; Region: Acetyltransf_1; pfam00583
261594006587	Catalytic domain of phosphoinositide-specific phospholipase C-like phosphodiesterases superfamily; Region: PI-PLCc_GDPD_SF; cl14615
261594006588	SMI1 / KNR4 family (SUKH-1); Region: SMI1_KNR4; pfam09346
261594006589	Uncharacterized NAD(FAD)-dependent dehydrogenases [General function prediction only]; Region: HcaD; COG0446
261594006590	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
261594006591	Zn-dependent hydrolases, including glyoxylases [General function prediction only]; Region: GloB; COG0491
261594006592	Rhodanese Homology Domain (RHOD); an alpha beta fold domain found duplicated in the rhodanese protein. The cysteine containing enzymatically active version of the domain is also found in the Cdc25 class of protein phosphatases and a variety of proteins...; Region: RHOD; cd00158
261594006593	active site residue [active]
261594006594	Rhodanese Homology Domain (RHOD); an alpha beta fold domain found duplicated in the rhodanese protein. The cysteine containing enzymatically active version of the domain is also found in the Cdc25 class of protein phosphatases and a variety of proteins...; Region: RHOD; cd00158
261594006595	active site residue [active]
261594006596	metallophosphatase superfamily, metallophosphatase domain; Region: MPP_superfamily; cl13995
261594006597	ABC-type cobalt transport system, ATPase component [Inorganic ion transport and metabolism]; Region: CbiO; COG1122
261594006598	ATP-binding cassette domain of the drug resistance transporter and related proteins, subfamily A; Region: ABC_DR_subfamily_A; cd03230
261594006599	Walker A/P-loop; other site
261594006600	ATP binding site [chemical binding]; other site
261594006601	Q-loop/lid; other site
261594006602	ABC transporter signature motif; other site
261594006603	Walker B; other site
261594006604	D-loop; other site
261594006605	H-loop/switch region; other site
261594006606	ABC-type multidrug transport system, permease component [Defense mechanisms]; Region: COG0842
261594006607	ABC-2 type transporter; Region: ABC2_membrane; pfam01061
261594006608	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
261594006609	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
261594006610	Protein of unknown function (DUF523); Region: DUF523; pfam04463
261594006611	Uncharacterized conserved protein [Function unknown]; Region: COG3272
261594006612	Protein of unknown function (DUF1722); Region: DUF1722; pfam08349
261594006613	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
261594006614	Short chain acyl-CoA dehydrogenases and eukaryotic short/branched chain acyl-CoA dehydrogenases; Region: SCAD_SBCAD; cd01158
261594006615	FAD binding site [chemical binding]; other site
261594006616	homotetramer interface [polypeptide binding]; other site
261594006617	substrate binding pocket [chemical binding]; other site
261594006618	catalytic base [active]
261594006619	acetyl-CoA carboxylase biotin carboxylase subunit; Validated; Region: PRK06111
261594006620	Carbamoyl-phosphate synthase L chain, N-terminal domain; Region: CPSase_L_chain; pfam00289
261594006621	ATP-grasp domain; Region: ATP-grasp_4; cl17255
261594006622	Biotin carboxylase C-terminal domain; Region: Biotin_carb_C; smart00878
261594006623	The biotinyl-domain or biotin carboxyl carrier protein (BCCP) domain is present in all biotin-dependent enzymes, such as acetyl-CoA carboxylase, pyruvate carboxylase, propionyl-CoA carboxylase, methylcrotonyl-CoA carboxylase, geranyl-CoA carboxylase; Region: biotinyl_domain; cd06850
261594006624	carboxyltransferase (CT) interaction site; other site
261594006625	biotinylation site [posttranslational modification]; other site
261594006626	Isopropylmalate/homocitrate/citramalate synthases [Amino acid transport and metabolism]; Region: LeuA; COG0119
261594006627	3-hydroxy-3-methylglutaryl-CoA lyase, catalytic TIM barrel domain; Region: DRE_TIM_HMGL; cd07938
261594006628	active site
261594006629	catalytic residues [active]
261594006630	metal binding site [ion binding]; metal-binding site
261594006631	enoyl-CoA hydratase; Provisional; Region: PRK07657
261594006632	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
261594006633	substrate binding site [chemical binding]; other site
261594006634	oxyanion hole (OAH) forming residues; other site
261594006635	trimer interface [polypeptide binding]; other site
261594006636	Acetyl-CoA carboxylase, carboxyltransferase component (subunits alpha and beta) [Lipid metabolism]; Region: COG4799
261594006637	Acetyl-CoA carboxylase alpha subunit [Lipid metabolism]; Region: AccA; cl17345
261594006638	Acetyl-CoA carboxylase alpha subunit [Lipid metabolism]; Region: AccA; cl17345
261594006639	Domain of unknown function (DUF3448); Region: DUF3448; pfam11930
261594006640	acetate--CoA ligase; Region: Ac_CoA_lig_AcsA; TIGR02188
261594006641	Uncharacterized acyl-CoA synthetase subfamily similar to Acetoacetyl-CoA synthetase; Region: AACS_like; cd05968
261594006642	acyl-activating enzyme (AAE) consensus motif; other site
261594006643	putative AMP binding site [chemical binding]; other site
261594006644	putative active site [active]
261594006645	putative CoA binding site [chemical binding]; other site
261594006646	Acetyltransferases, including N-acetylases of ribosomal proteins [Translation, ribosomal structure and biogenesis]; Region: RimL; COG1670
261594006647	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594006648	Coenzyme A binding pocket [chemical binding]; other site
261594006649	hypothetical protein; Provisional; Region: PRK08233
261594006650	Uridine kinase [Nucleotide transport and metabolism]; Region: Udk; COG0572
261594006651	active site
261594006652	Alpha/beta hydrolase family; Region: Abhydrolase_6; pfam12697
261594006653	DinB family; Region: DinB; cl17821
261594006654	DinB superfamily; Region: DinB_2; pfam12867
261594006655	D-alanyl-D-alanine carboxypeptidase; Region: Peptidase_S11; pfam00768
261594006656	Beta-lactamase enzyme family; Region: Beta-lactamase2; cl17872
261594006657	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
261594006658	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
261594006659	dimer interface [polypeptide binding]; other site
261594006660	phosphorylation site [posttranslational modification]
261594006661	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594006662	ATP binding site [chemical binding]; other site
261594006663	Mg2+ binding site [ion binding]; other site
261594006664	G-X-G motif; other site
261594006665	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
261594006666	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594006667	active site
261594006668	phosphorylation site [posttranslational modification]
261594006669	intermolecular recognition site; other site
261594006670	dimerization interface [polypeptide binding]; other site
261594006671	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
261594006672	DNA binding site [nucleotide binding]
261594006673	Metal dependent phosphohydrolases with conserved 'HD' motif; Region: HDc; cd00077
261594006674	Zn2+ binding site [ion binding]; other site
261594006675	Mg2+ binding site [ion binding]; other site
261594006676	Domain of unknown function (DUF3885); Region: DUF3885; pfam13021
261594006677	S-adenosylhomocysteine nucleosidase; Validated; Region: PRK06714
261594006678	biliverdin IX beta reductase (BVR-B, aka flavin reductase)-like proteins; atypical (a) SDRs; Region: BVR-B_like_SDR_a; cd05244
261594006679	NADH(P)-binding; Region: NAD_binding_10; pfam13460
261594006680	NAD binding site [chemical binding]; other site
261594006681	substrate binding site [chemical binding]; other site
261594006682	putative active site [active]
261594006683	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594006684	Coenzyme A binding pocket [chemical binding]; other site
261594006685	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594006686	Coenzyme A binding pocket [chemical binding]; other site
261594006687	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4627
261594006688	Putative hydrophobic ligand-binding SRPBCC domain of an uncharacterized subgroup of CalC- and Aha1-like proteins; Region: SRPBCC_CalC_Aha1-like_6; cd08899
261594006689	putative hydrophobic ligand binding site [chemical binding]; other site
261594006690	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
261594006691	AAA domain; Region: AAA_21; pfam13304
261594006692	Walker A/P-loop; other site
261594006693	ATP binding site [chemical binding]; other site
261594006694	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
261594006695	ABC transporter signature motif; other site
261594006696	Walker B; other site
261594006697	D-loop; other site
261594006698	H-loop/switch region; other site
261594006699	ATP-binding cassette domain of the excision repair protein UvrA; Region: ABC_UvrA; cd03238
261594006700	cobalt transport protein ATP-binding subunit; Region: cbiO; TIGR01166
261594006701	Restriction alleviation protein Lar; Region: Lar_restr_allev; pfam14354
261594006702	Predicted transcriptional regulators [Transcription]; Region: COG1695
261594006703	Transcriptional regulator PadR-like family; Region: PadR; pfam03551
261594006704	Beta-lactamase class C and other penicillin binding proteins [Defense mechanisms]; Region: AmpC; COG1680
261594006705	Beta-lactamase; Region: Beta-lactamase; pfam00144
261594006706	Helix-Turn-Helix DNA binding domain of the BmrR transcription regulator; Region: HTH_BmrR; cd01107
261594006707	MerR HTH family regulatory protein; Region: MerR_1; pfam13411
261594006708	DNA binding residues [nucleotide binding]
261594006709	drug binding residues [chemical binding]; other site
261594006710	dimer interface [polypeptide binding]; other site
261594006711	Bacterial transcription activator, effector binding domain; Region: AraC_E_bind; smart00871
261594006712	H+ Antiporter protein; Region: 2A0121; TIGR00900
261594006713	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594006714	putative substrate translocation pore; other site
261594006715	Nudix hydrolase is a superfamily of enzymes found in all three kingdoms of life, and it catalyzes the hydrolysis of NUcleoside DIphosphates linked to other moieties, X. Enzymes belonging to this superfamily require a divalent cation, such as Mg2+ or Mn2+...; Region: Nudix_Hydrolase; cl00447
261594006716	nudix motif; other site
261594006717	Predicted ring-cleavage extradiol dioxygenase [General function prediction only]; Region: COG2514
261594006718	This domain superfamily is found in a variety of structurally related metalloproteins, including the type I extradiol dioxygenases, glyoxalase I and a group of antibiotic resistance proteins; Region: Glo_EDI_BRP_like; cl14632
261594006719	Aminoglycoside 3'-phosphotransferase (APH) and Choline Kinase (ChoK) family. The APH/ChoK family is part of a larger superfamily that includes the catalytic domains of other kinases, such as the typical serine/threonine/tyrosine protein kinases (PKs)...; Region: APH_ChoK_like; cl17270
261594006720	Phosphotransferase enzyme family; Region: APH; pfam01636
261594006721	active site
261594006722	substrate binding site [chemical binding]; other site
261594006723	ATP binding site [chemical binding]; other site
261594006724	DNA-binding transcriptional regulator SoxS; Provisional; Region: PRK10219
261594006725	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
261594006726	Peptidase family M3B Oligopeptidase F (PepF); Region: M3B_PepF_1; cd09606
261594006727	oligoendopeptidase, M3 family; Region: M3_not_pepF; TIGR02289
261594006728	active site
261594006729	Zn binding site [ion binding]; other site
261594006730	Protein of unknown function (DUF4030); Region: DUF4030; pfam13222
261594006731	Transcriptional regulators containing a DNA-binding HTH domain and an aminotransferase domain (MocR family) and their eukaryotic orthologs [Transcription / Amino acid transport and metabolism]; Region: ARO8; COG1167
261594006732	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
261594006733	DNA-binding site [nucleotide binding]; DNA binding site
261594006734	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
261594006735	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594006736	homodimer interface [polypeptide binding]; other site
261594006737	catalytic residue [active]
261594006738	Threonine dehydrogenase and related Zn-dependent dehydrogenases [Amino acid transport and metabolism / General function prediction only]; Region: Tdh; COG1063
261594006739	Alcohol dehydrogenase GroES-like domain; Region: ADH_N; pfam08240
261594006740	2-desacetyl-2-hydroxyethyl bacteriochlorophyllide and other MDR family members; Region: 2-desacetyl-2-hydroxyethyl_bacteriochlorophyllide_; cd08255
261594006741	putative NAD(P) binding site [chemical binding]; other site
261594006742	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594006743	S-adenosylmethionine binding site [chemical binding]; other site
261594006744	Methyltransferase domain; Region: Methyltransf_23; pfam13489
261594006745	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594006746	S-adenosylmethionine binding site [chemical binding]; other site
261594006747	Cell Wall Hydrolase; Region: Hydrolase_2; pfam07486
261594006748	Predicted acetamidase/formamidase [Energy production and conversion]; Region: COG2421
261594006749	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
261594006750	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594006751	active site
261594006752	phosphorylation site [posttranslational modification]
261594006753	intermolecular recognition site; other site
261594006754	dimerization interface [polypeptide binding]; other site
261594006755	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
261594006756	DNA binding site [nucleotide binding]
261594006757	Preprotein translocase subunit SecD [Intracellular trafficking and secretion]; Region: SecD; COG0342
261594006758	Acetyltransferase (GNAT) domain; Region: Acetyltransf_3; pfam13302
261594006759	Acetyltransferase (GNAT) family; Region: Acetyltransf_1; pfam00583
261594006760	Protein of unknown function (DUF3267); Region: DUF3267; pfam11667
261594006761	ABC-type antimicrobial peptide transport system, ATPase component [Defense mechanisms]; Region: SalX; COG1136
261594006762	ATP-binding cassette domain of the transporters involved in export of lipoprotein and macrolide, and cell division protein; Region: ABC_MJ0796_LolCDE_FtsE; cd03255
261594006763	Walker A/P-loop; other site
261594006764	ATP binding site [chemical binding]; other site
261594006765	Q-loop/lid; other site
261594006766	ABC transporter signature motif; other site
261594006767	Walker B; other site
261594006768	D-loop; other site
261594006769	H-loop/switch region; other site
261594006770	hypothetical protein; Provisional; Region: PRK06760
261594006771	Protein of unknown function (DUF3914); Region: DUF3914; pfam13053
261594006772	homoserine dehydrogenase; Validated; Region: PRK06813
261594006773	Homoserine dehydrogenase, NAD binding domain; Region: NAD_binding_3; pfam03447
261594006774	Homoserine dehydrogenase; Region: Homoserine_dh; pfam00742
261594006775	Transcriptional regulators containing a DNA-binding HTH domain and an aminotransferase domain (MocR family) and their eukaryotic orthologs [Transcription / Amino acid transport and metabolism]; Region: ARO8; COG1167
261594006776	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
261594006777	DNA-binding site [nucleotide binding]; DNA binding site
261594006778	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
261594006779	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594006780	homodimer interface [polypeptide binding]; other site
261594006781	catalytic residue [active]
261594006782	D-alanine--D-alanine ligase; Reviewed; Region: ddl; PRK01372
261594006783	D-ala D-ala ligase N-terminus; Region: Dala_Dala_lig_N; pfam01820
261594006784	ATP-grasp domain; Region: ATP-grasp_4; cl17255
261594006785	Putative transcription activator [Transcription]; Region: TenA; COG0819
261594006786	Protein of unknown function (DUF3962); Region: DUF3962; pfam13111
261594006787	Domain of unknown function (DUF3893); Region: DUF3893; pfam13032
261594006788	Protein of unknown function (DUF3995); Region: DUF3995; pfam13160
261594006789	Domain of unknown function (DUF1835); Region: DUF1835; pfam08874
261594006790	Protein of unknown function; Region: DUF3658; pfam12395
261594006791	Cytochrome P450 [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CypX; COG2124
261594006792	Cytochrome P450; Region: p450; cl12078
261594006793	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594006794	H+ Antiporter protein; Region: 2A0121; TIGR00900
261594006795	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594006796	Xenobiotic acyltransferase (XAT): The XAT class of hexapeptide acyltransferases is composed of a large number of microbial enzymes that catalyze the CoA-dependent acetylation of a variety of hydroxyl-bearing acceptors such as chloramphenicol and...; Region: LbH_XAT; cd03349
261594006797	trimer interface [polypeptide binding]; other site
261594006798	active site
261594006799	substrate binding site [chemical binding]; other site
261594006800	CoA binding site [chemical binding]; other site
261594006801	Domain of Unknown Function (DUF1540); Region: DUF1540; pfam07561
261594006802	Predicted transcriptional regulators [Transcription]; Region: COG1695
261594006803	Transcriptional regulator PadR-like family; Region: PadR; pfam03551
261594006804	Cytochrome P450 [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CypX; COG2124
261594006805	Cytochrome P450; Region: p450; cl12078
261594006806	Predicted metal-dependent enzyme of the double-stranded beta helix superfamily [General function prediction only]; Region: COG5553
261594006807	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
261594006808	haloacid dehalogenase-like hydrolase; Region: Hydrolase_3; pfam08282
261594006809	active site
261594006810	motif I; other site
261594006811	motif II; other site
261594006812	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
261594006813	PAS domain S-box; Region: sensory_box; TIGR00229
261594006814	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
261594006815	putative active site [active]
261594006816	heme pocket [chemical binding]; other site
261594006817	phosphate regulon sensor kinase PhoR; Region: phoR_proteo; TIGR02966
261594006818	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
261594006819	dimer interface [polypeptide binding]; other site
261594006820	phosphorylation site [posttranslational modification]
261594006821	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594006822	ATP binding site [chemical binding]; other site
261594006823	Mg2+ binding site [ion binding]; other site
261594006824	G-X-G motif; other site
261594006825	Cell division protein FtsI/penicillin-binding protein 2 [Cell envelope biogenesis, outer membrane]; Region: FtsI; COG0768
261594006826	Penicillin-binding Protein dimerisation domain; Region: PBP_dimer; pfam03717
261594006827	Penicillin-binding Protein dimerisation domain; Region: PBP_dimer; pfam03717
261594006828	Penicillin binding protein transpeptidase domain; Region: Transpeptidase; pfam00905
261594006829	This family includes the Gtfs, a group of homologous glycosyltransferases involved in the final stages of the biosynthesis of antibiotics vancomycin and related chloroeremomycin. Gtfs transfer sugar moieties from an activated NDP-sugar donor to the...; Region: GT1_Gtf_like; cd03784
261594006830	glycosyltransferase, MGT family; Region: MGT; TIGR01426
261594006831	active site
261594006832	TDP-binding site; other site
261594006833	acceptor substrate-binding pocket; other site
261594006834	homodimer interface [polypeptide binding]; other site
261594006835	Aspartate racemase [Cell envelope biogenesis, outer membrane]; Region: RacX; COG1794
261594006836	aspartate racemase; Region: asp_race; TIGR00035
261594006837	hypothetical protein; Provisional; Region: PRK13661
261594006838	ATPase components of various ABC-type transport systems, contain duplicated ATPase [General function prediction only]; Region: COG1123
261594006839	First domain of the ATP-binding cassette component of cobalt transport system; Region: ABC_cobalt_CbiO_domain1; cd03225
261594006840	Walker A/P-loop; other site
261594006841	ATP binding site [chemical binding]; other site
261594006842	Q-loop/lid; other site
261594006843	ABC transporter signature motif; other site
261594006844	Walker B; other site
261594006845	D-loop; other site
261594006846	H-loop/switch region; other site
261594006847	ATP-binding cassette cobalt transporter; Region: DUF3744; pfam12558
261594006848	First domain of the ATP-binding cassette component of cobalt transport system; Region: ABC_cobalt_CbiO_domain1; cd03225
261594006849	Walker A/P-loop; other site
261594006850	ATP binding site [chemical binding]; other site
261594006851	Q-loop/lid; other site
261594006852	ABC transporter signature motif; other site
261594006853	Walker B; other site
261594006854	D-loop; other site
261594006855	H-loop/switch region; other site
261594006856	ABC-type cobalt transport system, permease component CbiQ and related transporters [Inorganic ion transport and metabolism]; Region: CbiQ; COG0619
261594006857	5TMR of 5TMR-LYT; Region: 5TM-5TMR_LYT; pfam07694
261594006858	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
261594006859	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
261594006860	dimer interface [polypeptide binding]; other site
261594006861	phosphorylation site [posttranslational modification]
261594006862	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594006863	ATP binding site [chemical binding]; other site
261594006864	Mg2+ binding site [ion binding]; other site
261594006865	G-X-G motif; other site
261594006866	Protein Kinases, catalytic domain; Region: PKc_like; cl09925
261594006867	Serine/threonine protein kinase [General function prediction only / Signal transduction mechanisms / Transcription / DNA replication, recombination, and repair]; Region: SPS1; COG0515
261594006868	active site
261594006869	ATP binding site [chemical binding]; other site
261594006870	substrate binding site [chemical binding]; other site
261594006871	activation loop (A-loop); other site
261594006872	Uncharacterized protein family (UPF0157); Region: UPF0157; pfam04229
261594006873	NADPH:quinone reductase and related Zn-dependent oxidoreductases [Energy production and conversion / General function prediction only]; Region: Qor; COG0604
261594006874	Medium chain reductase/dehydrogenase (MDR)/zinc-dependent alcohol dehydrogenase-like family; Region: MDR; cl16912
261594006875	NAD(P) binding site [chemical binding]; other site
261594006876	Cell division protein FtsI/penicillin-binding protein 2 [Cell envelope biogenesis, outer membrane]; Region: FtsI; COG0768
261594006877	Penicillin-binding Protein dimerisation domain; Region: PBP_dimer; pfam03717
261594006878	Penicillin binding protein transpeptidase domain; Region: Transpeptidase; pfam00905
261594006879	PASTA domain of PBP2x-like proteins, first repeat. Penicillin-binding proteins (PBPs) are the major targets for beta-lactam antibiotics, like penicillins and cephalosporins. Beta-lactam antibiotics specifically inhibit transpeptidase activity by...; Region: PASTA_Pbp2x-like_1; cd06576
261594006880	PASTA domain of PBP2x-like proteins, second repeat. Penicillin-binding proteins (PBPs) are the major targets for beta-lactam antibiotics, like penicillins and cephalosporins. Beta-lactam antibiotics specifically inhibit transpeptidase activity by...; Region: PASTA_Pbp2x-like_2; cd06575
261594006881	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594006882	H+ Antiporter protein; Region: 2A0121; TIGR00900
261594006883	putative substrate translocation pore; other site
261594006884	Beta-lactamase class C and other penicillin binding proteins [Defense mechanisms]; Region: AmpC; COG1680
261594006885	Beta-lactamase; Region: Beta-lactamase; pfam00144
261594006886	putative acetyltransferase; Provisional; Region: PRK03624
261594006887	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594006888	Coenzyme A binding pocket [chemical binding]; other site
261594006889	Protein of unknown function (DUF3189); Region: DUF3189; pfam11385
261594006890	EDD domain protein, DegV family; Region: DegV; TIGR00762
261594006891	Uncharacterized protein, DegV family COG1307; Region: DegV; pfam02645
261594006892	Putative amidotransferase; Region: DUF4066; pfam13278
261594006893	conserved cys residue [active]
261594006894	Predicted transcriptional regulator [Transcription]; Region: COG2378
261594006895	HTH domain; Region: HTH_11; pfam08279
261594006896	WYL domain; Region: WYL; pfam13280
261594006897	Type 1 glutamine amidotransferase (GATase1)-like domain found in a subgroup of proteins similar to PfpI from Pyrococcus furiosus; Region: GATase1_PfpI_3; cd03140
261594006898	Putative intracellular protease/amidase [General function prediction only]; Region: ThiJ; COG0693
261594006899	conserved cys residue [active]
261594006900	Protein of unknown function (DUF975); Region: DUF975; cl10504
261594006901	Beta-lactamase class C and other penicillin binding proteins [Defense mechanisms]; Region: AmpC; COG1680
261594006902	Beta-lactamase; Region: Beta-lactamase; pfam00144
261594006903	Helix-Turn-Helix DNA binding domain of putative transcription regulators from the MerR superfamily; Region: HTH_MerR-like_sg1; cd04777
261594006904	MerR HTH family regulatory protein; Region: MerR_1; pfam13411
261594006905	DNA binding residues [nucleotide binding]
261594006906	putative dimer interface [polypeptide binding]; other site
261594006907	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594006908	S-adenosylmethionine binding site [chemical binding]; other site
261594006909	H+ Antiporter protein; Region: 2A0121; TIGR00900
261594006910	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594006911	putative substrate translocation pore; other site
261594006912	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594006913	Coenzyme A binding pocket [chemical binding]; other site
261594006914	Glycerophosphodiester phosphodiesterase domain of Staphylococcus aureus and similar proteins; Region: GDPD_SaGlpQ_like; cd08601
261594006915	Glycerophosphoryl diester phosphodiesterase [Energy production and conversion]; Region: UgpQ; COG0584
261594006916	active site
261594006917	catalytic site [active]
261594006918	metal binding site [ion binding]; metal-binding site
261594006919	Domain of unknown function (DUF4269); Region: DUF4269; pfam14091
261594006920	EamA-like transporter family; Region: EamA; pfam00892
261594006921	Carboxylate/Amino Acid/Amine Transporter; Region: 2A78; TIGR00950
261594006922	EamA-like transporter family; Region: EamA; pfam00892
261594006923	Glycosyl hydrolases family 8; Region: Glyco_hydro_8; cl01351
261594006924	Nudix hydrolase is a superfamily of enzymes found in all three kingdoms of life, and it catalyzes the hydrolysis of NUcleoside DIphosphates linked to other moieties, X. Enzymes belonging to this superfamily require a divalent cation, such as Mg2+ or Mn2+...; Region: Nudix_Hydrolase; cl00447
261594006925	nudix motif; other site
261594006926	probable heterocycle-containing bacteriocin, BA_2677 family; Region: B_an_ocin; TIGR03601
261594006927	Beta-lactamase; Region: Beta-lactamase; pfam00144
261594006928	Beta-lactamase class C and other penicillin binding proteins [Defense mechanisms]; Region: AmpC; COG1680
261594006929	oxalate/formate antiporter family transporter; Region: 2A0111; TIGR00890
261594006930	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594006931	putative substrate translocation pore; other site
261594006932	Nudix hydrolase is a superfamily of enzymes found in all three kingdoms of life, and it catalyzes the hydrolysis of NUcleoside DIphosphates linked to other moieties, X. Enzymes belonging to this superfamily require a divalent cation, such as Mg2+ or Mn2+...; Region: Nudix_Hydrolase; cd02883
261594006933	nudix motif; other site
261594006934	DNA polymerase III subunit beta; Validated; Region: PRK06673
261594006935	Beta clamp domain.  The beta subunit (processivity factor) of DNA polymerase III holoenzyme, refered to as the beta clamp, forms a ring shaped dimer that encircles dsDNA (sliding clamp) in bacteria.  The beta-clamp is structurally similar to the trimeric...; Region: beta_clamp; cd00140
261594006936	putative DNA binding surface [nucleotide binding]; other site
261594006937	dimer interface [polypeptide binding]; other site
261594006938	beta-clamp/clamp loader binding surface; other site
261594006939	beta-clamp/translesion DNA polymerase binding surface; other site
261594006940	MutT homolog-1 (MTH1) is a member of the Nudix hydrolase superfamily. MTH1, the mammalian counterpart of MutT, hydrolyzes oxidized purine nucleoside triphosphates, such as 8-oxo-dGTP and 2-hydroxy-ATP, to monophosphates, thereby preventing the...; Region: MTH1; cd03427
261594006941	putative active site [active]
261594006942	nucleotide binding site [chemical binding]; other site
261594006943	nudix motif; other site
261594006944	putative metal binding site [ion binding]; other site
261594006945	Pectate lyase superfamily protein; Region: Pectate_lyase_3; pfam12708
261594006946	Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596
261594006947	Predicted Zn-dependent hydrolases of the beta-lactamase fold [General function prediction only]; Region: COG2220
261594006948	Beta-lactamase superfamily domain; Region: Lactamase_B_2; pfam12706
261594006949	translation initiation factor IF-2; Provisional; Region: PRK14845
261594006950	YjgF, YER057c, and UK114 belong to a large family of proteins present in bacteria, archaea, and eukaryotes with no definitive function. The conserved domain is similar in structure to chorismate mutase but there is no sequence similarity and no...; Region: YjgF_YER057c_UK114_family; cd00448
261594006951	homotrimer interaction site [polypeptide binding]; other site
261594006952	putative active site [active]
261594006953	Domain of unknown function (DUF1963); Region: DUF1963; pfam09234
261594006954	Domain of unknown function (DUF1992); Region: DUF1992; pfam09350
261594006955	Domain of unknown function (DUF3327); Region: DUF3327; pfam11806
261594006956	Predicted hydrolase of the alpha/beta superfamily [General function prediction only]; Region: COG2819
261594006957	Enterochelin esterase and related enzymes [Inorganic ion transport and metabolism]; Region: Fes; COG2382
261594006958	YxiJ-like protein; Region: YxiJ; pfam14176
261594006959	Pleckstrin homology (PH)-like domains in bacteria (PHb); Region: PH-like_bacteria; cd13225
261594006960	pentamer interface [polypeptide binding]; other site
261594006961	dodecaamer interface [polypeptide binding]; other site
261594006962	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594006963	Coenzyme A binding pocket [chemical binding]; other site
261594006964	metal-dependent hydrolase; Provisional; Region: PRK13291
261594006965	DinB superfamily; Region: DinB_2; pfam12867
261594006966	Acetyltransferase (GNAT) domain; Region: Acetyltransf_3; pfam13302
261594006967	Acetyltransferase (GNAT) family; Region: Acetyltransf_1; pfam00583
261594006968	2-polyprenyl-6-methoxyphenol hydroxylase and related FAD-dependent oxidoreductases [Coenzyme metabolism / Energy production and conversion]; Region: UbiH; COG0654
261594006969	Catalytic GIY-YIG domain of nucleotide excision repair endonucleases UvrC, Cho, and similar proteins; Region: GIY-YIG_UvrC_Cho; cd10434
261594006970	GIY-YIG motif/motif A; other site
261594006971	active site
261594006972	catalytic site [active]
261594006973	putative DNA binding site [nucleotide binding]; other site
261594006974	metal binding site [ion binding]; metal-binding site
261594006975	Glucose / Sorbosone dehydrogenase; Region: GSDH; pfam07995
261594006976	Serine/threonine protein kinase [General function prediction only / Signal transduction mechanisms / Transcription / DNA replication, recombination, and repair]; Region: SPS1; COG0515
261594006977	Protein Kinases, catalytic domain; Region: PKc_like; cl09925
261594006978	active site
261594006979	ATP binding site [chemical binding]; other site
261594006980	substrate binding site [chemical binding]; other site
261594006981	Members of the Nudix hydrolase superfamily catalyze the hydrolysis of NUcleoside DIphosphates linked to other moieties, X. Enzymes belonging to this superfamily require a divalent cation, such as Mg2+ or Mn2+, for their activity and contain a highly...; Region: Nudix_Hydrolase_7; cd04664
261594006982	nudix motif; other site
261594006983	Glycine/D-amino acid oxidases (deaminating) [Amino acid transport and metabolism]; Region: DadA; COG0665
261594006984	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; pfam13450
261594006985	Bacteriocin-protection, YdeI or OmpD-Associated; Region: OmdA; pfam13376
261594006986	Arylamine N-acetyltransferase [Secondary metabolites biosynthesis, transport, and catabolism]; Region: NhoA; COG2162
261594006987	MepB protein; Region: MepB; pfam08877
261594006988	Domain of unknown function (DUF4180); Region: DUF4180; pfam13788
261594006989	Predicted hydrolase (HAD superfamily) [General function prediction only]; Region: COG1011
261594006990	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
261594006991	motif II; other site
261594006992	DinB superfamily; Region: DinB_2; pfam12867
261594006993	Mycothiol maleylpyruvate isomerase N-terminal domain; Region: MDMPI_N; pfam11716
261594006994	tyrosine decarboxylase; Region: PLN02880
261594006995	Aspartate aminotransferase (AAT) superfamily (fold type I) of pyridoxal phosphate (PLP)-dependent enzymes. PLP combines with an alpha-amino acid to form a compound called a Schiff base or aldimine intermediate, which depending on the reaction, is the...; Region: AAT_I; cl00321
261594006996	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
261594006997	catalytic residue [active]
261594006998	This family is the oxydase domain of NRPS (non-ribosomal peptide synthetase) and other proteins that modify polypeptides by cyclizing a thioester to form a ring. These include epoB, part of the epothilone biosynthesis pathway; tubD, part of the tubulysin...; Region: mcbC-like_oxidoreductase; cd02142
261594006999	putative FMN binding site [chemical binding]; other site
261594007000	NADPH bind site [chemical binding]; other site
261594007001	Family 41 Carbohydrate-Binding Module from pullulanase-like enzymes; Region: CBM41_pullulanase; cd10315
261594007002	carbohydrate binding site [chemical binding]; other site
261594007003	pullulanase, type I; Region: pulA_typeI; TIGR02104
261594007004	Early set domain associated with the catalytic domain of pullulanase (also called dextrinase and alpha-dextrin endo-1,6-alpha glucosidase); Region: E_set_Pullulanase; cd02860
261594007005	Alpha amylase catalytic domain found in Pullulanase (also called dextrinase; alpha-dextrin endo-1,6-alpha glucosidase), limit dextrinase, and related proteins; Region: AmyAc_Pullulanase_LD-like; cd11341
261594007006	Ca binding site [ion binding]; other site
261594007007	active site
261594007008	catalytic site [active]
261594007009	Domain of unknown function (DUF3372); Region: DUF3372; pfam11852
261594007010	Zinc metalloprotease (elastase) [Amino acid transport and metabolism]; Region: LasB; COG3227
261594007011	Fungalysin/Thermolysin Propeptide Motif; Region: FTP; pfam07504
261594007012	Peptidase M4 family includes thermolysin, protealysin, aureolysin and neutral protease; Region: M4_neutral_protease; cd09597
261594007013	active site
261594007014	Zn binding site [ion binding]; other site
261594007015	Putative zinc-finger; Region: zf-HC2; pfam13490
261594007016	Domain of unknown function (DUF4179); Region: DUF4179; pfam13786
261594007017	RNA polymerase sigma factor SigX; Provisional; Region: PRK09639
261594007018	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
261594007019	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
261594007020	DNA binding residues [nucleotide binding]
261594007021	GyrI-like small molecule binding domain; Region: GyrI-like; cl01368
261594007022	preprotein translocase subunit SecY; Reviewed; Region: secY; PRK12907
261594007023	SecY translocase; Region: SecY; pfam00344
261594007024	hypothetical protein; Validated; Region: PRK06672
261594007025	DnaA N-terminal domain; Region: DnaA_N; pfam11638
261594007026	DnaA N-terminal domain; Region: DnaA_N; pfam11638
261594007027	DnaA N-terminal domain; Region: DnaA_N; pfam11638
261594007028	putative DMT superfamily transporter inner membrane protein; Provisional; Region: PRK11272
261594007029	EamA-like transporter family; Region: EamA; pfam00892
261594007030	EamA-like transporter family; Region: EamA; pfam00892
261594007031	Transcriptional regulators containing a DNA-binding HTH domain and an aminotransferase domain (MocR family) and their eukaryotic orthologs [Transcription / Amino acid transport and metabolism]; Region: ARO8; COG1167
261594007032	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
261594007033	DNA-binding site [nucleotide binding]; DNA binding site
261594007034	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
261594007035	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594007036	homodimer interface [polypeptide binding]; other site
261594007037	catalytic residue [active]
261594007038	Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596
261594007039	TAP-like protein; Region: Abhydrolase_4; pfam08386
261594007040	Plasmid segregation protein ParM and similar proteins; Region: ParM_like; cd10227
261594007041	Mg binding site [ion binding]; other site
261594007042	nucleotide binding site [chemical binding]; other site
261594007043	putative protofilament interface [polypeptide binding]; other site
261594007044	Protein of unknown function (DUF1697); Region: DUF1697; pfam08002
261594007045	Predicted membrane protein [Function unknown]; Region: COG4129
261594007046	Bacterial protein of unknown function (DUF939); Region: DUF939; pfam06081
261594007047	Acetyltransferase (GNAT) family; Region: Acetyltransf_1; pfam00583
261594007048	Domain of Unknown Function with PDB structure (DUF3862); Region: DUF3862; pfam12978
261594007049	sporulation lipoprotein, YhcN/YlaJ family; Region: spore_YhcN_YlaJ; TIGR02898
261594007050	Sporulation lipoprotein YhcN/YlaJ (Spore_YhcN_YlaJ); Region: Spore_YhcN_YlaJ; pfam09580
261594007051	germination protein YpeB; Region: spore_YpeB; TIGR02889
261594007052	spore cortex-lytic enzyme; Region: spore_SleB; TIGR02869
261594007053	Putative peptidoglycan binding domain; Region: PG_binding_1; pfam01471
261594007054	Cell Wall Hydrolase; Region: Hydrolase_2; pfam07486
261594007055	Protein of unknown function (DUF3889); Region: DUF3889; pfam13028
261594007056	Beta-lactamase class C and other penicillin binding proteins [Defense mechanisms]; Region: AmpC; COG1680
261594007057	Beta-lactamase; Region: Beta-lactamase; pfam00144
261594007058	tryptophan 2,3-dioxygenase; Region: trp_2_3_diox; TIGR03036
261594007059	arylformamidase; Region: trp_arylform; TIGR03035
261594007060	Aspartate aminotransferase (AAT) superfamily (fold type I) of pyridoxal phosphate (PLP)-dependent enzymes. PLP combines with an alpha-amino acid to form a compound called a Schiff base or aldimine intermediate, which depending on the reaction, is the...; Region: AAT_I; cl00321
261594007061	kynureninase; Region: kynureninase; TIGR01814
261594007062	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
261594007063	catalytic residue [active]
261594007064	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
261594007065	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
261594007066	Nudix hydrolase is a superfamily of enzymes found in all three kingdoms of life, and it catalyzes the hydrolysis of NUcleoside DIphosphates linked to other moieties, X. Enzymes belonging to this superfamily require a divalent cation, such as Mg2+ or Mn2+...; Region: Nudix_Hydrolase; cl00447
261594007067	nudix motif; other site
261594007068	N-acetyltransferase; Region: Acetyltransf_2; cl00949
261594007069	START/RHO_alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) ligand-binding domain superfamily; Region: SRPBCC; cl14643
261594007070	hydrophobic ligand binding site; other site
261594007071	Protein of unknown function (DUF3977); Region: DUF3977; pfam13122
261594007072	Transcriptional activator of acetoin/glycerol metabolism [Secondary metabolites biosynthesis, transport, and catabolism / Transcription]; Region: AcoR; COG3284
261594007073	GAF domain; Region: GAF; pfam01590
261594007074	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
261594007075	Walker A motif; other site
261594007076	ATP binding site [chemical binding]; other site
261594007077	Walker B motif; other site
261594007078	arginine finger; other site
261594007079	Bacterial regulatory protein, Fis family; Region: HTH_8; pfam02954
261594007080	Acetyltransferase (GNAT) domain; Region: Acetyltransf_4; pfam13420
261594007081	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594007082	Coenzyme A binding pocket [chemical binding]; other site
261594007083	Transcriptional regulators of sugar metabolism [Transcription / Carbohydrate transport and metabolism]; Region: GlpR; COG1349
261594007084	helix_turn_helix, Deoxyribose operon repressor; Region: HTH_DEOR; smart00420
261594007085	DeoR C terminal sensor domain; Region: DeoRC; pfam00455
261594007086	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594007087	S-adenosylmethionine binding site [chemical binding]; other site
261594007088	Thioredoxin reductase [Posttranslational modification, protein turnover, chaperones]; Region: TrxB; COG0492
261594007089	Rrf2 family protein; Region: rrf2_super; TIGR00738
261594007090	Transcriptional regulator; Region: Rrf2; pfam02082
261594007091	Protein of unknown function (DUF4085); Region: DUF4085; pfam13315
261594007092	dihydrolipoamide dehydrogenase; Validated; Region: acoL; PRK06912
261594007093	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
261594007094	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
261594007095	Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain; Region: Pyr_redox_dim; pfam02852
261594007096	branched-chain alpha-keto acid dehydrogenase subunit E2; Reviewed; Region: PRK11856
261594007097	Lipoyl domain of the dihydrolipoyl acyltransferase component (E2) of 2-oxo acid dehydrogenases. 2-oxo acid dehydrogenase multienzyme complexes, like pyruvate dehydrogenase (PDH), 2-oxoglutarate dehydrogenase (OGDH) and branched-chain 2-oxo acid...; Region: lipoyl_domain; cd06849
261594007098	E3 interaction surface; other site
261594007099	lipoyl attachment site [posttranslational modification]; other site
261594007100	e3 binding domain; Region: E3_binding; pfam02817
261594007101	2-oxoacid dehydrogenases acyltransferase (catalytic domain); Region: 2-oxoacid_dh; pfam00198
261594007102	Pyruvate/2-oxoglutarate dehydrogenase complex, dehydrogenase (E1) component, eukaryotic type, beta subunit [Energy production and conversion]; Region: AcoB; COG0022
261594007103	Pyrimidine (PYR) binding domain of the beta subunits of the E1 components of human pyruvate dehydrogenase complex (E1- PDHc) and related proteins; Region: TPP_PYR_E1-PDHc-beta_like; cd07036
261594007104	alpha subunit interface [polypeptide binding]; other site
261594007105	TPP binding site [chemical binding]; other site
261594007106	heterodimer interface [polypeptide binding]; other site
261594007107	Transketolase, C-terminal domain; Region: Transketolase_C; pfam02780
261594007108	Pyruvate/2-oxoglutarate dehydrogenase complex, dehydrogenase (E1) component, eukaryotic type, alpha subunit [Energy production and conversion]; Region: AcoA; COG1071
261594007109	Thiamine pyrophosphate (TPP) family, E1 of PDC_ADC_BCADC subfamily, TPP-binding module; composed of proteins similar to the E1 components of the human pyruvate dehydrogenase complex (PDC), the acetoin dehydrogenase complex (ADC) and the branched chain...; Region: TPP_E1_PDC_ADC_BCADC; cd02000
261594007110	tetramer interface [polypeptide binding]; other site
261594007111	TPP-binding site [chemical binding]; other site
261594007112	heterodimer interface [polypeptide binding]; other site
261594007113	phosphorylation loop region [posttranslational modification]
261594007114	DinB superfamily; Region: DinB_2; pfam12867
261594007115	Protein of unknown function (DUF1572); Region: DUF1572; pfam07609
261594007116	short chain dehydrogenase; Provisional; Region: PRK06914
261594007117	17beta hydroxysteroid dehydrogenase-like, classical (c) SDRs; Region: 17beta-HSD-like_SDR_c; cd05374
261594007118	NADP binding site [chemical binding]; other site
261594007119	active site
261594007120	steroid binding site; other site
261594007121	Uncharacterized protein family (UPF0157); Region: UPF0157; pfam04229
261594007122	Domain of unknown function (DUF4181); Region: DUF4181; pfam13789
261594007123	Members of the Nudix hydrolase superfamily catalyze the hydrolysis of NUcleoside DIphosphates linked to other moieties, X. Enzymes belonging to this superfamily require a divalent cation, such as Mg2+ or Mn2+, for their activity and contain a highly...; Region: Nudix_Hydrolase_29; cd04688
261594007124	nudix motif; other site
261594007125	Domain of unknown function (DUF4181); Region: DUF4181; pfam13789
261594007126	Protein phosphatase 2C; Region: PP2C_2; pfam13672
261594007127	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
261594007128	dimer interface [polypeptide binding]; other site
261594007129	conserved gate region; other site
261594007130	putative PBP binding loops; other site
261594007131	ABC-ATPase subunit interface; other site
261594007132	ABC-type proline/glycine betaine transport system, ATPase component [Amino acid transport and metabolism]; Region: ProV; COG4175
261594007133	ATP-binding cassette domain of the osmoprotectant proline/glycine betaine uptake system; Region: ABC_Pro_Gly_Betaine; cd03294
261594007134	Walker A/P-loop; other site
261594007135	ATP binding site [chemical binding]; other site
261594007136	Q-loop/lid; other site
261594007137	ABC transporter signature motif; other site
261594007138	Walker B; other site
261594007139	D-loop; other site
261594007140	H-loop/switch region; other site
261594007141	This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domains in association with the ABC transporter OpuCA. OpuCA is the ATP binding component of a bacterial solute transporter that serves a protective role to cells growing...; Region: CBS_pair_ABC_OpuCA_assoc2; cd04583
261594007142	ABC-type proline/glycine betaine transport systems, periplasmic components [Amino acid transport and metabolism]; Region: ProX; COG2113
261594007143	Substrate binding domain of ABC-type glycine betaine transport system; Region: OpuAC; pfam04069
261594007144	Clp protease; Region: CLP_protease; pfam00574
261594007145	Caseinolytic protease (ClpP) is an ATP-dependent, highly conserved serine protease; Region: S14_ClpP_2; cd07017
261594007146	oligomer interface [polypeptide binding]; other site
261594007147	active site residues [active]
261594007148	RNA polymerase factor sigma-70; Validated; Region: PRK06704
261594007149	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
261594007150	Sigma-70, region 4; Region: Sigma70_r4_2; pfam08281
261594007151	DNA binding residues [nucleotide binding]
261594007152	2Fe-2S iron-sulfur cluster binding domain. Iron-sulfur proteins play an important role in electron transfer processes and in various enzymatic reactions. The family includes plant and algal ferredoxins, which act as electron carriers in photosynthesis...; Region: fer2; cd00207
261594007153	Ferredoxin [Energy production and conversion]; Region: Fdx; COG0633
261594007154	catalytic loop [active]
261594007155	iron binding site [ion binding]; other site
261594007156	RPI_A: Ribose 5-phosphate isomerase type A (RPI_A) subfamily; RPI catalyzes the reversible conversion of ribose-5-phosphate to ribulose 5-phosphate, the first step of the non-oxidative branch of the pentose phosphate pathway. This reaction leads to the...; Region: RPI_A; cd01398
261594007157	tetramer (dimer of dimers) interface [polypeptide binding]; other site
261594007158	active site
261594007159	dimer interface [polypeptide binding]; other site
261594007160	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594007161	Coenzyme A binding pocket [chemical binding]; other site
261594007162	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3397
261594007163	Chitin binding domain; Region: Chitin_bind_3; pfam03067
261594007164	Fibronectin type 3 domain; One of three types of internal repeats found in the plasma protein fibronectin. Its tenth fibronectin type III repeat contains an RGD cell recognition sequence in a flexible loop between 2 strands. Approximately 2% of all...; Region: FN3; cd00063
261594007165	Interdomain contacts; other site
261594007166	Cytokine receptor motif; other site
261594007167	Fibronectin type 3 domain; One of three types of internal repeats found in the plasma protein fibronectin. Its tenth fibronectin type III repeat contains an RGD cell recognition sequence in a flexible loop between 2 strands. Approximately 2% of all...; Region: FN3; cd00063
261594007168	Interdomain contacts; other site
261594007169	Cytokine receptor motif; other site
261594007170	Carbohydrate binding domain; Region: CBM_5_12; pfam02839
261594007171	topology modulation protein; Reviewed; Region: PRK08118
261594007172	AAA domain; Region: AAA_17; pfam13207
261594007173	Protein of unknown function (DUF2809); Region: DUF2809; pfam10990
261594007174	Domain of unknown function (DUF1835); Region: DUF1835; pfam08874
261594007175	Protein of unknown function; Region: DUF3658; pfam12395
261594007176	Protein of unknown function (DUF419); Region: DUF419; pfam04237
261594007177	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594007178	Coenzyme A binding pocket [chemical binding]; other site
261594007179	S-layer homology domain; Region: SLH; pfam00395
261594007180	S-layer homology domain; Region: SLH; pfam00395
261594007181	S-layer homology domain; Region: SLH; pfam00395
261594007182	Predicted hydrolase (metallo-beta-lactamase superfamily) [General function prediction only]; Region: ComEC; COG2333
261594007183	Metallo-beta-lactamase superfamily; Region: Lactamase_B; smart00849
261594007184	Protein of unknown function (DUF3006); Region: DUF3006; pfam11213
261594007185	PlyB is a bacteriophage endolysin that displays potent lytic activity toward Bacillus anthracis.  PlyB has an N-terminal glycosyl hydrolase family 25 (GH25) catalytic domain and a C-terminal bacterial SH3-like domain, SH3b.  Both domains are required for...; Region: GH25_PlyB-like; cd06523
261594007186	Glycosyl hydrolases family 25; Region: Glyco_hydro_25; pfam01183
261594007187	active site
261594007188	N-acetylmuramoyl-l-alanine amidase; Region: Amidase02_C; pfam12123
261594007189	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594007190	Coenzyme A binding pocket [chemical binding]; other site
261594007191	Beta-lactamase enzyme family; Region: Beta-lactamase2; pfam13354
261594007192	Predicted transcriptional regulators [Transcription]; Region: COG1695
261594007193	Transcriptional regulator PadR-like family; Region: PadR; pfam03551
261594007194	Protein of unknown function (DUF952); Region: DUF952; pfam06108
261594007195	Superfamily I DNA and RNA helicases [General function prediction only]; Region: COG3973
261594007196	Part of AAA domain; Region: AAA_19; pfam13245
261594007197	Family description; Region: UvrD_C_2; pfam13538
261594007198	CAAX protease self-immunity; Region: Abi; pfam02517
261594007199	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594007200	S-adenosylmethionine binding site [chemical binding]; other site
261594007201	GGCT-like domains, also called AIG2-like family. Gamma-glutamyl cyclotransferase (GGCT) catalyzes the formation of pyroglutamic acid (5-oxoproline) from dipeptides containing gamma-glutamyl, and is a dimeric protein. In Homo sapiens, the protein is...; Region: GGCT_like; cd06661
261594007202	putative active site pocket [active]
261594007203	dimerization interface [polypeptide binding]; other site
261594007204	putative catalytic residue [active]
261594007205	ATP-dependent DNA helicase RecQ; Region: recQ; TIGR01389
261594007206	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
261594007207	ATP binding site [chemical binding]; other site
261594007208	putative Mg++ binding site [ion binding]; other site
261594007209	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
261594007210	nucleotide binding region [chemical binding]; other site
261594007211	ATP-binding site [chemical binding]; other site
261594007212	This DNA-binding domain is found in the RecQ helicase among others and has a helix-turn-helix structure; Region: RQC; smart00956
261594007213	HRDC domain; Region: HRDC; pfam00570
261594007214	Protein of unknown function (DUF4017); Region: DUF4017; pfam13209
261594007215	oligoendopeptidase, M3 family; Region: M3_not_pepF; TIGR02289
261594007216	Peptidase family M3B Oligopeptidase F (PepF); Region: M3B_PepF_1; cd09606
261594007217	active site
261594007218	Zn binding site [ion binding]; other site
261594007219	putative manganese-dependent inorganic pyrophosphatase; Provisional; Region: PRK05427
261594007220	The CBS domain, named after human CBS, is a small domain originally identified in cystathionine beta-synthase and is subsequently found in a wide range of different proteins. CBS domains usually occur in tandem repeats. They associate to form a so-called...; Region: CBS_pair; cl15354
261594007221	DHHA2 domain; Region: DHHA2; pfam02833
261594007222	Chitin binding domain; Region: Chitin_bind_3; pfam03067
261594007223	Acetyltransferase (GNAT) domain; Region: Acetyltransf_10; pfam13673
261594007224	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594007225	Coenzyme A binding pocket [chemical binding]; other site
261594007226	Uncharacterized homolog of gamma-carboxymuconolactone decarboxylase subunit [Function unknown]; Region: COG0599
261594007227	Na+/alanine symporter [Amino acid transport and metabolism]; Region: AlsT; COG1115
261594007228	Sodium:alanine symporter family; Region: Na_Ala_symp; cl00548
261594007229	ALDH subfamily: ALDH families 1and 2, including 10-formyltetrahydrofolate dehydrogenase, NAD+-dependent retinal dehydrogenase 1 and related proteins; Region: ALDH_F1-2_Ald2-like; cd07091
261594007230	Aldehyde dehydrogenase family; Region: Aldedh; pfam00171
261594007231	NAD(P) binding site [chemical binding]; other site
261594007232	catalytic residues [active]
261594007233	Dihydrodipicolinate synthase/N-acetylneuraminate lyase [Amino acid transport and metabolism / Cell envelope biogenesis, outer membrane]; Region: DapA; COG0329
261594007234	Dihydrodipicolinate synthase family; Region: DHDPS-like; cd00408
261594007235	inhibitor site; inhibition site
261594007236	active site
261594007237	dimer interface [polypeptide binding]; other site
261594007238	catalytic residue [active]
261594007239	Proline racemase; Region: Pro_racemase; pfam05544
261594007240	hydroxyproline-2-epimerase; Provisional; Region: PRK13971
261594007241	hydroxyproline-2-epimerase; Provisional; Region: PRK13971
261594007242	Proline racemase; Region: Pro_racemase; pfam05544
261594007243	Glycine/D-amino acid oxidases (deaminating) [Amino acid transport and metabolism]; Region: DadA; COG0665
261594007244	hydroxyglutarate oxidase; Provisional; Region: PRK11728
261594007245	PAS domain; Region: PAS; smart00091
261594007246	PAS domain; Region: PAS_9; pfam13426
261594007247	Response regulator containing CheY-like receiver, AAA-type ATPase, and DNA-binding domains [Signal transduction mechanisms]; Region: AtoC; COG2204
261594007248	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
261594007249	Walker A motif; other site
261594007250	ATP binding site [chemical binding]; other site
261594007251	Walker B motif; other site
261594007252	arginine finger; other site
261594007253	Bacterial regulatory protein, Fis family; Region: HTH_8; pfam02954
261594007254	Protein of unknown function (DUF2653); Region: DUF2653; pfam10850
261594007255	Domain of unknown function (DUF1836); Region: DUF1836; pfam08876
261594007256	Uncharacterized membrane-associated protein [Function unknown]; Region: DedA; COG0586
261594007257	SNARE associated Golgi protein; Region: SNARE_assoc; pfam09335
261594007258	D-alanyl-lipoteichoic acid biosynthesis protein DltD; Region: LTA_DltD; TIGR04092
261594007259	DltD N-terminal region; Region: DltD_N; pfam04915
261594007260	DltD central region; Region: DltD_M; pfam04918
261594007261	DltD C-terminal region; Region: DltD_C; pfam04914
261594007262	Acetyltransferase (GNAT) domain; Region: Acetyltransf_3; pfam13302
261594007263	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594007264	Coenzyme A binding pocket [chemical binding]; other site
261594007265	ABC-type oligopeptide transport system, periplasmic component [Amino acid transport and metabolism]; Region: OppA; COG4166
261594007266	The substrate-binding component of an ABC-type oligopetide import system contains the type 2 periplasmic binding fold; Region: PBP2_OppA; cd08504
261594007267	peptide binding site [polypeptide binding]; other site
261594007268	Cell wall-associated hydrolases (invasion-associated proteins) [Cell envelope biogenesis, outer membrane]; Region: Spr; COG0791
261594007269	NlpC/P60 family; Region: NLPC_P60; pfam00877
261594007270	L-Ala-D/L-Glu epimerase catalyzes the epimerization of L-Ala-D/L-Glu and other dipeptides. The genomic context and the substrate specificity of characterized members of this family from E.coli and B.subtilis indicates a possible role in the metabolism of...; Region: L-Ala-DL-Glu_epimerase; cd03319
261594007271	o-succinylbenzoate synthase; Region: menC_lowGC/arch; TIGR01928
261594007272	active site
261594007273	Septum formation initiator; Region: DivIC; pfam04977
261594007274	Septum formation initiator [Cell division and chromosome partitioning]; Region: COG2919
261594007275	Type 1 glutamine amidotransferase (GATase1)-like domain; Region: GAT_1; cl00020
261594007276	Cytidine deaminase zinc-binding domain. These enzymes are Zn dependent. The zinc ion in the active site plays a central role in the proposed catalytic mechanism, activating a water molecule to form a hydroxide ion that performs a nucleophilic attack on...; Region: cytidine_deaminase; cd01283
261594007277	active site
261594007278	catalytic motif [active]
261594007279	Zn binding site [ion binding]; other site
261594007280	Methyltransferase domain; Region: Methyltransf_23; pfam13489
261594007281	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594007282	S-adenosylmethionine binding site [chemical binding]; other site
261594007283	X-Pro dipeptidyl-peptidase (S15 family); Region: Peptidase_S15; pfam02129
261594007284	X-Pro dipeptidyl-peptidase C-terminal non-catalytic domain; Region: PepX_C; pfam08530
261594007285	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
261594007286	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
261594007287	dimerization interface [polypeptide binding]; other site
261594007288	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
261594007289	dimer interface [polypeptide binding]; other site
261594007290	phosphorylation site [posttranslational modification]
261594007291	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594007292	ATP binding site [chemical binding]; other site
261594007293	Mg2+ binding site [ion binding]; other site
261594007294	G-X-G motif; other site
261594007295	Alpha/beta hydrolase family; Region: Abhydrolase_5; pfam12695
261594007296	bifunctional 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase/phosphatase; Validated; Region: PRK06698
261594007297	bifunctional 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase/phosphatase; Provisional; Region: PRK14697
261594007298	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
261594007299	motif II; other site
261594007300	Aminoglycoside 3'-phosphotransferase (APH) and Choline Kinase (ChoK) family. The APH/ChoK family is part of a larger superfamily that includes the catalytic domains of other kinases, such as the typical serine/threonine/tyrosine protein kinases (PKs)...; Region: APH_ChoK_like; cl17270
261594007301	Phosphotransferase enzyme family; Region: APH; pfam01636
261594007302	active site
261594007303	substrate binding site [chemical binding]; other site
261594007304	ATP binding site [chemical binding]; other site
261594007305	Teichoic acid biosynthesis proteins [Cell envelope biogenesis, outer membrane]; Region: WecG; COG1922
261594007306	The glycosyltransferase WecG/TagA superfamily contains Escherichia coli WecG, Bacillus subtilis TagA and related proteins. E. coli WecG is believed to be a UDP-N-acetyl-D-mannosaminuronic acid transferase, and is involved in enterobacterial common...; Region: Glyco_transf_WecG_TagA; cd06533
261594007307	EDD domain protein, DegV family; Region: DegV; TIGR00762
261594007308	Uncharacterized protein, DegV family COG1307; Region: DegV; pfam02645
261594007309	Acetyltransferase (GNAT) family; Region: Acetyltransf_1; pfam00583
261594007310	Coenzyme A binding pocket [chemical binding]; other site
261594007311	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594007312	Major Facilitator Superfamily; Region: MFS_1; pfam07690
261594007313	putative substrate translocation pore; other site
261594007314	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594007315	putative substrate translocation pore; other site
261594007316	Integral membrane protein CcmA involved in cell shape determination [Cell envelope biogenesis, outer membrane]; Region: CcmA; COG1664
261594007317	Polymer-forming cytoskeletal; Region: Bactofilin; pfam04519
261594007318	Protein of unknown function (DUF4004); Region: DUF4004; pfam13171
261594007319	Sugar transport-related sRNA regulator N-term; Region: SgrR_N; pfam12793
261594007320	ABC-type uncharacterized transport system, periplasmic component [General function prediction only]; Region: COG4533
261594007321	The C-terminal solute-binding domain of DNA-binding transcriptional regulator SgrR is related to the ABC-type oligopeptide-binding proteins and contains the type 2 periplasmic-binding fold; Region: PBP2_SgrR_like; cd08507
261594007322	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594007323	Major Facilitator Superfamily; Region: MFS_1; pfam07690
261594007324	putative substrate translocation pore; other site
261594007325	Domain of unknown function (DUF4309); Region: DUF4309; pfam14172
261594007326	Peptidase Gluzincin family (thermolysin-like proteinases, TLPs) includes peptidases M1, M2, M3, M4, M13, M32 and M36 (fungalysins); Region: GluZincin; cl14813
261594007327	nuc_hydro: Nucleoside hydrolases. Nucleoside hydrolases cleave the N-glycosidic bond in nucleosides generating ribose and the respective base. These enzymes vary in their substrate specificity.  This group contains eukaryotic, bacterial and archeal...; Region: nuc_hydro; cd00455
261594007328	active site
261594007329	Protein of unknown function (DUF3970); Region: DUF3970; pfam13113
261594007330	Methyltransferase domain; Region: Methyltransf_31; pfam13847
261594007331	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594007332	S-adenosylmethionine binding site [chemical binding]; other site
261594007333	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594007334	putative substrate translocation pore; other site
261594007335	Major Facilitator Superfamily; Region: MFS_1; pfam07690
261594007336	aspartate aminotransferase; Provisional; Region: PRK07681
261594007337	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
261594007338	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594007339	homodimer interface [polypeptide binding]; other site
261594007340	catalytic residue [active]
261594007341	FabZ is a 17kD beta-hydroxyacyl-acyl carrier protein (ACP) dehydratase that primarily catalyzes the dehydration of beta-hydroxyacyl-ACP to trans-2-acyl-ACP, the third step in the elongation phase of the bacterial/ plastid, type II, fatty-acid...; Region: FabZ; cd01288
261594007342	pantothenate kinase; Provisional; Region: PRK13317
261594007343	pantothenate kinase, eukaryotic/staphyloccocal type; Region: panK_eukar; TIGR00555
261594007344	CAAX protease self-immunity; Region: Abi; pfam02517
261594007345	Protein of unknown function (DUF4052); Region: DUF4052; pfam13261
261594007346	Bacillus tandem small hypothetical protein; Region: Bac_small_yrzI; TIGR02413
261594007347	Bacillus tandem small hypothetical protein; Region: Bac_small_yrzI; TIGR02413
261594007348	Bacillus tandem small hypothetical protein; Region: Bac_small_yrzI; TIGR02413
261594007349	Probable sporulation protein (Bac_small_yrzI); Region: Bac_small_YrzI; pfam09501
261594007350	Probable sporulation protein (Bac_small_yrzI); Region: Bac_small_YrzI; pfam09501
261594007351	Probable sporulation protein (Bac_small_yrzI); Region: Bac_small_YrzI; pfam09501
261594007352	Predicted permease, member of the PurR regulon [General function prediction only]; Region: yhhT; COG0628
261594007353	Domain of unknown function DUF20; Region: UPF0118; pfam01594
261594007354	HNH endonuclease; Region: HNH_5; pfam14279
261594007355	alkanesulfonate monooxygenase; Provisional; Region: PRK00719
261594007356	Alkanesulfonate monoxygenase is the monoxygenase of a two-component system that catalyzes the conversion of alkanesulfonates to the corresponding aldehyde and sulfite. Alkanesulfonate monoxygenase (SsuD) has an absolute requirement for reduced flavin...; Region: Alkanesulfonate_monoxygenase; cd01094
261594007357	active site
261594007358	dimer interface [polypeptide binding]; other site
261594007359	non-prolyl cis peptide bond; other site
261594007360	insertion regions; other site
261594007361	ABC-type nitrate/sulfonate/bicarbonate transport system, permease component [Inorganic ion transport and metabolism]; Region: TauC; COG0600
261594007362	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
261594007363	dimer interface [polypeptide binding]; other site
261594007364	conserved gate region; other site
261594007365	putative PBP binding loops; other site
261594007366	ABC-ATPase subunit interface; other site
261594007367	ABC transporter, substrate-binding protein, aliphatic sulfonates family; Region: SsuA_fam; TIGR01728
261594007368	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
261594007369	substrate binding pocket [chemical binding]; other site
261594007370	membrane-bound complex binding site; other site
261594007371	hinge residues; other site
261594007372	ABC-type nitrate/sulfonate/bicarbonate transport system, ATPase component [Inorganic ion transport and metabolism]; Region: TauB; COG1116
261594007373	ATP-binding cassette domain of the nitrate and sulfonate transporters; Region: ABC_NrtD_SsuB_transporters; cd03293
261594007374	Walker A/P-loop; other site
261594007375	ATP binding site [chemical binding]; other site
261594007376	Q-loop/lid; other site
261594007377	ABC transporter signature motif; other site
261594007378	Walker B; other site
261594007379	D-loop; other site
261594007380	H-loop/switch region; other site
261594007381	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
261594007382	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
261594007383	Protein of unknown function (DUF402); Region: DUF402; pfam04167
261594007384	Contains a crystal structure of the Nudix hydrolase from Enterococcus faecalis, which has an unknown function. In general, members of the Nudix hydrolase superfamily catalyze the hydrolysis of NUcleoside DIphosphates linked to other moieties, X. Enzymes...; Region: Nudix_Hydrolase_25; cd04684
261594007385	nudix motif; other site
261594007386	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cl02429
261594007387	binding surface
261594007388	TPR motif; other site
261594007389	hypothetical protein; Provisional; Region: PRK09620
261594007390	Aminoglycoside 3-N-acetyltransferase; Region: Antibiotic_NAT; pfam02522
261594007391	Glutathionylspermidine synthase preATP-grasp; Region: GSP_synth; cl00503
261594007392	Acetyltransferase (GNAT) domain; Region: Acetyltransf_7; pfam13508
261594007393	Coenzyme A binding pocket [chemical binding]; other site
261594007394	Multidrug resistance efflux transporter; Region: EmrE; pfam13536
261594007395	DinB superfamily; Region: DinB_2; pfam12867
261594007396	Protein of unknown function (DUF664); Region: DUF664; pfam04978
261594007397	Acetyltransferase (GNAT) domain; Region: Acetyltransf_4; pfam13420
261594007398	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594007399	Coenzyme A binding pocket [chemical binding]; other site
261594007400	Acetyltransferase (GNAT) domain; Region: Acetyltransf_3; pfam13302
261594007401	Acetyltransferase (GNAT) family; Region: Acetyltransf_1; pfam00583
261594007402	Nucleotidyltransferase (NT) domain of Staphylococcus aureus kanamycin nucleotidyltransferase, and similar proteins; Region: NT_KNTase_like; cd05403
261594007403	active site
261594007404	NTP binding site [chemical binding]; other site
261594007405	metal binding triad [ion binding]; metal-binding site
261594007406	antibiotic binding site [chemical binding]; other site
261594007407	A new structural DNA glycosylase; Region: AlkD_like; cd06561
261594007408	active site
261594007409	delta-lactam-biosynthetic de-N-acetylase; Region: spore_pdaA; TIGR02884
261594007410	Catalytic NodB homology domain of Streptococcus mutans polysaccharide deacetylase PgdA, Bacillus subtilis YheN, and similar proteins; Region: CE4_SmPgdA_like; cd10944
261594007411	NodB motif; other site
261594007412	active site
261594007413	catalytic site [active]
261594007414	Zn binding site [ion binding]; other site
261594007415	Domain of unknown function (DUF3841); Region: DUF3841; pfam12952
261594007416	integral membrane protein, YjbE family; Region: R_switched_YjbE; TIGR03717
261594007417	Phosphoglycerol transferase and related proteins, alkaline phosphatase superfamily [Cell envelope biogenesis, outer membrane]; Region: MdoB; COG1368
261594007418	Sulfatase; Region: Sulfatase; pfam00884
261594007419	ABC transporter ATP-binding protein; Provisional; Region: PRK15064
261594007420	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
261594007421	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
261594007422	ABC transporter; Region: ABC_tran_2; pfam12848
261594007423	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
261594007424	hypothetical protein; Provisional; Region: PRK06761
261594007425	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
261594007426	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
261594007427	Predicted acetyltransferase involved in intracellular survival and related acetyltransferases [General function prediction only]; Region: Eis; COG4552
261594007428	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594007429	Coenzyme A binding pocket [chemical binding]; other site
261594007430	3-phosphoshikimate 1-carboxyvinyltransferase; Provisional; Region: PRK02427
261594007431	EPSP synthase domain. 3-phosphoshikimate 1-carboxyvinyltransferase (5-enolpyruvylshikimate-3-phosphate synthase) (EC 2.5.1.19) catalyses the reaction between shikimate-3-phosphate (S3P) and phosphoenolpyruvate (PEP) to form...; Region: EPSP_synthase; cd01556
261594007432	hinge; other site
261594007433	active site
261594007434	prephenate dehydrogenase; Validated; Region: PRK06545
261594007435	prephenate dehydrogenase; Validated; Region: PRK08507
261594007436	C-terminal ACT domain of the monofunctional, NAD dependent, prephenate dehydrogenase (PDH); Region: ACT_PDH-BS; cd04909
261594007437	histidinol-phosphate aminotransferase; Provisional; Region: PRK03158
261594007438	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
261594007439	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594007440	homodimer interface [polypeptide binding]; other site
261594007441	catalytic residue [active]
261594007442	Chorismate synthase [Amino acid transport and metabolism]; Region: AroC; COG0082
261594007443	Chorismase synthase, the enzyme catalyzing the final step of the shikimate pathway; Region: Chorismate_synthase; cd07304
261594007444	Tetramer interface [polypeptide binding]; other site
261594007445	active site
261594007446	FMN-binding site [chemical binding]; other site
261594007447	bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase; Reviewed; Region: PRK12595
261594007448	Chorismate mutase type II; Region: CM_2; cl00693
261594007449	phospho-2-dehydro-3-deoxyheptonate aldolase; Region: DAHP_synth_Bsub; TIGR01361
261594007450	Protein of unknown function (DUF2512); Region: DUF2512; pfam10710
261594007451	Isochorismatase family; Region: Isochorismatase; pfam00857
261594007452	Nicotinamidase_ related amidohydrolases.  Cysteine hydrolases of unknown function that share the catalytic triad with other amidohydrolases, like nicotinamidase, which converts nicotinamide to nicotinic acid and ammonia; Region: nicotinamidase_related; cd01014
261594007453	catalytic triad [active]
261594007454	conserved cis-peptide bond; other site
261594007455	Acetyltransferase (GNAT) domain; Region: Acetyltransf_3; pfam13302
261594007456	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594007457	Coenzyme A binding pocket [chemical binding]; other site
261594007458	YfzA-like protein; Region: YfzA; pfam14118
261594007459	hypothetical protein; Provisional; Region: PRK06762
261594007460	Bacterial SH3 domain; Region: SH3_3; pfam08239
261594007461	Bacterial SH3 domain; Region: SH3_3; pfam08239
261594007462	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3584
261594007463	RNA polymerase sigma factor, sigma-70 family; Region: sigma70-ECF; TIGR02937
261594007464	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
261594007465	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
261594007466	DNA binding residues [nucleotide binding]
261594007467	Uncharacterized protein conserved in bacteria (DUF2332); Region: DUF2332; pfam10094
261594007468	malate:quinone oxidoreductase; Validated; Region: PRK05257
261594007469	malate:quinone-oxidoreductase; Region: mal_quin_oxido; TIGR01320
261594007470	autoinducer 2-binding protein lsrB; Provisional; Region: PRK15408
261594007471	Periplasmic binding domain of autoinducer-2 (AI-2) receptor LsrB from Salmonella typhimurium and its close homologs; Region: PBP1_LsrB_Quorum_Sensing; cd06302
261594007472	ligand binding site [chemical binding]; other site
261594007473	Branched-chain amino acid transport system / permease component; Region: BPD_transp_2; pfam02653
261594007474	Transmembrane subunit (TM) of Escherichia coli AraH and related proteins. E. coli AraH is the TM of a Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporter involved in the uptake of the monosaccharide arabinose. This group...; Region: TM_PBP1_transp_AraH_like; cd06579
261594007475	TM-ABC transporter signature motif; other site
261594007476	Branched-chain amino acid transport system / permease component; Region: BPD_transp_2; pfam02653
261594007477	Transmembrane subunit (TM) of Escherichia coli AraH and related proteins. E. coli AraH is the TM of a Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporter involved in the uptake of the monosaccharide arabinose. This group...; Region: TM_PBP1_transp_AraH_like; cd06579
261594007478	TM-ABC transporter signature motif; other site
261594007479	First domain of the ATP-binding cassette component of monosaccharide transport system; Region: ABC_Carb_Monos_I; cd03216
261594007480	ABC-type sugar transport system, ATPase component [Carbohydrate transport and metabolism]; Region: MglA; COG1129
261594007481	Walker A/P-loop; other site
261594007482	ATP binding site [chemical binding]; other site
261594007483	Q-loop/lid; other site
261594007484	ABC transporter signature motif; other site
261594007485	Walker B; other site
261594007486	D-loop; other site
261594007487	H-loop/switch region; other site
261594007488	Second domain of the ATP-binding cassette component of monosaccharide transport system; Region: ABC_Carb_Monos_II; cd03215
261594007489	Transcriptional regulator, contains sigma factor-related N-terminal domain [Transcription]; Region: DeoR; COG2390
261594007490	Putative sugar-binding domain; Region: Sugar-bind; pfam04198
261594007491	Cupin domain; Region: Cupin_2; pfam07883
261594007492	DhnA-type fructose-1,6-bisphosphate aldolase and related enzymes [Carbohydrate transport and metabolism]; Region: FbaB; COG1830
261594007493	Class I fructose-1,6-bisphosphate (FBP) aldolases of the archaeal type (DhnA homologs); Region: DhnA; cd00958
261594007494	putative active site; other site
261594007495	catalytic residue [active]
261594007496	Acetyltransferase (GNAT) domain; Region: Acetyltransf_3; pfam13302
261594007497	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cl17182
261594007498	Uncharacterized enzyme involved in biosynthesis of extracellular polysaccharides [General function prediction only]; Region: COG2329
261594007499	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594007500	H+ Antiporter protein; Region: 2A0121; TIGR00900
261594007501	putative substrate translocation pore; other site
261594007502	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
261594007503	putative DNA binding site [nucleotide binding]; other site
261594007504	putative Zn2+ binding site [ion binding]; other site
261594007505	DinB superfamily; Region: DinB_2; pfam12867
261594007506	Nucleoside permease [Nucleotide transport and metabolism]; Region: NupC; COG1972
261594007507	Na+ dependent nucleoside transporter N-terminus; Region: Nucleos_tra2_N; pfam01773
261594007508	Na+ dependent nucleoside transporter C-terminus; Region: Nucleos_tra2_C; pfam07662
261594007509	Gamma-glutamyl phosphate reductase (GPR), aldehyde dehydrogenase families 18 and 19; Region: ALDH_F18-19_ProA-GPR; cd07079
261594007510	gamma-glutamyl phosphate reductase; Region: proA; TIGR00407
261594007511	putative catalytic cysteine [active]
261594007512	gamma-glutamyl kinase; Provisional; Region: PRK05429
261594007513	AAK_G5K_ProB: Glutamate-5-kinase (G5K) catalyzes glutamate-dependent ATP cleavage; G5K transfers the terminal phosphoryl group of ATP to the gamma-carboxyl group of glutamate, in the first and controlling step of proline (and, in mammals, ornithine)...; Region: AAK_G5K_ProB; cd04242
261594007514	nucleotide binding site [chemical binding]; other site
261594007515	homotetrameric interface [polypeptide binding]; other site
261594007516	putative phosphate binding site [ion binding]; other site
261594007517	putative allosteric binding site; other site
261594007518	PUA domain; Region: PUA; pfam01472
261594007519	pyrroline-5-carboxylate reductase; Reviewed; Region: PRK12491
261594007520	pyrroline-5-carboxylate reductase; Reviewed; Region: PRK11880
261594007521	Acetylornithine deacetylase/Succinyl-diaminopimelate desuccinylase and related deacylases [Amino acid transport and metabolism]; Region: ArgE; COG0624
261594007522	M20 Peptidase Arginine utilization protein, RocB; Region: M20_ArgE_RocB; cd05654
261594007523	putative metal binding site [ion binding]; other site
261594007524	putative dimer interface [polypeptide binding]; other site
261594007525	helix_turn_helix isocitrate lyase regulation; Region: HTH_ICLR; smart00346
261594007526	Transcriptional regulator [Transcription]; Region: IclR; COG1414
261594007527	Bacterial transcriptional regulator; Region: IclR; pfam01614
261594007528	S-methylmethionine transporter; Provisional; Region: PRK11387
261594007529	Uncharacterized protein family UPF0027; Region: UPF0027; pfam01139
261594007530	The Delta12 Fatty Acid Desaturase (Delta12-FADS)-like CD includes the integral-membrane enzymes, delta-12 acyl-lipid desaturases, oleate 12-hydroxylases, omega3 and omega6 fatty acid desaturases, and other related proteins, found in a wide range of...; Region: Delta12-FADS-like; cd03507
261594007531	Fatty acid desaturase; Region: FA_desaturase; pfam00487
261594007532	putative di-iron ligands [ion binding]; other site
261594007533	Alkaline phosphatase [Inorganic ion transport and metabolism]; Region: PhoA; COG1785
261594007534	Alkaline phosphatase homologues; alkaline phosphatases are non-specific phosphomonoesterases that catalyze the hydrolysis reaction via a phosphoseryl intermediate to produce inorganic phosphate and the corresponding alcohol, optimally at high pH; Region: alkPPc; cd00016
261594007535	dimer interface [polypeptide binding]; other site
261594007536	active site
261594007537	Protein of unknown function (DUF3036); Region: DUF3036; pfam11234
261594007538	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
261594007539	salt bridge; other site
261594007540	non-specific DNA binding site [nucleotide binding]; other site
261594007541	sequence-specific DNA binding site [nucleotide binding]; other site
261594007542	Protein of unknown function (DUF3887); Region: DUF3887; pfam13026
261594007543	Putative membrane peptidase family (DUF2324); Region: DUF2324; pfam10086
261594007544	Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase; Region: HATPase_c; pfam02518
261594007545	Response regulator of the LytR/AlgR family [Transcription / Signal transduction mechanisms]; Region: LytT; COG3279
261594007546	LytTr DNA-binding domain; Region: LytTR; pfam04397
261594007547	uridine kinase; Provisional; Region: PRK07667
261594007548	Acetyltransferase (GNAT) domain; Region: Acetyltransf_3; pfam13302
261594007549	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594007550	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cl17182
261594007551	Coenzyme A binding pocket [chemical binding]; other site
261594007552	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
261594007553	This domain superfamily is found in a variety of structurally related metalloproteins, including the type I extradiol dioxygenases, glyoxalase I and a group of antibiotic resistance proteins; Region: Glo_EDI_BRP_like; cd06587
261594007554	active site
261594007555	metal binding site [ion binding]; metal-binding site
261594007556	Protein of unknown function (DUF2812); Region: DUF2812; pfam11193
261594007557	Predicted transcriptional regulators [Transcription]; Region: COG1695
261594007558	Transcriptional regulator PadR-like family; Region: PadR; pfam03551
261594007559	MoxR-like ATPases [General function prediction only]; Region: COG0714
261594007560	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
261594007561	Walker A motif; other site
261594007562	ATP binding site [chemical binding]; other site
261594007563	Walker B motif; other site
261594007564	arginine finger; other site
261594007565	Uncharacterized conserved protein (some members contain a von Willebrand factor type A (vWA) domain) [General function prediction only]; Region: COG1721
261594007566	Protein of unknown function DUF58; Region: DUF58; pfam01882
261594007567	proline/glycine betaine transporter; Provisional; Region: PRK10642
261594007568	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594007569	putative substrate translocation pore; other site
261594007570	Glycosyltransferase family A (GT-A) includes diverse families of glycosyl transferases with a common GT-A type structural fold; Region: Glyco_tranf_GTA_type; cl11394
261594007571	active site
261594007572	Glycosyltransferase family A (GT-A) includes diverse families of glycosyl transferases with a common GT-A type structural fold; Region: Glyco_tranf_GTA_type; cl11394
261594007573	active site
261594007574	Glycosyltransferase family A (GT-A) includes diverse families of glycosyl transferases with a common GT-A type structural fold; Region: Glyco_tranf_GTA_type; cl11394
261594007575	active site
261594007576	DPM_DPG-synthase_like is a member of the Glycosyltransferase 2 superfamily; Region: DPM_DPG-synthase_like; cd04179
261594007577	Ligand binding site; other site
261594007578	Putative Catalytic site; other site
261594007579	DXD motif; other site
261594007580	acetylornithine aminotransferase; Provisional; Region: PRK02627
261594007581	Acetyl ornithine aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to ornithine aminotransferase, acetylornithine aminotransferase; Region: OAT_like; cd00610
261594007582	inhibitor-cofactor binding pocket; inhibition site
261594007583	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594007584	catalytic residue [active]
261594007585	Clade 1 of the heme-binding enzyme catalase; Region: catalase_clade_1; cd08154
261594007586	Catalase [Inorganic ion transport and metabolism]; Region: KatE; COG0753
261594007587	tetramer interface [polypeptide binding]; other site
261594007588	heme binding pocket [chemical binding]; other site
261594007589	Adenine deaminase [Nucleotide transport and metabolism]; Region: AdeC; COG1001
261594007590	Superfamily of metallo-dependent hydrolases (also called amidohydrolase superfamily) is a large group of proteins that show conservation in their 3-dimensional fold (TIM barrel) and in details of their active site. The vast majority of the members have a...; Region: metallo-dependent_hydrolases; cl00281
261594007591	Adenine deaminase (AdeC) directly deaminates adenine to form hypoxanthine. This reaction is part of one of the adenine salvage pathways, as well as the degradation pathway. It is important for adenine utilization as a purine, as well as a nitrogen source...; Region: AdeC; cd01295
261594007592	active site
261594007593	Adenine deaminase C-terminal domain; Region: Adenine_deam_C; pfam13382
261594007594	Beta-lactamase class C and other penicillin binding proteins [Defense mechanisms]; Region: AmpC; COG1680
261594007595	Beta-lactamase; Region: Beta-lactamase; pfam00144
261594007596	Protein of unknown function (DUF3902); Region: DUF3902; pfam13042
261594007597	Uncharacterized conserved protein (some members contain a von Willebrand factor type A (vWA) domain) [General function prediction only]; Region: COG1721
261594007598	Protein of unknown function DUF58; Region: DUF58; pfam01882
261594007599	MoxR-like ATPases [General function prediction only]; Region: COG0714
261594007600	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
261594007601	Walker A motif; other site
261594007602	ATP binding site [chemical binding]; other site
261594007603	Walker B motif; other site
261594007604	arginine finger; other site
261594007605	Uncharacterized conserved protein [Function unknown]; Region: COG1359
261594007606	Nitroreductase-like family 1. A subfamily of the nitroreductase family containing uncharacterized proteins that are similar to nitroreductase. Nitroreductase catalyzes the reduction of nitroaromatic compounds such as nitrotoluenes, nitrofurans and...; Region: Nitroreductase_1; cd02137
261594007607	dimer interface [polypeptide binding]; other site
261594007608	FMN binding site [chemical binding]; other site
261594007609	helix_turn_helix multiple antibiotic resistance protein; Region: HTH_MARR; smart00347
261594007610	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
261594007611	putative DNA binding site [nucleotide binding]; other site
261594007612	putative Zn2+ binding site [ion binding]; other site
261594007613	Translation elongation factors (GTPases) [Translation, ribosomal structure and biogenesis]; Region: FusA; COG0480
261594007614	Tet(M)-like family includes Tet(M), Tet(O), Tet(W), and OtrA, containing tetracycline resistant proteins; Region: TetM_like; cd04168
261594007615	G1 box; other site
261594007616	putative GEF interaction site [polypeptide binding]; other site
261594007617	GTP/Mg2+ binding site [chemical binding]; other site
261594007618	Switch I region; other site
261594007619	G2 box; other site
261594007620	G3 box; other site
261594007621	Switch II region; other site
261594007622	G4 box; other site
261594007623	G5 box; other site
261594007624	Tet_II: This subfamily represents domain II of ribosomal protection proteins Tet(M) and Tet(O). This domain has homology to domain II of the elongation factors EF-G and EF-2. Tet(M) and Tet(O) catalyze the release of tetracycline (Tc) from the ribosome...; Region: Tet_II; cd03690
261594007625	EF-G_domain IV_RPP domain is a part of bacterial ribosomal protected proteins (RPP) family. RPPs such as tetracycline resistance proteins Tet(M) and Tet(O) mediate tetracycline resistance in both gram-positive and -negative species. Tetracyclines inhibit...; Region: Tet_like_IV; cd01684
261594007626	Tet_C: C-terminus of ribosomal protection proteins Tet(M) and Tet(O). This domain has homology to the C terminal domains of the elongation factors EF-G and EF-2. Tet(M) and Tet(O) catalyze the release of tetracycline (Tc) from the ribosome in a...; Region: Tet_C; cd03711
261594007627	Members of the Nudix hydrolase superfamily catalyze the hydrolysis of NUcleoside DIphosphates linked to other moieties, X. Enzymes belonging to this superfamily require a divalent cation, such as Mg2+ or Mn2+, for their activity and contain a highly...; Region: Nudix_Hydrolase_29; cd04688
261594007628	nudix motif; other site
261594007629	YfzA-like protein; Region: YfzA; pfam14118
261594007630	ABC-2 family transporter protein; Region: ABC2_membrane_5; pfam13346
261594007631	ABC-type multidrug transport system, ATPase component [Defense mechanisms]; Region: CcmA; COG1131
261594007632	ATP-binding cassette domain of the drug resistance transporter and related proteins, subfamily A; Region: ABC_DR_subfamily_A; cd03230
261594007633	Walker A/P-loop; other site
261594007634	ATP binding site [chemical binding]; other site
261594007635	Q-loop/lid; other site
261594007636	ABC transporter signature motif; other site
261594007637	Walker B; other site
261594007638	D-loop; other site
261594007639	H-loop/switch region; other site
261594007640	Predicted transcriptional regulators [Transcription]; Region: COG1725
261594007641	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
261594007642	DNA-binding site [nucleotide binding]; DNA binding site
261594007643	atypical (a) SDRs, subgroup 1; Region: SDR_a1; cd05265
261594007644	NAD dependent epimerase/dehydratase family; Region: Epimerase; pfam01370
261594007645	putative NAD(P) binding site [chemical binding]; other site
261594007646	active site
261594007647	ABC-type antimicrobial peptide transport system, ATPase component [Defense mechanisms]; Region: SalX; COG1136
261594007648	ATP-binding cassette domain of the transporters involved in export of lipoprotein and macrolide, and cell division protein; Region: ABC_MJ0796_LolCDE_FtsE; cd03255
261594007649	Walker A/P-loop; other site
261594007650	ATP binding site [chemical binding]; other site
261594007651	Q-loop/lid; other site
261594007652	ABC transporter signature motif; other site
261594007653	Walker B; other site
261594007654	D-loop; other site
261594007655	H-loop/switch region; other site
261594007656	MacB-like periplasmic core domain; Region: MacB_PCD; pfam12704
261594007657	FtsX-like permease family; Region: FtsX; pfam02687
261594007658	FtsX-like permease family; Region: FtsX; pfam02687
261594007659	Beta-lactamase class C and other penicillin binding proteins [Defense mechanisms]; Region: AmpC; COG1680
261594007660	Beta-lactamase; Region: Beta-lactamase; pfam00144
261594007661	helix_turn_helix, arabinose operon control protein; Region: HTH_ARAC; smart00342
261594007662	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
261594007663	DNA gyrase inhibitor [DNA replication, recombination, and repair]; Region: COG3449
261594007664	Acetyltransferase (GNAT) domain; Region: Acetyltransf_10; pfam13673
261594007665	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594007666	Coenzyme A binding pocket [chemical binding]; other site
261594007667	Domain of unknown function (DUF3980); Region: DUF3980; pfam13140
261594007668	Contains a crystal structure of the Nudix hydrolase from Enterococcus faecalis, which has an unknown function. In general, members of the Nudix hydrolase superfamily catalyze the hydrolysis of NUcleoside DIphosphates linked to other moieties, X. Enzymes...; Region: Nudix_Hydrolase_25; cd04684
261594007669	nudix motif; other site
261594007670	EamA-like transporter family; Region: EamA; pfam00892
261594007671	Carboxylate/Amino Acid/Amine Transporter; Region: 2A78; TIGR00950
261594007672	EamA-like transporter family; Region: EamA; pfam00892
261594007673	Transcriptional regulators containing a DNA-binding HTH domain and an aminotransferase domain (MocR family) and their eukaryotic orthologs [Transcription / Amino acid transport and metabolism]; Region: ARO8; COG1167
261594007674	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
261594007675	DNA-binding site [nucleotide binding]; DNA binding site
261594007676	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
261594007677	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594007678	homodimer interface [polypeptide binding]; other site
261594007679	catalytic residue [active]
261594007680	hypothetical protein; Validated; Region: PRK00124
261594007681	Protein of unknown function (DUF3892); Region: DUF3892; pfam13031
261594007682	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
261594007683	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cl00080
261594007684	phosphorylation site [posttranslational modification]
261594007685	dimer interface [polypeptide binding]; other site
261594007686	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594007687	ATP binding site [chemical binding]; other site
261594007688	Mg2+ binding site [ion binding]; other site
261594007689	G-X-G motif; other site
261594007690	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
261594007691	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594007692	active site
261594007693	phosphorylation site [posttranslational modification]
261594007694	intermolecular recognition site; other site
261594007695	dimerization interface [polypeptide binding]; other site
261594007696	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
261594007697	DNA binding site [nucleotide binding]
261594007698	Alpha/beta hydrolase family; Region: Abhydrolase_6; pfam12697
261594007699	Novel bacterial esterase that cleaves esters on halogenated cyclic compounds; Region: Esterase_713_like; cl17303
261594007700	Protein of unknown function (DUF2785); Region: DUF2785; pfam10978
261594007701	uridine kinase; Validated; Region: PRK06696
261594007702	active site
261594007703	Calcineurin-like phosphoesterase superfamily domain; Region: Metallophos_2; pfam12850
261594007704	Calcineurin-like phosphoesterase; Region: Metallophos; pfam00149
261594007705	active site
261594007706	metal binding site [ion binding]; metal-binding site
261594007707	Phosphotransferase enzyme family; Region: APH; pfam01636
261594007708	Aminoglycoside 3'-phosphotransferase (APH) and Choline Kinase (ChoK) family. The APH/ChoK family is part of a larger superfamily that includes the catalytic domains of other kinases, such as the typical serine/threonine/tyrosine protein kinases (PKs)...; Region: APH_ChoK_like; cl17270
261594007709	active site
261594007710	substrate binding site [chemical binding]; other site
261594007711	ATP binding site [chemical binding]; other site
261594007712	Glyoxalase-like domain; Region: Glyoxalase_3; pfam13468
261594007713	Sulfite exporter TauE/SafE; Region: TauE; pfam01925
261594007714	Acetyltransferase (GNAT) domain; Region: Acetyltransf_3; pfam13302
261594007715	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594007716	Coenzyme A binding pocket [chemical binding]; other site
261594007717	lysine transporter; Provisional; Region: PRK10836
261594007718	DNA alkylation repair enzyme [DNA replication, recombination, and repair]; Region: COG4335
261594007719	Protein of unknown function (DUF2716); Region: DUF2716; pfam10898
261594007720	Methyltransferase domain; Region: Methyltransf_23; pfam13489
261594007721	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594007722	S-adenosylmethionine binding site [chemical binding]; other site
261594007723	Cephalosporin hydroxylase; Region: CmcI; pfam04989
261594007724	signal peptidase I, bacterial type; Region: sigpep_I_bact; TIGR02227
261594007725	The S26 Type I signal peptidase (SPase; LepB; leader peptidase B; leader peptidase I; EC 3.4.21.89) family members are essential membrane-bound serine proteases that function to cleave the amino-terminal signal peptide extension from proteins that are...; Region: S26_SPase_I; cd06530
261594007726	Catalytic site [active]
261594007727	NAD-dependent deacetylase; Provisional; Region: PRK00481
261594007728	SIR2_Af2: Archaeal and prokaryotic group which includes Archaeoglobus fulgidus Sir2-Af2, Sulfolobus solfataricus ssSir2, and several bacterial homologs; and are members of the SIR2 family of proteins, silent information regulator 2 (Sir2) enzymes which...; Region: SIR2_Af2; cd01413
261594007729	NAD+ binding site [chemical binding]; other site
261594007730	substrate binding site [chemical binding]; other site
261594007731	Zn binding site [ion binding]; other site
261594007732	Pyroglutamyl peptidase (PGP) type I, also known as pyrrolidone carboxyl peptidase (pcp) type I:  Enzymes responsible for cleaving pyroglutamate (pGlu) from the N-terminal end of specialized proteins. The N-terminal pGlu protects these proteins from...; Region: Peptidase_C15; cd00501
261594007733	putative substrate binding pocket [chemical binding]; other site
261594007734	AC domain interface; other site
261594007735	catalytic triad [active]
261594007736	AB domain interface; other site
261594007737	interchain disulfide; other site
261594007738	Predicted membrane protein [Function unknown]; Region: COG3817
261594007739	Protein of unknown function (DUF979); Region: DUF979; pfam06166
261594007740	Protein of unknown function (DUF969); Region: DUF969; pfam06149
261594007741	LamB/YcsF family of  lactam utilization protein; Region: LamB_YcsF_like; cd10787
261594007742	putative active site [active]
261594007743	Allophanate hydrolase subunit 2; Region: AHS2; smart00797
261594007744	Allophanate hydrolase subunit 1; Region: AHS1; pfam02682
261594007745	Allophanate hydrolase subunit 1 [Amino acid transport and metabolism]; Region: DUR1; COG2049
261594007746	Transcriptional regulator [Transcription]; Region: IclR; COG1414
261594007747	helix_turn_helix isocitrate lyase regulation; Region: HTH_ICLR; smart00346
261594007748	Bacterial transcriptional regulator; Region: IclR; pfam01614
261594007749	signal peptidase I, bacterial type; Region: sigpep_I_bact; TIGR02227
261594007750	The S26 Type I signal peptidase (SPase; LepB; leader peptidase B; leader peptidase I; EC 3.4.21.89) family members are essential membrane-bound serine proteases that function to cleave the amino-terminal signal peptide extension from proteins that are...; Region: S26_SPase_I; cd06530
261594007751	Catalytic site [active]
261594007752	CutC family; Region: CutC; cl01218
261594007753	Stage II sporulation protein P (SpoIIP); Region: SpoIIP; pfam07454
261594007754	stage II sporulation protein P; Region: spore_II_P; TIGR02867
261594007755	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
261594007756	dimerization interface [polypeptide binding]; other site
261594007757	putative DNA binding site [nucleotide binding]; other site
261594007758	putative Zn2+ binding site [ion binding]; other site
261594007759	DinB superfamily; Region: DinB_2; pfam12867
261594007760	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
261594007761	Acyl-CoA dehydrogenase; Region: ACAD; cl09933
261594007762	Acyl-CoA dehydrogenase; Region: ACAD; cd00567
261594007763	Uncharacterized conserved protein [Function unknown]; Region: COG1434
261594007764	YdcF-like. YdcF-like is a large family of mainly bacterial proteins, with a few members found in fungi, plants, and archaea. Escherichia coli YdcF has been shown to bind S-adenosyl-L-methionine (AdoMet), but a biochemical function has not been...; Region: YdcF-like; cd06259
261594007765	putative active site [active]
261594007766	Acetyltransferases, including N-acetylases of ribosomal proteins [Translation, ribosomal structure and biogenesis]; Region: RimL; COG1670
261594007767	Acetyltransferase (GNAT) family; Region: Acetyltransf_1; pfam00583
261594007768	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3314
261594007769	Nucleoside recognition; Region: Gate; pfam07670
261594007770	Uncharacterized bacterial proteins with similarity to Aminoglycoside 3'-phosphotransferase (APH) and Choline kinase (ChoK) family members. The APH/ChoK subfamily is part of a larger superfamily that includes the catalytic domains of other kinases; Region: APH_ChoK_like_1; cd05155
261594007771	Phosphotransferase enzyme family; Region: APH; pfam01636
261594007772	putative active site [active]
261594007773	putative substrate binding site [chemical binding]; other site
261594007774	ATP binding site [chemical binding]; other site
261594007775	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594007776	Coenzyme A binding pocket [chemical binding]; other site
261594007777	Uncharacterized conserved protein [Function unknown]; Region: COG1633
261594007778	Ferritin-like superfamily of diiron-containing four-helix-bundle proteins; Region: Ferritin_like; cd00657
261594007779	dinuclear metal binding motif [ion binding]; other site
261594007780	YhgE/Pip N-terminal domain; Region: pip_yhgE_Nterm; TIGR03061
261594007781	YhgE/Pip C-terminal domain; Region: pip_yhgE_Cterm; TIGR03062
261594007782	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
261594007783	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
261594007784	Transcriptional regulator C-terminal region; Region: TetR_C_8; pfam14278
261594007785	phosphoenolpyruvate synthase; Validated; Region: PRK06241
261594007786	Pyruvate phosphate dikinase, PEP/pyruvate binding domain; Region: PPDK_N; pfam01326
261594007787	PEP-utilising enzyme, mobile domain; Region: PEP-utilizers; pfam00391
261594007788	Metallo-beta-lactamase superfamily; Region: Lactamase_B; smart00849
261594007789	Cytochrome c oxidase caa3 assembly factor (Caa3_CtaG); Region: Caa3_CtaG; pfam09678
261594007790	Predicted membrane protein (DUF2243); Region: DUF2243; pfam10002
261594007791	Spore coat protein [Cell envelope biogenesis, outer membrane]; Region: COG5577
261594007792	YqcI/YcgG family; Region: YqcI_YcgG; pfam08892
261594007793	LysE type translocator; Region: LysE; pfam01810
261594007794	Small, acid-soluble spore proteins, alpha/beta type; Region: SASP; pfam00269
261594007795	Protein of unknown function (DUF2512); Region: DUF2512; pfam10710
261594007796	Protein of unknown function (DUF3231); Region: DUF3231; pfam11553
261594007797	Small, acid-soluble spore proteins, alpha/beta type; Region: SASP; pfam00269
261594007798	Glutathione-dependent formaldehyde dehydrogenase related proteins, child 1; Region: FDH_like_1; cd08283
261594007799	Threonine dehydrogenase and related Zn-dependent dehydrogenases [Amino acid transport and metabolism / General function prediction only]; Region: Tdh; COG1063
261594007800	NAD binding site [chemical binding]; other site
261594007801	catalytic Zn binding site [ion binding]; other site
261594007802	structural Zn binding site [ion binding]; other site
261594007803	Asp/Glu/Hydantoin racemase; Region: Asp_Glu_race; cl00518
261594007804	Manganese catalase, ferritin-like diiron-binding domain; Region: Mn_catalase; cd01051
261594007805	dimanganese center [ion binding]; other site
261594007806	aspartate ammonia-lyase; Provisional; Region: PRK14515
261594007807	Aspartase; Region: Aspartase; cd01357
261594007808	active sites [active]
261594007809	tetramer interface [polypeptide binding]; other site
261594007810	Type I (cytosolic) bacterial L-asparaginase; Region: L-asparaginase_I; cd08963
261594007811	active site
261594007812	homodimer interface [polypeptide binding]; other site
261594007813	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
261594007814	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
261594007815	non-specific DNA binding site [nucleotide binding]; other site
261594007816	salt bridge; other site
261594007817	sequence-specific DNA binding site [nucleotide binding]; other site
261594007818	Catalytic GIY-YIG domain of nucleotide excision repair endonucleases UvrC, Cho, and similar proteins; Region: GIY-YIG_UvrC_Cho; cd10434
261594007819	GIY-YIG motif/motif A; other site
261594007820	active site
261594007821	catalytic site [active]
261594007822	putative DNA binding site [nucleotide binding]; other site
261594007823	metal binding site [ion binding]; metal-binding site
261594007824	amino acid transporter; Region: 2A0306; TIGR00909
261594007825	Spore germination protein; Region: Spore_permease; cl17796
261594007826	C-terminus of AA_permease; Region: AA_permease_C; pfam13906
261594007827	Branched-chain amino acid transport protein; Region: Branch_AA_trans; pfam05525
261594007828	pyrroline-5-carboxylate reductase; Reviewed; Region: PRK12491
261594007829	pyrroline-5-carboxylate reductase; Reviewed; Region: PRK11880
261594007830	DoxX-like family; Region: DoxX_2; pfam13564
261594007831	Malic enzyme [Energy production and conversion]; Region: SfcA; COG0281
261594007832	Malic enzyme, N-terminal domain; Region: malic; pfam00390
261594007833	NAD(P) binding domain of malic enzyme (ME), subgroup 2; Region: NAD_bind_2_malic_enz; cd05311
261594007834	putative NAD(P) binding site [chemical binding]; other site
261594007835	Bacillus/Clostridium GerA spore germination protein; Region: GerA; pfam03323
261594007836	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594007837	Response regulator receiver domain; Region: Response_reg; pfam00072
261594007838	active site
261594007839	phosphorylation site [posttranslational modification]
261594007840	intermolecular recognition site; other site
261594007841	dimerization interface [polypeptide binding]; other site
261594007842	YcbB domain; Region: YcbB; pfam08664
261594007843	glutaminase; Reviewed; Region: PRK12357
261594007844	Glutaminase [Amino acid transport and metabolism]; Region: GlsA; COG2066
261594007845	Putative anion permease YbiR.  Based on sequence similarity, YbiR proteins are predicted to function as anion translocating permeases in eubacteria, archaea and plants. They belong to ArsB/NhaD superfamily of permeases that have been shown to translocate...; Region: YbiR_permease; cd01117
261594007846	transmembrane helices; other site
261594007847	Zinc-dependent metalloprotease. This super-family of metalloproteases contains two major branches, the astacin-like proteases and the adamalysin/reprolysin-like proteases. Both branches have wide phylogenetic distribution, and contain sub-families, which...; Region: ZnMc; cl00064
261594007848	Zinc-dependent metalloprotease. This super-family of metalloproteases contains two major branches, the astacin-like proteases and the adamalysin/reprolysin-like proteases. Both branches have wide phylogenetic distribution, and contain sub-families, which...; Region: ZnMc; cl00064
261594007849	active site
261594007850	active site
261594007851	5'-nucleotidase/2',3'-cyclic phosphodiesterase and related esterases [Nucleotide transport and metabolism]; Region: UshA; COG0737
261594007852	Bacillus subtilis YhcR endonuclease and related proteins, N-terminal metallophosphatase domain; Region: MPP_YhcR_N; cd07412
261594007853	putative active site [active]
261594007854	putative metal binding site [ion binding]; other site
261594007855	5'-nucleotidase, C-terminal domain; Region: 5_nucleotid_C; pfam02872
261594007856	Catalase [Inorganic ion transport and metabolism]; Region: KatE; COG0753
261594007857	Clade 1 of the heme-binding enzyme catalase; Region: catalase_clade_1; cd08154
261594007858	tetramer interface [polypeptide binding]; other site
261594007859	heme binding pocket [chemical binding]; other site
261594007860	Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596
261594007861	Putative lysophospholipase; Region: Hydrolase_4; pfam12146
261594007862	TAP-like protein; Region: Abhydrolase_4; pfam08386
261594007863	Isochorismatase family; Region: Isochorismatase; pfam00857
261594007864	YcaC related amidohydrolases; E.coli YcaC is an homooctameric hydrolase with unknown specificity. Despite its weak sequence similarity, it is structurally related to other amidohydrolases and shares conserved active site residues with them; Region: YcaC_related; cd01012
261594007865	catalytic triad [active]
261594007866	dimer interface [polypeptide binding]; other site
261594007867	conserved cis-peptide bond; other site
261594007868	Isochorismatase family; Region: Isochorismatase; pfam00857
261594007869	YcaC related amidohydrolases; E.coli YcaC is an homooctameric hydrolase with unknown specificity. Despite its weak sequence similarity, it is structurally related to other amidohydrolases and shares conserved active site residues with them; Region: YcaC_related; cd01012
261594007870	catalytic triad [active]
261594007871	dimer interface [polypeptide binding]; other site
261594007872	conserved cis-peptide bond; other site
261594007873	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3224
261594007874	Transcriptional regulator [Transcription]; Region: LysR; COG0583
261594007875	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
261594007876	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cd05466
261594007877	dimerization interface [polypeptide binding]; other site
261594007878	Plasmid segregation protein ParM and similar proteins; Region: ParM_like; cd10227
261594007879	Mg binding site [ion binding]; other site
261594007880	nucleotide binding site [chemical binding]; other site
261594007881	putative protofilament interface [polypeptide binding]; other site
261594007882	Heat induced stress protein YflT; Region: YflT; pfam11181
261594007883	Protein of unknown function (DUF1093); Region: DUF1093; pfam06486
261594007884	Alpha/beta hydrolase family; Region: Abhydrolase_5; pfam12695
261594007885	Lipase.  Lipases are esterases that can hydrolyze long-chain acyl-triglycerides into di- and monoglycerides, glycerol, and free fatty acids at a water/lipid interface. A typical feature of lipases is "interfacial activation", the process of...; Region: Lipase; cl14883
261594007886	TspO/MBR family; Region: TspO_MBR; pfam03073
261594007887	Deoxyribodipyrimidine photolyase [DNA replication, recombination, and repair]; Region: PhrB; COG0415
261594007888	DNA photolyase; Region: DNA_photolyase; pfam00875
261594007889	Carbonic anhydrases (CA) are zinc-containing enzymes that catalyze the reversible hydration of carbon dioxide in a two-step mechanism in which the nucleophilic attack of a zinc-bound hydroxide ion on carbon dioxide is followed by the regeneration of an...; Region: beta_CA; cl00391
261594007890	zinc binding site [ion binding]; other site
261594007891	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3002
261594007892	Uncharacterized protein conserved in bacteria (DUF2309); Region: DUF2309; pfam10070
261594007893	NADH dehydrogenase subunit 5; Validated; Region: PRK08601
261594007894	NADH-Ubiquinone/plastoquinone (complex I), various chains; Region: Oxidored_q1; pfam00361
261594007895	Uncharacterized conserved protein (DUF2294); Region: DUF2294; pfam10057
261594007896	Acetyltransferases [General function prediction only]; Region: RimI; COG0456
261594007897	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594007898	Coenzyme A binding pocket [chemical binding]; other site
261594007899	1,4-dihydroxy-2-naphthoate octaprenyltransferase; Provisional; Region: PRK13387
261594007900	UbiA prenyltransferase family; Region: UbiA; pfam01040
261594007901	Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596
261594007902	Novel bacterial esterase that cleaves esters on halogenated cyclic compounds; Region: Esterase_713_like; cl17303
261594007903	ABC-type metal ion transport system, periplasmic component/surface adhesin [Inorganic ion transport and metabolism]; Region: LraI; COG0803
261594007904	Metal binding protein PsaA.  These proteins have been shown to function as initial receptors in ABC transport of Mn2+ and as surface adhesins in some eubacterial species.  They belong to the TroA superfamily of periplasmic metal binding proteins that...; Region: PsaA; cd01137
261594007905	metal binding site [ion binding]; metal-binding site
261594007906	ABC-type Mn2+/Zn2+ transport systems, permease components [Inorganic ion transport and metabolism]; Region: ZnuB; COG1108
261594007907	Transmembrane subunit (TM), of Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters involved in the uptake of siderophores, heme, vitamin B12, or the divalent cations Mg2+ and Zn2+. PBP-dependent ABC transporters consist of...; Region: TM_ABC_iron-siderophores_like; cd06550
261594007908	ABC-ATPase subunit  interface; other site
261594007909	dimer interface [polypeptide binding]; other site
261594007910	putative PBP binding regions; other site
261594007911	ABC-type Mn/Zn transport systems, ATPase component [Inorganic ion transport and metabolism]; Region: ZnuC; COG1121
261594007912	ATP-binding cassette domain of the metal-type transporters; Region: ABC_Metallic_Cations; cd03235
261594007913	DJ-1 family protein; Region: not_thiJ; TIGR01383
261594007914	Type 1 glutamine amidotransferase (GATase1)-like domain found in a subgroup of proteins similar to PfpI from Pyrococcus furiosus; Region: GATase1_PfpI_2; cd03139
261594007915	conserved cys residue [active]
261594007916	Phosphotransferase enzyme family; Region: APH; pfam01636
261594007917	Aminoglycoside 3'-phosphotransferase (APH) and Choline Kinase (ChoK) family. The APH/ChoK family is part of a larger superfamily that includes the catalytic domains of other kinases, such as the typical serine/threonine/tyrosine protein kinases (PKs)...; Region: APH_ChoK_like; cl17270
261594007918	active site
261594007919	ATP binding site [chemical binding]; other site
261594007920	GNAT acetyltransferase; Region: GNAT_acetyltran; pfam12746
261594007921	Protein-tyrosine-phosphatase [Signal transduction mechanisms]; Region: Wzb; COG0394
261594007922	Low molecular weight phosphatase family; Region: LMWPc; cd00115
261594007923	active site
261594007924	Arsenite efflux pump ACR3 and related permeases [Inorganic ion transport and metabolism]; Region: ACR3; COG0798
261594007925	arsenical-resistance protein; Region: acr3; TIGR00832
261594007926	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
261594007927	This conserved domain belongs to a superfamily including the bleomycin resistance protein, glyoxalase I, and type I ring-cleaving dioxygenases; Region: Glo_EDI_BRP_like_20; cd07254
261594007928	putative metal binding site [ion binding]; other site
261594007929	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
261594007930	dimerization interface [polypeptide binding]; other site
261594007931	putative DNA binding site [nucleotide binding]; other site
261594007932	putative Zn2+ binding site [ion binding]; other site
261594007933	Protein of unknown function (DUF1266); Region: DUF1266; pfam06889
261594007934	DnaJ domain; Region: DnaJ; pfam00226
261594007935	HSP70 interaction site [polypeptide binding]; other site
261594007936	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cd00189
261594007937	binding surface
261594007938	TPR motif; other site
261594007939	TPR repeat; Region: TPR_11; pfam13414
261594007940	Molecular chaperone [Posttranslational modification, protein turnover, chaperones]; Region: DnaK; COG0443
261594007941	Nucleotide-binding domain of Escherichia coli HscC and similar proteins; Region: HscC_like_NBD; cd10235
261594007942	nucleotide binding site [chemical binding]; other site
261594007943	putative NEF/HSP70 interaction site [polypeptide binding]; other site
261594007944	SBD interface [polypeptide binding]; other site
261594007945	short chain dehydrogenase; Provisional; Region: PRK12746
261594007946	tetrahydroxynaphthalene/trihydroxynaphthalene reductase-like, classical (c) SDRs; Region: THN_reductase-like_SDR_c; cd05362
261594007947	NADP binding site [chemical binding]; other site
261594007948	homodimer interface [polypeptide binding]; other site
261594007949	active site
261594007950	substrate binding site [chemical binding]; other site
261594007951	helix_turn_helix ASNC type; Region: HTH_ASNC; smart00344
261594007952	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
261594007953	putative DNA binding site [nucleotide binding]; other site
261594007954	putative Zn2+ binding site [ion binding]; other site
261594007955	AsnC family; Region: AsnC_trans_reg; pfam01037
261594007956	M20 Peptidase Aminoacylase 1-like protein 2-like, amidohydrolase subfamily; Region: M20_ACY1L2_like; cd05672
261594007957	Metal-dependent amidase/aminoacylase/carboxypeptidase [General function prediction only]; Region: AbgB; COG1473
261594007958	metal binding site [ion binding]; metal-binding site
261594007959	AAA domain; Region: AAA_11; pfam13086
261594007960	Part of AAA domain; Region: AAA_19; pfam13245
261594007961	Erp protein C-terminus; Region: Erp_C; pfam06780
261594007962	AAA domain; Region: AAA_30; pfam13604
261594007963	AAA domain; Region: AAA_12; pfam13087
261594007964	Catalytic domain of phospholipase D superfamily proteins; Region: PLDc_SF; cl15239
261594007965	putative active site [active]
261594007966	catalytic site [active]
261594007967	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
261594007968	This domain superfamily is found in a variety of structurally related metalloproteins, including the type I extradiol dioxygenases, glyoxalase I and a group of antibiotic resistance proteins; Region: Glo_EDI_BRP_like; cd06587
261594007969	active site
261594007970	metal binding site [ion binding]; metal-binding site
261594007971	HEAT repeats; Region: HEAT_2; pfam13646
261594007972	Protein of unknown function (DUF1203); Region: DUF1203; pfam06718
261594007973	putative transporter; Provisional; Region: PRK11021
261594007974	Beta-lactamase; Region: Beta-lactamase; pfam00144
261594007975	Beta-lactamase class C and other penicillin binding proteins [Defense mechanisms]; Region: AmpC; COG1680
261594007976	putative monooxygenase; Provisional; Region: PRK11118
261594007977	DoxX-like family; Region: DoxX_2; pfam13564
261594007978	Transcriptional regulators [Transcription]; Region: MarR; COG1846
261594007979	MarR family; Region: MarR_2; pfam12802
261594007980	Cytochrome P450 [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CypX; COG2124
261594007981	Cytochrome P450; Region: p450; pfam00067
261594007982	Sulfite reductase, alpha subunit (flavoprotein) [Inorganic ion transport and metabolism]; Region: CysJ; COG0369
261594007983	Flavodoxin; Region: Flavodoxin_1; pfam00258
261594007984	These bifunctional proteins fuse N-terminal cytochrome p450 with a cytochrome p450 reductase (CYPOR). NADPH cytochrome p450 reductase serves as an electron donor in several oxygenase systems and is a component of nitric oxide synthases and methionine...; Region: bifunctional_CYPOR; cd06206
261594007985	FAD binding pocket [chemical binding]; other site
261594007986	FAD binding motif [chemical binding]; other site
261594007987	catalytic residues [active]
261594007988	NAD binding pocket [chemical binding]; other site
261594007989	phosphate binding motif [ion binding]; other site
261594007990	beta-alpha-beta structure motif; other site
261594007991	drug resistance transporter, EmrB/QacA subfamily; Region: efflux_EmrB; TIGR00711
261594007992	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594007993	putative substrate translocation pore; other site
261594007994	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594007995	Malarial early transcribed membrane protein (ETRAMP); Region: ETRAMP; cl09917
261594007996	Protein of unknown function (DUF3251); Region: DUF3251; cl08186
261594007997	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
261594007998	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594007999	active site
261594008000	phosphorylation site [posttranslational modification]
261594008001	intermolecular recognition site; other site
261594008002	dimerization interface [polypeptide binding]; other site
261594008003	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
261594008004	DNA binding site [nucleotide binding]
261594008005	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
261594008006	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
261594008007	dimerization interface [polypeptide binding]; other site
261594008008	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
261594008009	dimer interface [polypeptide binding]; other site
261594008010	phosphorylation site [posttranslational modification]
261594008011	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594008012	ATP binding site [chemical binding]; other site
261594008013	G-X-G motif; other site
261594008014	Putative peptidoglycan binding domain; Region: PG_binding_4; pfam12229
261594008015	L,D-transpeptidase catalytic domain; Region: YkuD; pfam03734
261594008016	D-cysteine desulfhydrase; Validated; Region: PRK03910
261594008017	Tryptophan synthase beta superfamily (fold type II); this family of pyridoxal phosphate (PLP)-dependent enzymes catalyzes beta-replacement and beta-elimination reactions. This CD corresponds to aminocyclopropane-1-carboxylate deaminase (ACCD), tryptophan...; Region: Trp-synth-beta_II; cl00342
261594008018	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
261594008019	catalytic residue [active]
261594008020	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
261594008021	salt bridge; other site
261594008022	non-specific DNA binding site [nucleotide binding]; other site
261594008023	sequence-specific DNA binding site [nucleotide binding]; other site
261594008024	putative adenylate-forming enzyme; Region: aden_form_hyp; TIGR02304
261594008025	Coenzyme F390 synthetase [Coenzyme metabolism]; Region: PaaK; COG1541
261594008026	Metallo-beta-lactamase superfamily; Region: Lactamase_B; pfam00753
261594008027	Nucleoside-diphosphate-sugar epimerases [Cell envelope biogenesis, outer membrane / Carbohydrate transport and metabolism]; Region: WcaG; COG0451
261594008028	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
261594008029	NAD(P) binding site [chemical binding]; other site
261594008030	active site
261594008031	3-oxoacyl-(acyl carrier protein) synthase III; Reviewed; Region: PRK07204
261594008032	Ketoacyl-acyl carrier protein synthase III (KASIII) initiates the elongation in type II fatty acid synthase systems. It is found in bacteria and plants. Elongation of fatty acids in the type II systems occurs by Claisen condensation of malonyl-acyl...; Region: KAS_III; cd00830
261594008033	dimer interface [polypeptide binding]; other site
261594008034	active site
261594008035	CoA binding pocket [chemical binding]; other site
261594008036	O-Methyltransferase involved in polyketide biosynthesis [Secondary metabolites biosynthesis, transport, and catabolism]; Region: COG3315
261594008037	Leucine carboxyl methyltransferase; Region: LCM; pfam04072
261594008038	AAA domain; Region: AAA_33; pfam13671
261594008039	AAA domain; Region: AAA_17; pfam13207
261594008040	Fibrinogen alpha/beta chain family; Region: Fib_alpha; pfam08702
261594008041	LPXTG-motif cell wall anchor domain; Region: LPXTG_anchor; TIGR01167
261594008042	ABC-type antimicrobial peptide transport system, ATPase component [Defense mechanisms]; Region: SalX; COG1136
261594008043	ATP-binding cassette domain of the transporters involved in export of lipoprotein and macrolide, and cell division protein; Region: ABC_MJ0796_LolCDE_FtsE; cd03255
261594008044	Walker A/P-loop; other site
261594008045	ATP binding site [chemical binding]; other site
261594008046	Q-loop/lid; other site
261594008047	ABC transporter signature motif; other site
261594008048	Walker B; other site
261594008049	D-loop; other site
261594008050	H-loop/switch region; other site
261594008051	MacB-like periplasmic core domain; Region: MacB_PCD; pfam12704
261594008052	ABC-type antimicrobial peptide transport system, permease component [Defense mechanisms]; Region: SalY; COG0577
261594008053	FtsX-like permease family; Region: FtsX; pfam02687
261594008054	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
261594008055	dimerization interface [polypeptide binding]; other site
261594008056	putative DNA binding site [nucleotide binding]; other site
261594008057	Predicted transcriptional regulator [Transcription]; Region: COG2345
261594008058	putative Zn2+ binding site [ion binding]; other site
261594008059	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594008060	H+ Antiporter protein; Region: 2A0121; TIGR00900
261594008061	putative substrate translocation pore; other site
261594008062	osmolarity sensor protein; Provisional; Region: envZ; PRK09467
261594008063	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
261594008064	dimerization interface [polypeptide binding]; other site
261594008065	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
261594008066	dimer interface [polypeptide binding]; other site
261594008067	phosphorylation site [posttranslational modification]
261594008068	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594008069	ATP binding site [chemical binding]; other site
261594008070	Mg2+ binding site [ion binding]; other site
261594008071	G-X-G motif; other site
261594008072	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
261594008073	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594008074	active site
261594008075	phosphorylation site [posttranslational modification]
261594008076	intermolecular recognition site; other site
261594008077	dimerization interface [polypeptide binding]; other site
261594008078	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
261594008079	DNA binding site [nucleotide binding]
261594008080	Predicted membrane protein [Function unknown]; Region: COG2364
261594008081	Transcriptional regulators [Transcription]; Region: MarR; COG1846
261594008082	MarR family; Region: MarR; pfam01047
261594008083	Transcriptional regulator [Transcription]; Region: PaiB; COG2808
261594008084	Uncharacterized conserved protein [Function unknown]; Region: COG1284
261594008085	Uncharacterized BCR, YitT family COG1284; Region: DUF161; pfam02588
261594008086	Uncharacterized protein conserved in bacteria (DUF2179); Region: DUF2179; pfam10035
261594008087	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594008088	D-galactonate transporter; Region: 2A0114; TIGR00893
261594008089	putative substrate translocation pore; other site
261594008090	Uncharacterized conserved protein [Function unknown]; Region: COG1556
261594008091	Uncharacterized conserved protein containing a ferredoxin-like domain [Energy production and conversion]; Region: COG1139
261594008092	Uncharacterized ACR, YkgG family COG1556; Region: DUF162; pfam02589
261594008093	4Fe-4S binding domain; Region: Fer4; pfam00037
261594008094	Domain of unknown function (DUF3390); Region: DUF3390; pfam11870
261594008095	CoB--CoM heterodisulfide reductase, subunit B; Region: CoB_CoM_SS_B; TIGR03288
261594008096	Cysteine-rich domain; Region: CCG; pfam02754
261594008097	Cysteine-rich domain; Region: CCG; pfam02754
261594008098	Transcriptional regulator [Transcription]; Region: LysR; COG0583
261594008099	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
261594008100	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cd05466
261594008101	dimerization interface [polypeptide binding]; other site
261594008102	F0F1 ATP synthase subunit alpha; Validated; Region: PRK06763
261594008103	Microcin C7 self-immunity protein determines resistance to exogenous microcin C7; Region: Peptidase_S66_mccF_like; cd07062
261594008104	putative dimer interface [polypeptide binding]; other site
261594008105	catalytic triad [active]
261594008106	Uncharacterized conserved protein (DUF2164); Region: DUF2164; cl02278
261594008107	Fucose permease [Carbohydrate transport and metabolism]; Region: FucP; COG0738
261594008108	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594008109	putative substrate translocation pore; other site
261594008110	Predicted dehydrogenases and related proteins [General function prediction only]; Region: MviM; COG0673
261594008111	Oxidoreductase family, NAD-binding Rossmann fold; Region: GFO_IDH_MocA; pfam01408
261594008112	Predicted hydrolases of the HAD superfamily [General function prediction only]; Region: Cof; COG0561
261594008113	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
261594008114	Transcriptional regulators [Transcription]; Region: PurR; COG1609
261594008115	Helix-turn-helix (HTH) DNA binding domain of the LacI family of transcriptional regulators; Region: HTH_LacI; cd01392
261594008116	DNA binding site [nucleotide binding]
261594008117	domain linker motif; other site
261594008118	Ligand-binding domain of a novel transcription factor implicated in catabolite repression in Bacillus and Clostridium species; Region: PBP1_CcpB_like; cd06286
261594008119	putative dimerization interface [polypeptide binding]; other site
261594008120	putative ligand binding site [chemical binding]; other site
261594008121	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cl02429
261594008122	TPR motif; other site
261594008123	Tetratricopeptide repeat; Region: TPR_12; pfam13424
261594008124	binding surface
261594008125	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cd00189
261594008126	TPR motif; other site
261594008127	binding surface
261594008128	Fascin-like domain; members include actin-bundling/crosslinking proteins facsin, histoactophilin and singed;  identified in sea urchin, Drosophila, Xenopus, rodents, and humans; The fascin-like domain adopts a beta-trefoil topology and contains an...; Region: Fascin; cd00257
261594008129	PKC phosphorylation site [posttranslational modification]; other site
261594008130	DNA polymerase IV; Reviewed; Region: PRK03103
261594008131	umuC subunit of DNA Polymerase V; Region: PolY_Pol_V_umuC; cd01700
261594008132	active site
261594008133	DNA binding site [nucleotide binding]
261594008134	Domain of unknown function (DUF4113); Region: DUF4113; pfam13438
261594008135	YolD-like protein; Region: YolD; pfam08863
261594008136	Tar ligand binding domain homologue; Region: TarH; pfam02203
261594008137	Cache domain; Region: Cache_1; pfam02743
261594008138	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
261594008139	dimerization interface [polypeptide binding]; other site
261594008140	Methyl-accepting chemotaxis-like domains (chemotaxis sensory transducer); Region: MA; smart00283
261594008141	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
261594008142	dimer interface [polypeptide binding]; other site
261594008143	putative CheW interface [polypeptide binding]; other site
261594008144	CAAX protease self-immunity; Region: Abi; pfam02517
261594008145	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594008146	Acetyltransferase (GNAT) domain; Region: Acetyltransf_3; pfam13302
261594008147	Coenzyme A binding pocket [chemical binding]; other site
261594008148	Na+-driven multidrug efflux pump [Defense mechanisms]; Region: NorM; COG0534
261594008149	Subfamily of the multidrug and toxic compound extrusion (MATE)-like proteins similar to Bacillus subtilis yoeA; Region: MATE_yoeA_like; cd13138
261594008150	Peptidase family M9 N-terminal; Region: Peptidase_M9_N; pfam08453
261594008151	Peptidase Gluzincin family (thermolysin-like proteinases, TLPs) includes peptidases M1, M2, M3, M4, M13, M32 and M36 (fungalysins); Region: GluZincin; cl14813
261594008152	FOG: PKD repeat [General function prediction only]; Region: COG3291
261594008153	polycystic kidney disease I (PKD) domain; similar to other cell-surface modules, with an IG-like fold; domain probably functions as a ligand binding site in protein-protein or protein-carbohydrate interactions; a single instance of the repeat is...; Region: PKD; cd00146
261594008154	Bacterial pre-peptidase C-terminal domain; Region: PPC; pfam04151
261594008155	Arabinose efflux permease [Carbohydrate transport and metabolism]; Region: AraJ; COG2814
261594008156	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594008157	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
261594008158	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
261594008159	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
261594008160	dimerization interface [polypeptide binding]; other site
261594008161	putative DNA binding site [nucleotide binding]; other site
261594008162	putative Zn2+ binding site [ion binding]; other site
261594008163	Amino acid permeases [Amino acid transport and metabolism]; Region: SdaC; COG0814
261594008164	threonine/serine transporter TdcC; Provisional; Region: PRK13629; cl17672
261594008165	Serine dehydratase alpha chain; Region: SDH_alpha; cl12120
261594008166	L-serine deaminase [Amino acid transport and metabolism]; Region: SdaA; COG1760
261594008167	Serine dehydratase beta chain; Region: SDH_beta; pfam03315
261594008168	diaminobutyrate--2-oxoglutarate aminotransferase; Validated; Region: PRK09264
261594008169	Acetyl ornithine aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to ornithine aminotransferase, acetylornithine aminotransferase; Region: OAT_like; cd00610
261594008170	inhibitor-cofactor binding pocket; inhibition site
261594008171	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594008172	catalytic residue [active]
261594008173	Acylphosphatase; Region: Acylphosphatase; pfam00708
261594008174	Hydrogenase maturation factor [Posttranslational modification, protein turnover, chaperones]; Region: HypF; COG0068
261594008175	HypF finger; Region: zf-HYPF; pfam07503
261594008176	HypF finger; Region: zf-HYPF; pfam07503
261594008177	Telomere recombination; Region: Sua5_yciO_yrdC; pfam01300
261594008178	HypE (Hydrogenase expression/formation protein). HypE is involved in Ni-Fe hydrogenase biosynthesis.  HypE dehydrates its own carbamoyl moiety in an ATP-dependent process to yield the enzyme thiocyanate. The N-terminal domain of HypE is related to the...; Region: HypE; cd02197
261594008179	dimerization interface [polypeptide binding]; other site
261594008180	hydrogenase expression/formation protein HypE; Region: hypE; TIGR02124
261594008181	ATP binding site [chemical binding]; other site
261594008182	Isochorismatase family; Region: Isochorismatase; pfam00857
261594008183	Cysteine hydrolases; This family contains amidohydrolases, like CSHase (N-carbamoylsarcosine amidohydrolase), involved in creatine metabolism and nicotinamidase, converting nicotinamide to nicotinic acid and ammonia in the pyridine nucleotide cycle. It...; Region: cysteine_hydrolases; cd00431
261594008184	catalytic triad [active]
261594008185	conserved cis-peptide bond; other site
261594008186	helix_turn_helix ASNC type; Region: HTH_ASNC; smart00344
261594008187	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
261594008188	putative DNA binding site [nucleotide binding]; other site
261594008189	putative Zn2+ binding site [ion binding]; other site
261594008190	AsnC family; Region: AsnC_trans_reg; pfam01037
261594008191	putative transporter; Provisional; Region: PRK11021
261594008192	Domain of unknown function (DUF4303); Region: DUF4303; pfam14136
261594008193	Uncharacterized conserved protein [Function unknown]; Region: COG4198
261594008194	Protein of unknown function (DUF1015); Region: DUF1015; pfam06245
261594008195	Putative D-3-Phosphoglycerate Dehydrogenases, NAD-binding and catalytic domains; Region: PGDH_like_3; cd12174
261594008196	D-isomer specific 2-hydroxyacid dehydrogenase, catalytic domain; Region: 2-Hacid_dh; pfam00389
261594008197	putative ligand binding site [chemical binding]; other site
261594008198	putative NAD binding site [chemical binding]; other site
261594008199	putative catalytic site [active]
261594008200	C-terminal ACT (regulatory) domain of D-3-Phosphoglycerate Dehydrogenase (3PGDH) found in fungi and bacteria; Region: ACT_3PGDH; cd04901
261594008201	L-serine binding site [chemical binding]; other site
261594008202	ACT domain interface; other site
261594008203	Phosphoserine aminotransferase (PSAT) family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major group in this CD corresponds to phosphoserine aminotransferase (PSAT).  PSAT is active as...; Region: PSAT_like; cd00611
261594008204	homodimer interface [polypeptide binding]; other site
261594008205	substrate-cofactor binding pocket; other site
261594008206	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594008207	catalytic residue [active]
261594008208	Sigma factor regulator N-terminal; Region: Sigma_reg_N; pfam13800
261594008209	Sigma factor regulator C-terminal; Region: Sigma_reg_C; pfam13791
261594008210	RNA polymerase sigma factor SigM; Provisional; Region: PRK09644
261594008211	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
261594008212	Sigma-70, region 4; Region: Sigma70_r4_2; pfam08281
261594008213	Uncharacterized conserved protein [Function unknown]; Region: COG2155
261594008214	Cupin domain; Region: Cupin_2; cl17218
261594008215	AraC-type DNA-binding domain-containing proteins [Transcription]; Region: AraC; COG2207
261594008216	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
261594008217	Protein related to penicillin acylase [General function prediction only]; Region: COG2366
261594008218	The Ntn hydrolases (N-terminal nucleophile) are a diverse superfamily of of enzymes that are activated autocatalytically via an N-terminally lcated nucleophilic amino acid.  N-terminal nucleophile (NTN-) hydrolase superfamily, which contains a...; Region: Ntn_hydrolase; cl00467
261594008219	Penicillin G acylase (PGA) belongs to a family of beta-lactam acylases that includes cephalosporin acylase (CA) and aculeacin A acylase. PGA and CA are crucial for the production of backbone chemicals like 6-aminopenicillanic acid and...; Region: Ntn_PGA_like; cd03747
261594008220	active site
261594008221	Replication initiation and membrane attachment; Region: DnaB_2; pfam07261
261594008222	DNA alkylation repair enzyme; Region: DNA_alkylation; pfam08713
261594008223	A new structural DNA glycosylase; Region: AlkD_like; cd06561
261594008224	active site
261594008225	Protein of unknown function (DUF3895); Region: DUF3895; pfam13034
261594008226	S-layer homology domain; Region: SLH; pfam00395
261594008227	S-layer homology domain; Region: SLH; pfam00395
261594008228	S-layer homology domain; Region: SLH; pfam00395
261594008229	This conserved domain belongs to a superfamily including the bleomycin resistance protein, glyoxalase I, and type I ring-cleaving dioxygenases; Region: Glo_EDI_BRP_like_13; cd08354
261594008230	putative metal binding site [ion binding]; other site
261594008231	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
261594008232	Domain of unknown function (DUF4279); Region: DUF4279; pfam14106
261594008233	NETI protein; Region: NETI; pfam14044
261594008234	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594008235	Major Facilitator Superfamily; Region: MFS_1; pfam07690
261594008236	putative substrate translocation pore; other site
261594008237	Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596
261594008238	Putative lysophospholipase; Region: Hydrolase_4; pfam12146
261594008239	helix_turn_helix multiple antibiotic resistance protein; Region: HTH_MARR; smart00347
261594008240	MarR family; Region: MarR_2; pfam12802
261594008241	Major Facilitator Superfamily; Region: MFS_1; pfam07690
261594008242	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594008243	putative substrate translocation pore; other site
261594008244	Beta-lactamase class C and other penicillin binding proteins [Defense mechanisms]; Region: AmpC; COG1680
261594008245	Beta-lactamase; Region: Beta-lactamase; pfam00144
261594008246	ABC-2 family transporter protein; Region: ABC2_membrane_2; cl17866
261594008247	ABC-type multidrug transport system, ATPase component [Defense mechanisms]; Region: CcmA; COG1131
261594008248	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
261594008249	Walker A/P-loop; other site
261594008250	ATP binding site [chemical binding]; other site
261594008251	Q-loop/lid; other site
261594008252	ABC transporter signature motif; other site
261594008253	Walker B; other site
261594008254	D-loop; other site
261594008255	H-loop/switch region; other site
261594008256	Phospholipase_D-nuclease N-terminal; Region: PLDc_N; pfam13396
261594008257	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
261594008258	putative DNA binding site [nucleotide binding]; other site
261594008259	putative Zn2+ binding site [ion binding]; other site
261594008260	Membrane transporters of cations and cationic drugs [Inorganic ion transport and metabolism]; Region: EmrE; COG2076
261594008261	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
261594008262	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
261594008263	Thiol-activated cytolysin; Region: Thiol_cytolysin; pfam01289
261594008264	Short chain fatty acids transporter [Lipid metabolism]; Region: AtoE; COG2031
261594008265	Flavodoxin-like fold; Region: Flavodoxin_2; pfam02525
261594008266	NADPH-dependent FMN reductase; Region: FMN_red; pfam03358
261594008267	SWIM zinc finger; Region: SWIM; pfam04434
261594008268	YwiC-like protein; Region: YwiC; pfam14256
261594008269	ECF-type riboflavin transporter, S component; Region: ECF-ribofla_trS; cl17272
261594008270	ABC-type cobalt transport system, ATPase component [Inorganic ion transport and metabolism]; Region: CbiO; COG1122
261594008271	First domain of the ATP-binding cassette component of cobalt transport system; Region: ABC_cobalt_CbiO_domain1; cd03225
261594008272	Walker A/P-loop; other site
261594008273	ATP binding site [chemical binding]; other site
261594008274	Q-loop/lid; other site
261594008275	ABC transporter signature motif; other site
261594008276	Walker B; other site
261594008277	D-loop; other site
261594008278	H-loop/switch region; other site
261594008279	ABC-type cobalt transport system, ATPase component [Inorganic ion transport and metabolism]; Region: CbiO; COG1122
261594008280	Second domain of the ATP-binding cassette component of cobalt transport system; Region: ABC_cobalt_CbiO_domain2; cd03226
261594008281	Walker A/P-loop; other site
261594008282	ATP binding site [chemical binding]; other site
261594008283	Q-loop/lid; other site
261594008284	ABC transporter signature motif; other site
261594008285	Walker B; other site
261594008286	D-loop; other site
261594008287	H-loop/switch region; other site
261594008288	ABC-type cobalt transport system, permease component CbiQ and related transporters [Inorganic ion transport and metabolism]; Region: CbiQ; COG0619
261594008289	This group contains class II terpene cyclases, protein prenyltransferases beta subunit, two broadly specific proteinase inhibitors alpha2-macroglobulin (alpha (2)-M) and pregnancy zone protein (PZP) and, the C3 C4 and C5 components of vertebrate...; Region: ISOPREN_C2_like; cd00688
261594008290	Prenyltransferase-like; Region: Prenyltrans_2; pfam13249
261594008291	ribonuclease activity regulator protein RraA; Provisional; Region: PRK09372
261594008292	Predicted membrane protein [Function unknown]; Region: COG1288
261594008293	C4-dicarboxylate anaerobic carrier; Region: DcuC; pfam03606
261594008294	Endonuclease I; Region: Endonuclease_1; pfam04231
261594008295	Putative lysophospholipase; Region: Hydrolase_4; pfam12146
261594008296	alpha/beta hydrolase fold; Region: Abhydrolase_1; pfam00561
261594008297	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
261594008298	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
261594008299	non-specific DNA binding site [nucleotide binding]; other site
261594008300	salt bridge; other site
261594008301	sequence-specific DNA binding site [nucleotide binding]; other site
261594008302	putative glycerol-3-phosphate acyltransferase PlsY; Provisional; Region: PRK00220
261594008303	This CD includes cysteinyl-tRNA(Pro) deacylases from Haemophilus influenzae and Escherichia coli and other related bacterial proteins. These trans-acting, single-domain proteins are homologs of ProX and also the cis-acting prolyl-tRNA synthetase (ProRS)...; Region: YbaK_deacylase; cd00002
261594008304	putative deacylase active site [active]
261594008305	histidyl-tRNA synthetase; Provisional; Region: PRK12420
261594008306	Class II Histidinyl-tRNA synthetase (HisRS)-like catalytic core domain. HisRS is a homodimer. It is responsible for the attachment of histidine to the 3' OH group of ribose of the appropriate tRNA. This domain is primarily responsible for...; Region: HisRS-like_core; cd00773
261594008307	dimer interface [polypeptide binding]; other site
261594008308	motif 1; other site
261594008309	active site
261594008310	motif 2; other site
261594008311	motif 3; other site
261594008312	HisRS Histidyl-anticodon binding domain. HisRS belongs to class II aminoacyl-tRNA synthetases (aaRS). This alignment contains the anticodon binding domain, which is responsible for specificity in tRNA-binding, so that the activated amino acid is...; Region: HisRS_anticodon; cd00859
261594008313	anticodon binding site; other site
261594008314	Predicted transcriptional regulators [Transcription]; Region: COG1733
261594008315	HxlR-like helix-turn-helix; Region: HxlR; pfam01638
261594008316	NAD(P)H:FMN oxidoreductase family. This domain catalyzes the reduction of flavin, nitrocompound, quinones and azo compounds using NADH or NADPH as an electron donor. The enzyme is a homodimer, and each monomer binds a FMN as co-factor. This family...; Region: NfsB_like_nitroreductase; cd02149
261594008317	dimer interface [polypeptide binding]; other site
261594008318	FMN binding site [chemical binding]; other site
261594008319	pyruvate kinase; Validated; Region: PRK06739
261594008320	active site
261594008321	domain interfaces; other site
261594008322	3-ketoacyl-(acyl-carrier-protein) reductase; Provisional; Region: PRK12748
261594008323	classical (c) SDRs; Region: SDR_c; cd05233
261594008324	NAD(P) binding site [chemical binding]; other site
261594008325	active site
261594008326	ABC-type Na+ transport system, ATPase component [Energy production and conversion / Inorganic ion transport and metabolism]; Region: NatA; COG4555
261594008327	ATP-binding cassette domain of the drug resistance transporter and related proteins, subfamily A; Region: ABC_DR_subfamily_A; cd03230
261594008328	Walker A/P-loop; other site
261594008329	ATP binding site [chemical binding]; other site
261594008330	Q-loop/lid; other site
261594008331	ABC transporter signature motif; other site
261594008332	Walker B; other site
261594008333	D-loop; other site
261594008334	H-loop/switch region; other site
261594008335	Protein of unknown function (DUF3796); Region: DUF3796; pfam12676
261594008336	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
261594008337	non-specific DNA binding site [nucleotide binding]; other site
261594008338	salt bridge; other site
261594008339	sequence-specific DNA binding site [nucleotide binding]; other site
261594008340	HAD superfamily (subfamily IA) hydrolase, TIGR02254; Region: YjjG/YfnB
261594008341	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
261594008342	motif II; other site
261594008343	Protein of unknown function (DUF1648); Region: DUF1648; pfam07853
261594008344	Tyrosine phosphatase family; Region: Y_phosphatase3; pfam13350
261594008345	Tyrosine phosphatase family C-terminal region; Region: Y_phosphatase3C; pfam13348
261594008346	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cl17182
261594008347	Coenzyme A binding pocket [chemical binding]; other site
261594008348	Protein of unknown function (DUF2785); Region: DUF2785; pfam10978
261594008349	Protein of unknown function (DUF2651); Region: DUF2651; pfam10852
261594008350	This conserved domain belongs to a superfamily including the bleomycin resistance protein, glyoxalase I, and type I ring-cleaving dioxygenases; Region: Glo_EDI_BRP_like_3; cd07241
261594008351	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
261594008352	putative metal binding site [ion binding]; other site
261594008353	Transcriptional regulator/sugar kinase [Transcription / Carbohydrate transport and metabolism]; Region: NagC; COG1940
261594008354	Nucleotide-Binding Domain of the sugar kinase/HSP70/actin superfamily; Region: NBD_sugar-kinase_HSP70_actin; cl17037
261594008355	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594008356	putative substrate translocation pore; other site
261594008357	Major Facilitator Superfamily; Region: MFS_1; pfam07690
261594008358	maltose O-acetyltransferase; Provisional; Region: PRK10092
261594008359	Maltose O-acetyltransferase (MAT) and Galactoside O-acetyltransferase (GAT): MAT and GAT catalyze the CoA-dependent acetylation of the 6-hydroxyl group of their respective sugar substrates. MAT acetylates maltose and glucose exclusively at the C6...; Region: LbH_MAT_GAT; cd03357
261594008360	active site
261594008361	substrate binding site [chemical binding]; other site
261594008362	trimer interface [polypeptide binding]; other site
261594008363	CoA binding site [chemical binding]; other site
261594008364	ABC-type antimicrobial peptide transport system, ATPase component [Defense mechanisms]; Region: SalX; COG1136
261594008365	ATP-binding cassette domain of the transporters involved in export of lipoprotein and macrolide, and cell division protein; Region: ABC_MJ0796_LolCDE_FtsE; cd03255
261594008366	Walker A/P-loop; other site
261594008367	ATP binding site [chemical binding]; other site
261594008368	Q-loop/lid; other site
261594008369	ABC transporter signature motif; other site
261594008370	Walker B; other site
261594008371	D-loop; other site
261594008372	H-loop/switch region; other site
261594008373	tryptophanyl-tRNA synthetase II; Reviewed; Region: PRK12282
261594008374	catalytic core domain of tryptophanyl-tRNA synthetase; Region: TrpRS_core; cd00806
261594008375	active site
261594008376	HIGH motif; other site
261594008377	dimer interface [polypeptide binding]; other site
261594008378	KMSKS motif; other site
261594008379	1-deoxy-D-xylulose 5-phosphate reductoisomerase; Provisional; Region: PRK12464
261594008380	1-deoxy-D-xylulose 5-phosphate reductoisomerase; Region: DXP_reductoisom; pfam02670
261594008381	1-deoxy-D-xylulose 5-phosphate reductoisomerase C-terminal; Region: DXP_redisom_C; pfam08436
261594008382	DXP reductoisomerase C-terminal domain; Region: DXPR_C; pfam13288
261594008383	Predicted permease, member of the PurR regulon [General function prediction only]; Region: yhhT; COG0628
261594008384	Domain of unknown function DUF20; Region: UPF0118; pfam01594
261594008385	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594008386	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cl17182
261594008387	Coenzyme A binding pocket [chemical binding]; other site
261594008388	Methyltransferase domain; Region: Methyltransf_31; pfam13847
261594008389	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594008390	S-adenosylmethionine binding site [chemical binding]; other site
261594008391	Protein of unknown function (DUF1470); Region: DUF1470; pfam07336
261594008392	CGNR zinc finger; Region: zf-CGNR; pfam11706
261594008393	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594008394	multidrug resistance protein MdtH; Provisional; Region: PRK11646
261594008395	putative substrate translocation pore; other site
261594008396	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cd00189
261594008397	TPR motif; other site
261594008398	TPR repeat; Region: TPR_11; pfam13414
261594008399	binding surface
261594008400	TPR repeat; Region: TPR_11; pfam13414
261594008401	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cl02429
261594008402	binding surface
261594008403	TPR motif; other site
261594008404	Protein of unknown function (DUF3923); Region: DUF3923; pfam13061
261594008405	hypothetical protein; Provisional; Region: PRK04164
261594008406	Uncharacterized protein conserved in bacteria (DUF2179); Region: DUF2179; pfam10035
261594008407	ATP synthase I chain; Region: ATP_synt_I; cl09170
261594008408	Hemolysins and related proteins containing CBS domains [General function prediction only]; Region: TlyC; COG1253
261594008409	Domain of unknown function DUF21; Region: DUF21; pfam01595
261594008410	This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domains associated with the CorC_HlyC domain. CorC_HlyC is a transporter associated domain. This small domain is found in Na+/H+ antiporters, in proteins involved in...; Region: CBS_pair_CorC_HlyC_assoc; cd04590
261594008411	Transporter associated domain; Region: CorC_HlyC; smart01091
261594008412	Helix-Turn-Helix DNA binding domain of putative transcription regulators from the MerR superfamily; Region: HTH_MerR-like_sg4; cd04779
261594008413	Predicted transcriptional regulators [Transcription]; Region: SoxR; COG0789
261594008414	DNA binding residues [nucleotide binding]
261594008415	putative dimer interface [polypeptide binding]; other site
261594008416	EamA-like transporter family; Region: EamA; pfam00892
261594008417	Carboxylate/Amino Acid/Amine Transporter; Region: 2A78; TIGR00950
261594008418	EamA-like transporter family; Region: EamA; pfam00892
261594008419	Pentapeptide repeats containing protein [Function unknown]; Region: COG1357
261594008420	Pentapeptide repeats (8 copies); Region: Pentapeptide; pfam00805
261594008421	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3813
261594008422	Protein of unknown function (DUF1272); Region: DUF1272; pfam06906
261594008423	Lactonase, 7-bladed beta-propeller; Region: Lactonase; pfam10282
261594008424	gluconate kinase, FGGY type; Region: gntK_FGGY; TIGR01314
261594008425	Gluconate kinases; a subfamily of the FGGY family of carbohydrate kinases; Region: FGGY_GntK; cd07770
261594008426	N- and C-terminal domain interface [polypeptide binding]; other site
261594008427	active site
261594008428	catalytic site [active]
261594008429	metal binding site [ion binding]; metal-binding site
261594008430	carbohydrate binding site [chemical binding]; other site
261594008431	ATP binding site [chemical binding]; other site
261594008432	GntP family permease; Region: GntP_permease; pfam02447
261594008433	fructuronate transporter; Provisional; Region: PRK10034; cl15264
261594008434	Transaldolase-like fructose-6-phosphate aldolases (FSA) found in bacteria and archaea; Region: Transaldolase_FSA; cd00956
261594008435	active site
261594008436	intersubunit interactions; other site
261594008437	catalytic residue [active]
261594008438	Predicted 6-phosphogluconate dehydrogenase [Carbohydrate transport and metabolism]; Region: Gnd; COG1023
261594008439	6-phosphogluconate dehydrogenase-like protein; Reviewed; Region: PRK09599
261594008440	Transketolase [Carbohydrate transport and metabolism]; Region: TktA; COG0021
261594008441	Thiamine pyrophosphate (TPP) family, Transketolase (TK) subfamily, TPP-binding module; TK catalyzes the transfer of a two-carbon unit from ketose phosphates to aldose phosphates. In heterotrophic organisms, TK provides a link between glycolysis and the...; Region: TPP_TK; cd02012
261594008442	TPP-binding site [chemical binding]; other site
261594008443	dimer interface [polypeptide binding]; other site
261594008444	Pyrimidine (PYR) binding domain of 1-deoxy-D-xylulose-5-phosphate synthase (DXS), transketolase (TK), and related proteins; Region: TPP_PYR_DXS_TK_like; cd07033
261594008445	PYR/PP interface [polypeptide binding]; other site
261594008446	dimer interface [polypeptide binding]; other site
261594008447	TPP binding site [chemical binding]; other site
261594008448	Transketolase, C-terminal domain; Region: Transketolase_C; pfam02780
261594008449	glucose-6-phosphate 1-dehydrogenase; Validated; Region: PRK05722
261594008450	Glucose-6-phosphate dehydrogenase, NAD binding domain; Region: G6PD_N; pfam00479
261594008451	Glucose-6-phosphate dehydrogenase, C-terminal domain; Region: G6PD_C; pfam02781
261594008452	Glucose-6-phosphate dehydrogenase, NAD binding domain; Region: G6PD_N; pfam00479
261594008453	NADPH:quinone reductase and related Zn-dependent oxidoreductases [Energy production and conversion / General function prediction only]; Region: Qor; COG0604
261594008454	alcohol dehydrogenase and quinone reductase-like medium chain degydrogenases/reductases; Region: MDR_like_2; cd05289
261594008455	putative NAD(P) binding site [chemical binding]; other site
261594008456	luciferase-type oxidoreductase, BA3436 family; Region: lucif_BA3436; TIGR03571
261594008457	Flavin-utilizing monoxygenases; Region: Flavin_utilizing_monoxygenases; cl07892
261594008458	Medium chain dehydrogenases/reductase (MDR)/zinc-dependent alcohol dehydrogenase-like family; Region: MDR6; cd08272
261594008459	NADPH:quinone reductase and related Zn-dependent oxidoreductases [Energy production and conversion / General function prediction only]; Region: Qor; COG0604
261594008460	putative NAD(P) binding site [chemical binding]; other site
261594008461	3-ketoacyl-(acyl-carrier-protein) reductase; Validated; Region: fabG; PRK05653
261594008462	classical (c) SDRs; Region: SDR_c; cd05233
261594008463	NAD(P) binding site [chemical binding]; other site
261594008464	active site
261594008465	Zinc metalloprotease (elastase) [Amino acid transport and metabolism]; Region: LasB; COG3227
261594008466	Fungalysin/Thermolysin Propeptide Motif; Region: FTP; pfam07504
261594008467	Peptidase M4 family includes thermolysin, protealysin, aureolysin and neutral protease; Region: M4_neutral_protease; cd09597
261594008468	active site
261594008469	Zn binding site [ion binding]; other site
261594008470	Viral enhancin protein; Region: Enhancin; pfam03272
261594008471	Peptidase M60-like family; Region: M60-like; pfam13402
261594008472	Nitroreductase-like family 4.  A subfamily of the nitroreductase family containing uncharacterized proteins that are similar to nitroreductase. Nitroreductase catalyzes the reduction of nitroaromatic compounds such as nitrotoluenes, nitrofurans and...; Region: Nitroreductase_4; cd02140
261594008473	dimer interface [polypeptide binding]; other site
261594008474	FMN binding site [chemical binding]; other site
261594008475	BNR repeat-like domain; Region: BNR_2; pfam13088
261594008476	Aldo-keto reductases (AKRs) are a superfamily of soluble NAD(P)(H) oxidoreductases whose chief purpose is to reduce aldehydes and ketones to primary and secondary alcohols. AKRs are present in all phyla and are of importance to both health and industrial...; Region: Aldo_ket_red; cd06660
261594008477	Aldo/keto reductase family; Region: Aldo_ket_red; pfam00248
261594008478	active site
261594008479	catalytic tetrad [active]
261594008480	Arabinose efflux permease [Carbohydrate transport and metabolism]; Region: AraJ; COG2814
261594008481	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594008482	putative substrate translocation pore; other site
261594008483	4-Oxalocrotonate Tautomerase:  Catalyzes the isomerization of unsaturated ketones. The structure is a homohexamer that is arranged as a trimer of dimers. The hexamer contains six active sites, each formed by residues from three monomers, two from one...; Region: 4Oxalocrotonate_Tautomerase; cl00235
261594008484	active site 1 [active]
261594008485	dimer interface [polypeptide binding]; other site
261594008486	hexamer interface [polypeptide binding]; other site
261594008487	active site 2 [active]
261594008488	4-Oxalocrotonate Tautomerase:  Catalyzes the isomerization of unsaturated ketones. The structure is a homohexamer that is arranged as a trimer of dimers. The hexamer contains six active sites, each formed by residues from three monomers, two from one...; Region: 4Oxalocrotonate_Tautomerase; cl00235
261594008489	hexamer interface [polypeptide binding]; other site
261594008490	active site 2 [active]
261594008491	hypothetical protein; Provisional; Region: PRK02487
261594008492	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
261594008493	This domain superfamily is found in a variety of structurally related metalloproteins, including the type I extradiol dioxygenases, glyoxalase I and a group of antibiotic resistance proteins; Region: Glo_EDI_BRP_like; cd06587
261594008494	active site
261594008495	metal binding site [ion binding]; metal-binding site
261594008496	Amino acid permeases [Amino acid transport and metabolism]; Region: SdaC; COG0814
261594008497	threonine/serine transporter TdcC; Provisional; Region: PRK13629; cl17672
261594008498	IDEAL domain; Region: IDEAL; pfam08858
261594008499	Transcriptional regulator; Region: Rrf2; pfam02082
261594008500	Rrf2 family protein; Region: rrf2_super; TIGR00738
261594008501	chaperonin_like superfamily. Chaperonins are involved in productive folding of proteins. They share a common general morphology, a double toroid of 2 stacked rings, each composed of 7-9 subunits. There are 2 main chaperonin groups. The symmetry of type I...; Region: chaperonin_like; cl02777
261594008502	Arsenate Reductase (ArsC) family, Spx subfamily; Spx is a unique RNA polymerase (RNAP)-binding protein present in bacilli and some mollicutes. It inhibits transcription by binding to the C-terminal domain of the alpha subunit of RNAP, disrupting complex...; Region: ArsC_Spx; cd03032
261594008503	ArsC family; Region: ArsC; pfam03960
261594008504	putative catalytic residues [active]
261594008505	thiol/disulfide switch; other site
261594008506	Predicted transcriptional regulators [Transcription]; Region: COG1733
261594008507	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
261594008508	dimerization interface [polypeptide binding]; other site
261594008509	putative DNA binding site [nucleotide binding]; other site
261594008510	putative Zn2+ binding site [ion binding]; other site
261594008511	Transcriptional regulators [Transcription]; Region: PhnF; COG2188
261594008512	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
261594008513	DNA-binding site [nucleotide binding]; DNA binding site
261594008514	UTRA domain; Region: UTRA; pfam07702
261594008515	Cyclopropane fatty acid synthase and related methyltransferases [Cell envelope biogenesis, outer membrane]; Region: Cfa; COG2230
261594008516	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cl17173
261594008517	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594008518	S-adenosylmethionine binding site [chemical binding]; other site
261594008519	Predicted transcriptional regulators [Transcription]; Region: COG1733
261594008520	HxlR-like helix-turn-helix; Region: HxlR; pfam01638
261594008521	Predicted transcriptional regulators [Transcription]; Region: COG1733
261594008522	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
261594008523	dimerization interface [polypeptide binding]; other site
261594008524	putative DNA binding site [nucleotide binding]; other site
261594008525	putative Zn2+ binding site [ion binding]; other site
261594008526	Aldo/keto reductase family; Region: Aldo_ket_red; pfam00248
261594008527	Aldo-keto reductases (AKRs) are a superfamily of soluble NAD(P)(H) oxidoreductases whose chief purpose is to reduce aldehydes and ketones to primary and secondary alcohols. AKRs are present in all phyla and are of importance to both health and industrial...; Region: Aldo_ket_red; cd06660
261594008528	active site
261594008529	catalytic tetrad [active]
261594008530	Pyrabactin resistance 1 (PYR1), PYR1-like (PYL), regulatory component of abscisic acid receptors (RCARs), and related proteins; Region: PYR_PYL_RCAR_like; cd07821
261594008531	putative hydrophobic ligand binding site [chemical binding]; other site
261594008532	protein interface [polypeptide binding]; other site
261594008533	gate; other site
261594008534	Metallo-beta-lactamase superfamily; Region: Lactamase_B; smart00849
261594008535	Aminoglycoside/hydroxyurea antibiotic resistance kinase; Region: APH_6_hur; cl17810
261594008536	Phosphotransferase enzyme family; Region: APH; pfam01636
261594008537	Predicted epimerase, PhzC/PhzF homolog [General function prediction only]; Region: COG0384
261594008538	Diaminopimelate epimerase; Region: DAP_epimerase; pfam01678
261594008539	hydroxyproline-2-epimerase; Provisional; Region: PRK13971
261594008540	Acetyltransferases, including N-acetylases of ribosomal proteins [Translation, ribosomal structure and biogenesis]; Region: RimL; COG1670
261594008541	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594008542	Coenzyme A binding pocket [chemical binding]; other site
261594008543	C factor cell-cell signaling protein; Provisional; Region: PRK09009
261594008544	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
261594008545	NAD(P) binding site [chemical binding]; other site
261594008546	active site
261594008547	Acetyltransferases, including N-acetylases of ribosomal proteins [Translation, ribosomal structure and biogenesis]; Region: RimL; COG1670
261594008548	Acetyltransferase (GNAT) family; Region: Acetyltransf_1; pfam00583
261594008549	Acyl-CoA synthetases (AMP-forming)/AMP-acid ligases II [Lipid metabolism / Secondary metabolites biosynthesis, transport, and catabolism]; Region: CaiC; COG0318
261594008550	Adenylate forming domain, Class I; Region: AFD_class_I; cl17068
261594008551	acyl-activating enzyme (AAE) consensus motif; other site
261594008552	AMP binding site [chemical binding]; other site
261594008553	active site
261594008554	CoA binding site [chemical binding]; other site
261594008555	Ankyrin repeats (many copies); Region: Ank_4; pfam13637
261594008556	ankyrin repeats;  ankyrin repeats mediate protein-protein interactions in very diverse families of proteins. The number of ANK repeats in a protein can range from 2 to over 20 (ankyrins, for example). ANK repeats may occur in combinations with other...; Region: ANK; cd00204
261594008557	Ankyrin repeats (3 copies); Region: Ank_2; pfam12796
261594008558	ankyrin repeats;  ankyrin repeats mediate protein-protein interactions in very diverse families of proteins. The number of ANK repeats in a protein can range from 2 to over 20 (ankyrins, for example). ANK repeats may occur in combinations with other...; Region: ANK; cd00204
261594008559	Ankyrin repeats (3 copies); Region: Ank_2; pfam12796
261594008560	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
261594008561	dimerization interface [polypeptide binding]; other site
261594008562	putative DNA binding site [nucleotide binding]; other site
261594008563	putative Zn2+ binding site [ion binding]; other site
261594008564	Anti-sigma factor N-terminus; Region: RsgI_N; pfam12791
261594008565	putative RNA polymerase sigma factor SigI; Reviewed; Region: PRK08311
261594008566	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
261594008567	CAAX protease self-immunity; Region: Abi; pfam02517
261594008568	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
261594008569	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
261594008570	Protein of unknown function (DUF3963); Region: DUF3963; pfam13124
261594008571	Bacterial transcription activator, effector binding domain; Region: AraC_E_bind; smart00871
261594008572	Protein of unknown function (DUF805); Region: DUF805; pfam05656
261594008573	ABC-2 type transporter; Region: ABC2_membrane; cl17235
261594008574	ABC-type Na+ transport system, ATPase component [Energy production and conversion / Inorganic ion transport and metabolism]; Region: NatA; COG4555
261594008575	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
261594008576	Walker A/P-loop; other site
261594008577	ATP binding site [chemical binding]; other site
261594008578	Q-loop/lid; other site
261594008579	ABC transporter signature motif; other site
261594008580	Walker B; other site
261594008581	D-loop; other site
261594008582	H-loop/switch region; other site
261594008583	Protein of unknown function (DUF1048); Region: DUF1048; pfam06304
261594008584	Predicted transcriptional regulators [Transcription]; Region: COG1695
261594008585	Transcriptional regulator PadR-like family; Region: PadR; pfam03551
261594008586	hydroxylamine reductase; Provisional; Region: PRK12310
261594008587	The HCP family of iron-sulfur proteins includes hybrid cluster protein (HCP), acetyl-CoA synthase (ACS), and carbon monoxide dehydrogenase (CODH), all of which contain [Fe4-S4] metal clusters at their active sites. These proteins have a conserved...; Region: HCP_like; cl14655
261594008588	ACS interaction site; other site
261594008589	CODH interaction site; other site
261594008590	metal cluster binding site [ion binding]; other site
261594008591	Metallo-beta-lactamase superfamily; Region: Lactamase_B; smart00849
261594008592	Uncharacterized bacterial muramidase containing a glycosyl hydrolase family 25 (GH25) catalytic domain. Endo-N-acetylmuramidases are lysozymes (also referred to as peptidoglycan hydrolases) that degrade bacterial cell walls by catalyzing the hydrolysis...; Region: GH25_muramidase_1; cd06413
261594008593	Glycosyl hydrolases family 25; Region: Glyco_hydro_25; pfam01183
261594008594	active site
261594008595	Nucleoside Triphosphate Pyrophosphohydrolase (EC 3.6.1.8) MazG-like domain superfamily; Region: NTP-PPase; cl16941
261594008596	metal binding site [ion binding]; metal-binding site
261594008597	Domain of unknown function (DUF3784); Region: DUF3784; pfam12650
261594008598	hypothetical protein; Provisional; Region: PRK06771
261594008599	Beta-lactamase class C and other penicillin binding proteins [Defense mechanisms]; Region: AmpC; COG1680
261594008600	Beta-lactamase; Region: Beta-lactamase; pfam00144
261594008601	Predicted flavoprotein involved in K+ transport [Inorganic ion transport and metabolism]; Region: TrkA; COG2072
261594008602	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox_3; pfam13738
261594008603	Bleomycin binding protein (BLMA) and similar proteins; BLMA confers bleomycin (Bm) resistance by directly binding to Bm; Region: BLMA_like; cd08349
261594008604	dimer interface [polypeptide binding]; other site
261594008605	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
261594008606	ligand binding site [chemical binding]; other site
261594008607	DNA-binding transcriptional activator YeiL; Provisional; Region: PRK10402
261594008608	effector domain of the CAP family of transcription factors; members include CAP (or cAMP receptor protein (CRP)), which binds cAMP, FNR (fumarate and nitrate reduction), which uses an iron-sulfur cluster to sense oxygen) and CooA, a heme containing CO...; Region: CAP_ED; cd00038
261594008609	ligand binding site [chemical binding]; other site
261594008610	flexible hinge region; other site
261594008611	Crp-like helix-turn-helix domain; Region: HTH_Crp_2; pfam13545
261594008612	Protein of unknown function, DUF606; Region: DUF606; pfam04657
261594008613	Protein of unknown function, DUF606; Region: DUF606; pfam04657
261594008614	Metallo-beta-lactamase superfamily; Region: Lactamase_B; smart00849
261594008615	putative transport protein YifK; Provisional; Region: PRK10746
261594008616	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594008617	drug resistance transporter, Bcr/CflA subfamily; Region: efflux_Bcr_CflA; TIGR00710
261594008618	putative substrate translocation pore; other site
261594008619	Haemolysin XhlA; Region: XhlA; pfam10779
261594008620	bacillithiol biosynthesis deacetylase BshB2; Region: thiol_BshB2; TIGR04000
261594008621	Protein of unknown function (DUF1806); Region: DUF1806; pfam08830
261594008622	Na+/H+ antiporter NhaD and related arsenite permeases [Inorganic ion transport and metabolism]; Region: ArsB; COG1055
261594008623	Permease P (pink-eyed dilution). Mutations in the human melanosomal P gene were responsible for classic phenotype of oculocutaneous albinism type 2 (OCA2). Although the precise function of the P protein is unknown, it was predicted to regulate the...; Region: P_permease; cd01116
261594008624	transmembrane helices; other site
261594008625	Periplasmic binding protein FeuA.  These proteins have predicted to function as initial receptors in ABC transport of metal ions in some eubacterial species.  They belong to the TroA superfamily of periplasmic metal binding proteins that share a distinct...; Region: FeuA; cd01138
261594008626	putative ligand binding residues [chemical binding]; other site
261594008627	Periplasmic binding protein; Region: Peripla_BP_2; pfam01497
261594008628	ABC-type enterobactin transport system, permease component [Inorganic ion transport and metabolism]; Region: FepG; COG4779
261594008629	Transmembrane subunit (TM), of Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters involved in the uptake of siderophores, heme, vitamin B12, or the divalent cations Mg2+ and Zn2+. PBP-dependent ABC transporters consist of...; Region: TM_ABC_iron-siderophores_like; cd06550
261594008630	ABC-ATPase subunit  interface; other site
261594008631	dimer interface [polypeptide binding]; other site
261594008632	putative PBP binding regions; other site
261594008633	iron-hydroxamate transporter permease subunit; Provisional; Region: PRK10577
261594008634	Transmembrane subunit (TM), of Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters involved in the uptake of siderophores, heme, vitamin B12, or the divalent cations Mg2+ and Zn2+. PBP-dependent ABC transporters consist of...; Region: TM_ABC_iron-siderophores_like; cd06550
261594008635	ABC-ATPase subunit  interface; other site
261594008636	dimer interface [polypeptide binding]; other site
261594008637	putative PBP binding regions; other site
261594008638	Protein of unknown function (DUF817); Region: DUF817; pfam05675
261594008639	Predicted epimerase, PhzC/PhzF homolog [General function prediction only]; Region: COG0384
261594008640	Diaminopimelate epimerase; Region: DAP_epimerase; pfam01678
261594008641	Protein of unknown function (DUF4003); Region: DUF4003; pfam13170
261594008642	DinB superfamily; Region: DinB_2; pfam12867
261594008643	DinB family; Region: DinB; cl17821
261594008644	Protein of unknown function (DUF2690); Region: DUF2690; pfam10901
261594008645	Protein of unknown function (DUF2690); Region: DUF2690; pfam10901
261594008646	Transcriptional regulator [Transcription]; Region: LysR; COG0583
261594008647	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
261594008648	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cd05466
261594008649	dimerization interface [polypeptide binding]; other site
261594008650	NADPH:quinone reductase and related Zn-dependent oxidoreductases [Energy production and conversion / General function prediction only]; Region: Qor; COG0604
261594008651	Quinone oxidoreductase (QOR); Region: QOR2; cd05286
261594008652	NADP binding site [chemical binding]; other site
261594008653	dimer interface [polypeptide binding]; other site
261594008654	Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067
261594008655	catalytic core [active]
261594008656	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594008657	Coenzyme A binding pocket [chemical binding]; other site
261594008658	DNA-binding domain of DNA mismatch repair MUTS family; Region: MUTSd; smart00533
261594008659	MutS domain III; Region: MutS_III; pfam05192
261594008660	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
261594008661	Walker A/P-loop; other site
261594008662	ATP binding site [chemical binding]; other site
261594008663	Q-loop/lid; other site
261594008664	ABC transporter signature motif; other site
261594008665	Walker B; other site
261594008666	D-loop; other site
261594008667	H-loop/switch region; other site
261594008668	cytoplasmic alpha-amylase; Reviewed; Region: PRK09441
261594008669	Alpha amylase catalytic domain found in bacterial and fungal Alpha amylases (also called 1,4-alpha-D-glucan-4-glucanohydrolase); Region: AmyAc_bac_fung_AmyA; cd11318
261594008670	active site
261594008671	Na/Ca binding site [ion binding]; other site
261594008672	catalytic site [active]
261594008673	Domain of unknown function (DUF1939); Region: DUF1939; pfam09154
261594008674	oligoendopeptidase F; Region: pepF; TIGR00181
261594008675	Peptidase family M3B Oligopeptidase F (PepF); Region: M3B_PepF_3; cd09608
261594008676	active site
261594008677	Zn binding site [ion binding]; other site
261594008678	Beta-lactamase class C and other penicillin binding proteins [Defense mechanisms]; Region: AmpC; COG1680
261594008679	Beta-lactamase; Region: Beta-lactamase; pfam00144
261594008680	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594008681	putative substrate translocation pore; other site
261594008682	Major Facilitator Superfamily; Region: MFS_1; pfam07690
261594008683	Transcriptional regulator [Transcription]; Region: LysR; COG0583
261594008684	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
261594008685	The C-terminal substrate binding domain of LysR-type transcriptional regulators, YofA and SoxR, contains the type 2 periplasmic binding fold; Region: PBP2_YofA_SoxR_like; cd08442
261594008686	putative dimerization interface [polypeptide binding]; other site
261594008687	Protein of unknown function (DUF3916); Region: DUF3916; pfam13079
261594008688	YdcF-like. YdcF-like is a large family of mainly bacterial proteins, with a few members found in fungi, plants, and archaea. Escherichia coli YdcF has been shown to bind S-adenosyl-L-methionine (AdoMet), but a biochemical function has not been...; Region: YdcF-like; cd06259
261594008689	putative active site [active]
261594008690	Glycerophosphodiester phosphodiesterase domain of Staphylococcus aureus and similar proteins; Region: GDPD_SaGlpQ_like; cd08601
261594008691	Glycerophosphoryl diester phosphodiesterase [Energy production and conversion]; Region: UgpQ; COG0584
261594008692	active site
261594008693	catalytic site [active]
261594008694	metal binding site [ion binding]; metal-binding site
261594008695	FAD binding domain; Region: FAD_binding_3; pfam01494
261594008696	hypothetical protein; Provisional; Region: PRK07236
261594008697	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
261594008698	dimerization interface [polypeptide binding]; other site
261594008699	putative DNA binding site [nucleotide binding]; other site
261594008700	putative Zn2+ binding site [ion binding]; other site
261594008701	NADPH:quinone reductase and related Zn-dependent oxidoreductases [Energy production and conversion / General function prediction only]; Region: Qor; COG0604
261594008702	alcohol dehydrogenase and quinone reductase-like medium chain degydrogenases/reductases; Region: MDR_like_2; cd05289
261594008703	putative NAD(P) binding site [chemical binding]; other site
261594008704	Uncharacterized conserved protein [Function unknown]; Region: COG0397
261594008705	hypothetical protein; Validated; Region: PRK00029
261594008706	Putative FMN-binding domain; Region: FMN_bind_2; pfam04299
261594008707	Uncharacterized protein family (UPF0157); Region: UPF0157; pfam04229
261594008708	Domain of unknown function (DUF4260); Region: DUF4260; pfam14079
261594008709	Predicted Na+-dependent transporter [General function prediction only]; Region: COG0385
261594008710	Sodium Bile acid symporter family; Region: SBF; cl17470
261594008711	FAD/FMN-containing dehydrogenases [Energy production and conversion]; Region: GlcD; COG0277
261594008712	FAD binding domain; Region: FAD_binding_4; pfam01565
261594008713	Protein of unknown function (DUF2871); Region: DUF2871; pfam11070
261594008714	methyltransferase, FkbM family; Region: fkbM_fam; TIGR01444
261594008715	Acetyltransferase (isoleucine patch superfamily) [General function prediction only]; Region: WbbJ; COG0110
261594008716	Maltose O-acyltransferase (MAT)-like: This family is composed of maltose O-acetyltransferase, galactoside O-acetyltransferase (GAT), xenobiotic acyltransferase (XAT) and similar proteins. MAT and GAT catalyze the CoA-dependent acetylation of the...; Region: LbH_MAT_like; cd04647
261594008717	trimer interface [polypeptide binding]; other site
261594008718	active site
261594008719	substrate binding site [chemical binding]; other site
261594008720	CoA binding site [chemical binding]; other site
261594008721	Predicted pyridoxal phosphate-dependent enzyme apparently involved in regulation of cell wall biogenesis [Cell envelope biogenesis, outer membrane]; Region: WecE; COG0399
261594008722	3-amino-5-hydroxybenzoic acid synthase family (AHBA_syn). AHBA_syn family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The members of this CD are involved in various biosynthetic pathways for secondary...; Region: AHBA_syn; cd00616
261594008723	inhibitor-cofactor binding pocket; inhibition site
261594008724	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594008725	catalytic residue [active]
261594008726	Glycosyltransferase like family 2; Region: Glyco_tranf_2_3; pfam13641
261594008727	Glycosyl transferase family 2; Region: Glycos_transf_2; pfam00535
261594008728	active site
261594008729	Glycosyltransferases involved in cell wall biogenesis [Cell envelope biogenesis, outer membrane]; Region: WcaA; COG0463
261594008730	Glycosyltransferase family A (GT-A) includes diverse families of glycosyl transferases with a common GT-A type structural fold; Region: Glyco_tranf_GTA_type; cl11394
261594008731	active site
261594008732	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594008733	Methyltransferase domain; Region: Methyltransf_23; pfam13489
261594008734	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4627
261594008735	enoyl-CoA hydratase; Provisional; Region: PRK06688
261594008736	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
261594008737	substrate binding site [chemical binding]; other site
261594008738	oxyanion hole (OAH) forming residues; other site
261594008739	trimer interface [polypeptide binding]; other site
261594008740	Peptidase family M9 N-terminal; Region: Peptidase_M9_N; pfam08453
261594008741	Peptidase Gluzincin family (thermolysin-like proteinases, TLPs) includes peptidases M1, M2, M3, M4, M13, M32 and M36 (fungalysins); Region: GluZincin; cl14813
261594008742	FOG: PKD repeat [General function prediction only]; Region: COG3291
261594008743	polycystic kidney disease I (PKD) domain; similar to other cell-surface modules, with an IG-like fold; domain probably functions as a ligand binding site in protein-protein or protein-carbohydrate interactions; a single instance of the repeat is...; Region: PKD; cd00146
261594008744	Bacterial pre-peptidase C-terminal domain; Region: PPC; pfam04151
261594008745	MgtC family; Region: MgtC; pfam02308
261594008746	Predicted acetyltransferase [General function prediction only]; Region: COG3981
261594008747	Acetyltransferase (GNAT) domain; Region: Acetyltransf_3; pfam13302
261594008748	Predicted ring-cleavage extradiol dioxygenase [General function prediction only]; Region: COG2514
261594008749	This conserved domain belongs to a superfamily including the bleomycin resistance protein, glyoxalase I, and type I ring-cleaving dioxygenases; Region: Glo_EDI_BRP_like_12; cd07255
261594008750	putative metal binding site [ion binding]; other site
261594008751	This domain superfamily is found in a variety of structurally related metalloproteins, including the type I extradiol dioxygenases, glyoxalase I and a group of antibiotic resistance proteins; Region: Glo_EDI_BRP_like; cl14632
261594008752	active site
261594008753	metal binding site [ion binding]; metal-binding site
261594008754	VanW like protein; Region: VanW; pfam04294
261594008755	Protein of unknown function (DUF3900); Region: DUF3900; pfam13039
261594008756	Domain of unknown function (DUF3898); Region: DUF3898; pfam13037
261594008757	exonuclease; Provisional; Region: PRK06722
261594008758	DEDDh 3'-5' exonuclease domain of Caenorhabditis elegans ERI-1, human 3' exonuclease, and similar proteins; Region: ERI-1_3'hExo_like; cd06133
261594008759	active site
261594008760	catalytic site [active]
261594008761	substrate binding site [chemical binding]; other site
261594008762	Cold-Shock Protein (CSP) contains an S1-like cold-shock domain (CSD) that is found in eukaryotes, prokaryotes, and archaea.  CSP's include the major cold-shock proteins CspA and CspB in bacteria and the eukaryotic gene regulatory factor Y-box...; Region: CSP_CDS; cd04458
261594008763	DNA-binding site [nucleotide binding]; DNA binding site
261594008764	RNA-binding motif; other site
261594008765	Uncharacterized protein related to plant photosystem II stability/assembly factor [General function prediction only]; Region: COG4447
261594008766	flavodoxin; Provisional; Region: PRK06703
261594008767	GPR1/FUN34/yaaH family; Region: Grp1_Fun34_YaaH; cl00685
261594008768	Nudix hydrolase is a superfamily of enzymes found in all three kingdoms of life, and it catalyzes the hydrolysis of NUcleoside DIphosphates linked to other moieties, X. Enzymes belonging to this superfamily require a divalent cation, such as Mg2+ or Mn2+...; Region: Nudix_Hydrolase; cl00447
261594008769	nudix motif; other site
261594008770	ASC-1 homology domain, subfamily similar to Pyrococcus furiosus Pf0470. The ASCH domain, a small beta-barrel domain found in all three kingdoms of life, resembles the RNA-binding PUA domain and may also interact with RNA. ASCH has been proposed to...; Region: ASCH_PF0470_like; cd06555
261594008771	Xenobiotic acyltransferase (XAT): The XAT class of hexapeptide acyltransferases is composed of a large number of microbial enzymes that catalyze the CoA-dependent acetylation of a variety of hydroxyl-bearing acceptors such as chloramphenicol and...; Region: LbH_XAT; cd03349
261594008772	trimer interface [polypeptide binding]; other site
261594008773	active site
261594008774	substrate binding site [chemical binding]; other site
261594008775	CoA binding site [chemical binding]; other site
261594008776	conserved repeat domain; Region: B_ant_repeat; TIGR01451
261594008777	conserved repeat domain; Region: B_ant_repeat; TIGR01451
261594008778	conserved repeat domain; Region: B_ant_repeat; TIGR01451
261594008779	conserved repeat domain; Region: B_ant_repeat; TIGR01451
261594008780	conserved repeat domain; Region: B_ant_repeat; TIGR01451
261594008781	conserved repeat domain; Region: B_ant_repeat; TIGR01451
261594008782	conserved repeat domain; Region: B_ant_repeat; TIGR01451
261594008783	Domain of unknown function DUF11; Region: DUF11; cl17728
261594008784	conserved repeat domain; Region: B_ant_repeat; TIGR01451
261594008785	conserved repeat domain; Region: B_ant_repeat; TIGR01451
261594008786	conserved repeat domain; Region: B_ant_repeat; TIGR01451
261594008787	conserved repeat domain; Region: B_ant_repeat; TIGR01451
261594008788	conserved repeat domain; Region: B_ant_repeat; TIGR01451
261594008789	short chain dehydrogenase; Provisional; Region: PRK06924
261594008790	sepiapterin reductase (SPR)-like, classical (c) SDRs; Region: SPR-like_SDR_c; cd05367
261594008791	NADP binding site [chemical binding]; other site
261594008792	homodimer interface [polypeptide binding]; other site
261594008793	active site
261594008794	Predicted acetyltransferase [General function prediction only]; Region: COG3393
261594008795	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cl17182
261594008796	argininosuccinate lyase; Provisional; Region: PRK06705
261594008797	Argininosuccinate lyase (argininosuccinase, ASAL); Region: Argininosuccinate_lyase; cd01359
261594008798	active sites [active]
261594008799	tetramer interface [polypeptide binding]; other site
261594008800	Beta-lactamase enzyme family; Region: Beta-lactamase2; cl17872
261594008801	Beta-lactamase enzyme family; Region: Beta-lactamase2; cl17872
261594008802	nuc_hydro: Nucleoside hydrolases. Nucleoside hydrolases cleave the N-glycosidic bond in nucleosides generating ribose and the respective base. These enzymes vary in their substrate specificity.  This group contains eukaryotic, bacterial and archeal...; Region: nuc_hydro; cd00455
261594008803	active site
261594008804	Predicted symporter [General function prediction only]; Region: DhlC; COG4147
261594008805	Na(+)/pantothenate cotransporters: PanF of Escherichia coli and related proteins; solute binding domain; Region: SLC5sbd_PanF; cd10327
261594008806	Na binding site [ion binding]; other site
261594008807	Protein of unknown function (DUF997); Region: DUF997; pfam06196
261594008808	ALDH subfamily: ALDH families 1and 2, including 10-formyltetrahydrofolate dehydrogenase, NAD+-dependent retinal dehydrogenase 1 and related proteins; Region: ALDH_F1-2_Ald2-like; cd07091
261594008809	Aldehyde dehydrogenase family; Region: Aldedh; pfam00171
261594008810	NAD(P) binding site [chemical binding]; other site
261594008811	catalytic residues [active]
261594008812	3-ketoacyl-(acyl-carrier-protein) reductase; Validated; Region: fabG; PRK05653
261594008813	beta-Keto acyl carrier protein reductase (BKR), involved in Type II FAS, classical (c) SDRs; Region: BKR_SDR_c; cd05333
261594008814	NAD(P) binding site [chemical binding]; other site
261594008815	homotetramer interface [polypeptide binding]; other site
261594008816	homodimer interface [polypeptide binding]; other site
261594008817	active site
261594008818	YfhD-like protein; Region: YfhD; pfam14151
261594008819	squalene-hopene cyclase; Region: hopene_cyclase; TIGR01507
261594008820	This group contains class II terpene cyclases, protein prenyltransferases beta subunit, two broadly specific proteinase inhibitors alpha2-macroglobulin (alpha (2)-M) and pregnancy zone protein (PZP) and, the C3 C4 and C5 components of vertebrate...; Region: ISOPREN_C2_like; cl08267
261594008821	Divergent PAP2 family; Region: DUF212; pfam02681
261594008822	Predicted permeases [General function prediction only]; Region: RarD; COG2962
261594008823	Protein of unknown function (DUF1294); Region: DUF1294; pfam06961
261594008824	antiporter inner membrane protein; Provisional; Region: PRK11670
261594008825	Domain of unknown function DUF59; Region: DUF59; pfam01883
261594008826	MRP (Multiple Resistance and pH adaptation) is a homologue of the Fer4_NifH superfamily. Like the other members of the superfamily, MRP contains a ATP-binding domain at the N-termini. It is found in bacteria as a membrane-spanning protein and functions...; Region: MRP-like; cd02037
261594008827	Walker A motif; other site
261594008828	Ubiquitin domain of MoaD-like proteins; Region: MoaD; cd00754
261594008829	MoaE interaction surface [polypeptide binding]; other site
261594008830	MoeB interaction surface [polypeptide binding]; other site
261594008831	thiocarboxylated glycine; other site
261594008832	MoaE family. Members of this family are involved in biosynthesis of the molybdenum cofactor (Moco), an essential cofactor for a diverse group of redox enzymes. Moco biosynthesis is an evolutionarily conserved pathway present in eubacteria, archaea and...; Region: MoaE; cd00756
261594008833	MoaE homodimer interface [polypeptide binding]; other site
261594008834	MoaD interaction [polypeptide binding]; other site
261594008835	active site residues [active]
261594008836	Molybdopterin biosynthesis enzyme [Coenzyme metabolism]; Region: MoeA; COG0303
261594008837	MoeA family. Members of this family are involved in biosynthesis of the molybdenum cofactor (MoCF), an essential cofactor of a diverse group of redox enzymes. MoCF biosynthesis is an evolutionarily conserved pathway present in eubacteria, archaea and...; Region: MoeA; cd00887
261594008838	dimer interface [polypeptide binding]; other site
261594008839	putative functional site; other site
261594008840	putative MPT binding site; other site
261594008841	thiamine/molybdopterin biosynthesis MoeB-like protein; Provisional; Region: PRK12475
261594008842	ThiF_MoeB_HesA. Family of E1-like enzymes involved in molybdopterin and thiamine biosynthesis family. The common reaction mechanism catalyzed by MoeB and ThiF, like other E1 enzymes, begins with a nucleophilic attack of the C-terminal carboxylate of MoaD...; Region: ThiF_MoeB_HesA_family; cd00757
261594008843	ATP binding site [chemical binding]; other site
261594008844	substrate interface [chemical binding]; other site
261594008845	Formate/nitrite transporter; Region: Form_Nir_trans; pfam01226
261594008846	molybdenum cofactor biosynthesis protein A; Reviewed; Region: moaA; PRK00164
261594008847	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
261594008848	FeS/SAM binding site; other site
261594008849	Molybdenum Cofactor Synthesis C; Region: Mob_synth_C; pfam06463
261594008850	formate dehydrogenase accessory protein; Reviewed; Region: PRK00724
261594008851	Uncharacterized conserved protein [Function unknown]; Region: COG5609
261594008852	Uncharacterized conserved protein [Function unknown]; Region: COG2427
261594008853	Uncharacterized anaerobic dehydrogenase [General function prediction only]; Region: COG3383
261594008854	2Fe-2S iron-sulfur cluster binding domain. Iron-sulfur proteins play an important role in electron transfer processes and in various enzymatic reactions. The family includes plant and algal ferredoxins, which act as electron carriers in photosynthesis...; Region: fer2; cd00207
261594008855	catalytic loop [active]
261594008856	iron binding site [ion binding]; other site
261594008857	NADH-ubiquinone oxidoreductase-G iron-sulfur binding region; Region: NADH-G_4Fe-4S_3; pfam10588
261594008858	4Fe-4S binding domain; Region: Fer4; pfam00037
261594008859	4Fe-4S binding domain; Region: Fer4; pfam00037
261594008860	Formate dehydrogenase H (Formate-Dh-H) catalyzes the reversible oxidation of formate to CO2 with the release of a proton and two electrons. It is a component of the anaerobic formate hydrogen lyase complex. The E. coli formate dehydrogenase H (Fdh-H) is...; Region: MopB_Formate-Dh-H; cd02753
261594008861	[4Fe-4S] binding site [ion binding]; other site
261594008862	molybdopterin cofactor binding site; other site
261594008863	Formate dehydrogenase N, alpha subunit (Formate-Dh-Na) is a major component of nitrate respiration in bacteria such as in the E. coli formate dehydrogenase N (Fdh-N). Fdh-N is a membrane protein that is a complex of three different subunits and is the...; Region: MopB_CT_Formate-Dh-Na-like; cd02792
261594008864	molybdopterin cofactor binding site; other site
261594008865	Bacillus/Clostridium GerA spore germination protein; Region: GerA; pfam03323
261594008866	spore germination protein (amino acid permease); Region: 2A0309; TIGR00912
261594008867	germination protein, Ger(x)C family; Region: spore_ger_x_C; TIGR02887
261594008868	Spore germination B3/ GerAC like, C-terminal; Region: Spore_GerAC; pfam05504
261594008869	Tubulin like; Region: Tubulin_2; pfam13809
261594008870	Von Willebrand factor type A (vWA) domain was originally found in the blood coagulation protein von Willebrand factor (vWF). Typically, the vWA domain is made up of approximately 200 amino acid residues folded into a classic a/b para-rossmann type of...; Region: vWFA; cd00198
261594008871	metal ion-dependent adhesion site (MIDAS); other site
261594008872	Methyltransferase domain; Region: Methyltransf_31; pfam13847
261594008873	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594008874	S-adenosylmethionine binding site [chemical binding]; other site
261594008875	O-methyltransferase; Region: Methyltransf_2; pfam00891
261594008876	ABC-type oligopeptide transport system, periplasmic component [Amino acid transport and metabolism]; Region: OppA; COG4166
261594008877	The substrate-binding component of an ABC-type oligopetide import system contains the type 2 periplasmic binding fold; Region: PBP2_OppA; cd08504
261594008878	peptide binding site [polypeptide binding]; other site
261594008879	ABC-type oligopeptide transport system, periplasmic component [Amino acid transport and metabolism]; Region: OppA; COG4166
261594008880	The substrate-binding component of an ABC-type oligopetide import system contains the type 2 periplasmic binding fold; Region: PBP2_OppA; cd08504
261594008881	peptide binding site [polypeptide binding]; other site
261594008882	ABC-type oligopeptide transport system, periplasmic component [Amino acid transport and metabolism]; Region: OppA; COG4166
261594008883	The substrate-binding component of an ABC-type oligopetide import system contains the type 2 periplasmic binding fold; Region: PBP2_OppA; cd08504
261594008884	peptide binding site [polypeptide binding]; other site
261594008885	Transcriptional regulator [Transcription]; Region: LytR; COG1316
261594008886	RNA polymerase sigma-70 factor, TIGR02954 family; Region: Sig70_famx3
261594008887	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
261594008888	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
261594008889	DNA binding residues [nucleotide binding]
261594008890	ABC-type multidrug transport system, ATPase component [Defense mechanisms]; Region: CcmA; COG1131
261594008891	ATP-binding cassette domain of the drug resistance transporter and related proteins, subfamily A; Region: ABC_DR_subfamily_A; cd03230
261594008892	Walker A/P-loop; other site
261594008893	ATP binding site [chemical binding]; other site
261594008894	Q-loop/lid; other site
261594008895	ABC transporter signature motif; other site
261594008896	Walker B; other site
261594008897	D-loop; other site
261594008898	H-loop/switch region; other site
261594008899	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
261594008900	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
261594008901	putative oxidoreductase; Provisional; Region: PRK11579
261594008902	Oxidoreductase family, NAD-binding Rossmann fold; Region: GFO_IDH_MocA; pfam01408
261594008903	Oxidoreductase family, C-terminal alpha/beta domain; Region: GFO_IDH_MocA_C; pfam02894
261594008904	DNA topoisomerase IV subunit A; Validated; Region: PRK05561
261594008905	DNA Topoisomerase, subtype IIA; domain A'; bacterial DNA topoisomerase IV (C subunit, ParC), bacterial DNA gyrases (A subunit, GyrA),mammalian DNA toposiomerases II. DNA topoisomerases are essential enzymes that regulate the conformational changes...; Region: TOP4c; cd00187
261594008906	CAP-like domain; other site
261594008907	active site
261594008908	primary dimer interface [polypeptide binding]; other site
261594008909	DNA gyrase C-terminal domain, beta-propeller; Region: DNA_gyraseA_C; pfam03989
261594008910	DNA gyrase C-terminal domain, beta-propeller; Region: DNA_gyraseA_C; pfam03989
261594008911	DNA gyrase C-terminal domain, beta-propeller; Region: DNA_gyraseA_C; pfam03989
261594008912	DNA gyrase C-terminal domain, beta-propeller; Region: DNA_gyraseA_C; pfam03989
261594008913	DNA gyrase subunit B; Validated; Region: gyrB; PRK05644
261594008914	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594008915	ATP binding site [chemical binding]; other site
261594008916	Mg2+ binding site [ion binding]; other site
261594008917	G-X-G motif; other site
261594008918	TopoIIA_Trans_DNA_gyrase: Transducer domain, having a ribosomal S5 domain 2-like fold, of the type found in proteins of the type IIA family of DNA topoisomerases similar to the B subunits of E. coli DNA gyrase and E. coli Topoisomerase IV which are; Region: TopoII_Trans_DNA_gyrase; cd00822
261594008919	anchoring element; other site
261594008920	dimer interface [polypeptide binding]; other site
261594008921	ATP binding site [chemical binding]; other site
261594008922	TOPRIM_TopoIIA_GyrB: topoisomerase-primase (TOPRIM) nucleotidyl transferase/hydrolase domain of the type found in proteins of the type IIA family of DNA topoisomerases similar to the Escherichia coli GyrB subunit. TopoIIA enzymes cut both strands of the...; Region: TOPRIM_TopoIIA_GyrB; cd03366
261594008923	active site
261594008924	putative metal-binding site [ion binding]; other site
261594008925	DNA gyrase B subunit, carboxyl terminus; Region: DNA_gyraseB_C; pfam00986
261594008926	Predicted CoA-binding protein [General function prediction only]; Region: COG1832
261594008927	Trypsin-like peptidase domain; Region: Trypsin_2; pfam13365
261594008928	PDZ domain of tryspin-like serine proteases, such as DegP/HtrA, which are oligomeric proteins involved in heat-shock response, chaperone function, and apoptosis. May be responsible for substrate recognition and/or binding, as most PDZ domains bind...; Region: PDZ_serine_protease; cd00987
261594008929	protein binding site [polypeptide binding]; other site
261594008930	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
261594008931	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594008932	active site
261594008933	phosphorylation site [posttranslational modification]
261594008934	intermolecular recognition site; other site
261594008935	dimerization interface [polypeptide binding]; other site
261594008936	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
261594008937	DNA binding site [nucleotide binding]
261594008938	anaerobic ribonucleoside triphosphate reductase; Provisional; Region: PRK14704
261594008939	Class III ribonucleotide reductase; Region: RNR_III; cd01675
261594008940	effector binding site; other site
261594008941	active site
261594008942	Zn binding site [ion binding]; other site
261594008943	glycine loop; other site
261594008944	putative glycerol-3-phosphate acyltransferase PlsY; Provisional; Region: PRK00220
261594008945	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4841
261594008946	4-hydroxybenzoyl-CoA thioesterase (4HBT). Catalyzes the final step in the 4-chlorobenzoate degradation pathway in which 4-chlorobenzoate is converted to 4-hydroxybenzoate in certain soil-dwelling bacteria. 4HBT forms a homotetramer with four active sites; Region: 4HBT; cd00586
261594008947	active site
261594008948	Predicted glycosyl hydrolase [General function prediction only]; Region: COG3858
261594008949	Lysine Motif is a small domain involved in binding peptidoglycan; Region: LysM; cd00118
261594008950	Lysine Motif is a small domain involved in binding peptidoglycan; Region: LysM; cd00118
261594008951	Cortical fragment-lytic enzyme (CFLE) is a peptidoglycan hydrolase involved in  bacterial endospore germination.  CFLE is expressed as an inactive preprotein (called SleB) in the forespore compartment of sporulating cells.  SleB translocates across the...; Region: GH18_CFLE_spore_hydrolase; cd02874
261594008952	active site
261594008953	small acid-soluble spore protein Tlp; Provisional; Region: PRK03830
261594008954	acid-soluble spore protein N; Provisional; Region: sspN; PRK09398
261594008955	Protein of unknown function (DUF3901); Region: DUF3901; pfam13040
261594008956	DNA polymerase III subunit epsilon; Validated; Region: PRK06807
261594008957	DEDDh 3'-5' exonuclease domain family; Region: DEDDh; cd06127
261594008958	active site
261594008959	catalytic site [active]
261594008960	substrate binding site [chemical binding]; other site
261594008961	TlpA-like family; composed of  TlpA, ResA, DsbE and similar proteins. TlpA, ResA and DsbE are bacterial protein disulfide reductases with important roles in cytochrome maturation. They are membrane-anchored proteins with a soluble TRX domain containing a...; Region: TlpA_like_family; cd02966
261594008962	Thioredoxin-like; Region: Thioredoxin_8; pfam13905
261594008963	catalytic residues [active]
261594008964	ABC-type multidrug transport system, ATPase and permease components [Defense mechanisms]; Region: MdlB; COG1132
261594008965	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
261594008966	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
261594008967	Walker A/P-loop; other site
261594008968	ATP binding site [chemical binding]; other site
261594008969	Q-loop/lid; other site
261594008970	ABC transporter signature motif; other site
261594008971	Walker B; other site
261594008972	D-loop; other site
261594008973	H-loop/switch region; other site
261594008974	aconitate hydratase; Validated; Region: PRK09277
261594008975	Aconitase A catalytic domain; Region: AcnA_IRP; cd01586
261594008976	substrate binding site [chemical binding]; other site
261594008977	ligand binding site [chemical binding]; other site
261594008978	Aconitase A swivel domain. This is the major form of the TCA cycle enzyme aconitate hydratase, also known as aconitase and citrate hydro-lyase. It includes bacterial and archaeal aconitase A, and the eukaryotic cytosolic form of aconitase. This group...; Region: AcnA_IRP_Swivel; cd01580
261594008979	substrate binding site [chemical binding]; other site
261594008980	acid-soluble spore protein O; Provisional; Region: sspO; PRK02984
261594008981	Predicted xylanase/chitin deacetylase [Carbohydrate transport and metabolism]; Region: CDA1; COG0726
261594008982	Catalytic NodB homology domain of rhizobial NodB-like proteins; Region: CE4_NodB_like_6s_7s; cd10917
261594008983	NodB motif; other site
261594008984	active site
261594008985	catalytic site [active]
261594008986	metal binding site [ion binding]; metal-binding site
261594008987	Molecular chaperone (small heat shock protein) [Posttranslational modification, protein turnover, chaperones]; Region: IbpA; COG0071
261594008988	Alpha-crystallin domain (ACD) of alpha-crystallin-type small(s) heat shock proteins (Hsps). sHsps are small stress induced proteins with monomeric masses between 12 -43 kDa, whose common feature is the Alpha-crystallin domain  (ACD). sHsps are generally...; Region: ACD_sHsps-like; cd06464
261594008989	putative dimer interface [polypeptide binding]; other site
261594008990	BT1 family; Region: BT1; pfam03092
261594008991	Predicted metal-dependent hydrolases related to alanyl-tRNA synthetase HxxxH domain [General function prediction only]; Region: COG2872
261594008992	Threonyl and Alanyl tRNA synthetase second additional domain; Region: tRNA_SAD; smart00863
261594008993	Nudix hydrolase is a superfamily of enzymes found in all three kingdoms of life, and it catalyzes the hydrolysis of NUcleoside DIphosphates linked to other moieties, X. Enzymes belonging to this superfamily require a divalent cation, such as Mg2+ or Mn2+...; Region: Nudix_Hydrolase; cd02883
261594008994	nudix motif; other site
261594008995	SAP domain; Region: SAP; pfam02037
261594008996	acetyl-CoA acetyltransferase; Provisional; Region: PRK06690
261594008997	Thiolase are ubiquitous enzymes that catalyze the reversible thiolytic cleavage of 3-ketoacyl-CoA into acyl-CoA and acetyl-CoA, a 2-step reaction involving a covalent intermediate formed with a catalytic cysteine. They are found in prokaryotes and...; Region: thiolase; cd00751
261594008998	dimer interface [polypeptide binding]; other site
261594008999	active site
261594009000	acyl-CoA synthetase; Validated; Region: PRK07638
261594009001	Adenylate forming domain, Class I; Region: AFD_class_I; cl17068
261594009002	Adenylate forming domain, Class I; Region: AFD_class_I; cl17068
261594009003	acyl-activating enzyme (AAE) consensus motif; other site
261594009004	acyl-activating enzyme (AAE) consensus motif; other site
261594009005	AMP binding site [chemical binding]; other site
261594009006	active site
261594009007	CoA binding site [chemical binding]; other site
261594009008	BioY family; Region: BioY; pfam02632
261594009009	long-chain-fatty-acid--CoA ligase; Validated; Region: PRK06187
261594009010	Fatty acyl-CoA synthetases similar to LC-FACS from Thermus thermophiles; Region: ttLC_FACS_AlkK_like; cd12119
261594009011	dimer interface [polypeptide binding]; other site
261594009012	acyl-activating enzyme (AAE) consensus motif; other site
261594009013	putative active site [active]
261594009014	AMP binding site [chemical binding]; other site
261594009015	putative CoA binding site [chemical binding]; other site
261594009016	GCN5-related N-acetyltransferases (GNAT) represent a large superfamily of functionally diverse enzymes that catalyze the transfer of an acetyl group from acetyl-Coenzyme A to the primary amine of a wide range of acceptor substrates. Members of this...; Region: GNAT; cl00443
261594009017	Coenzyme A binding pocket; other site
261594009018	S-layer homology domain; Region: SLH; pfam00395
261594009019	S-layer homology domain; Region: SLH; pfam00395
261594009020	S-layer homology domain; Region: SLH; pfam00395
261594009021	Cytidine deaminase zinc-binding domain. These enzymes are Zn dependent. The zinc ion in the active site plays a central role in the proposed catalytic mechanism, activating a water molecule to form a hydroxide ion that performs a nucleophilic attack on...; Region: cytidine_deaminase; cd01283
261594009022	active site
261594009023	catalytic motif [active]
261594009024	Zn binding site [ion binding]; other site
261594009025	Uncharacterized conserved protein (DUF2164); Region: DUF2164; pfam09932
261594009026	Peptidoglycan recognition proteins (PGRPs) are pattern recognition receptors that bind, and in certain cases, hydrolyze peptidoglycans (PGNs) of bacterial cell walls. PGRPs have been divided into three classes: short PGRPs (PGRP-S), that are small (20...; Region: PGRP; cd06583
261594009027	amidase catalytic site [active]
261594009028	Zn binding residues [ion binding]; other site
261594009029	substrate binding site [chemical binding]; other site
261594009030	active site
261594009031	Protein phosphatase 2C; Region: PP2C_2; pfam13672
261594009032	Uncharacterized conserved protein [Function unknown]; Region: COG1284
261594009033	Uncharacterized protein conserved in bacteria (DUF2179); Region: DUF2179; pfam10035
261594009034	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
261594009035	This conserved domain belongs to a superfamily including the bleomycin resistance protein, glyoxalase I, and type I ring-cleaving dioxygenases; Region: Glo_EDI_BRP_like_9; cd07245
261594009036	dimer interface [polypeptide binding]; other site
261594009037	putative metal binding site [ion binding]; other site
261594009038	PAS domain S-box; Region: sensory_box; TIGR00229
261594009039	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
261594009040	putative active site [active]
261594009041	heme pocket [chemical binding]; other site
261594009042	phosphate regulon sensor kinase PhoR; Region: phoR_proteo; TIGR02966
261594009043	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
261594009044	putative active site [active]
261594009045	heme pocket [chemical binding]; other site
261594009046	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
261594009047	dimer interface [polypeptide binding]; other site
261594009048	phosphorylation site [posttranslational modification]
261594009049	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594009050	ATP binding site [chemical binding]; other site
261594009051	Mg2+ binding site [ion binding]; other site
261594009052	G-X-G motif; other site
261594009053	Predicted esterase [General function prediction only]; Region: COG0400
261594009054	putative hydrolase; Provisional; Region: PRK11460
261594009055	N-terminal domain of Sphingobium chlorophenolicum 2,6-dichloro-p-hydroquinone 1,2-dioxygenase (PcpA), and similar proteins; Region: PcpA_N_like; cd08346
261594009056	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
261594009057	Zn binding site [ion binding]; other site
261594009058	C-terminal domain of Sphingobium chlorophenolicum 2,6-dichloro-p-hydroquinone 1,2-dioxygenase (PcpA), and similar proteins; Region: PcpA_C_like; cd08347
261594009059	Zn binding site [ion binding]; other site
261594009060	Na(+)/proline cotransporter PutP and related proteins; solute binding domain; Region: SLC5sbd_PutP; cd11475
261594009061	Predicted symporter [General function prediction only]; Region: DhlC; COG4147
261594009062	Na binding site [ion binding]; other site
261594009063	Glutamate synthase domain 2 [Amino acid transport and metabolism]; Region: GltB; COG0069
261594009064	Glutamate synthase (GltS) FMN-binding domain.  GltS is a complex iron-sulfur flavoprotein that catalyzes the reductive synthesis of L-glutamate from 2-oxoglutarate and L-glutamine via intramolecular channelling of ammonia, a reaction in the plant, yeast...; Region: GltS_FMN; cd02808
261594009065	active site
261594009066	FMN binding site [chemical binding]; other site
261594009067	substrate binding site [chemical binding]; other site
261594009068	3Fe-4S cluster binding site [ion binding]; other site
261594009069	NADH:flavin oxidoreductases, Old Yellow Enzyme family [Energy production and conversion]; Region: NemA; COG1902
261594009070	Old yellow enzyme (OYE)-like FMN binding domain. OYE was the first flavin-dependent enzyme identified, however its true physiological role remains elusive to this day. Each monomer of OYE contains FMN as a non-covalently bound cofactor, uses NADPH as a...; Region: OYE_like_FMN; cd02933
261594009071	FMN binding site [chemical binding]; other site
261594009072	active site
261594009073	substrate binding site [chemical binding]; other site
261594009074	catalytic residue [active]
261594009075	Transcriptional regulators, similar to M. xanthus CarD [Transcription]; Region: COG1329
261594009076	agmatinase; Region: agmatinase; TIGR01230
261594009077	Agmatinase-like family; Region: Agmatinase-like; cd09990
261594009078	active site
261594009079	oligomer interface [polypeptide binding]; other site
261594009080	Mn binding site [ion binding]; other site
261594009081	imidazolonepropionase; Validated; Region: PRK09356
261594009082	Imidazolonepropionase/imidazolone-5-propionate hydrolase (Imidazolone-5PH) catalyzes the third step in the histidine degradation pathway, the hydrolysis of (S)-3-(5-oxo-4,5-dihydro-3H-imidazol-4-yl)propanoate to N-formimidoyl-L-glutamate. In bacteria; Region: Imidazolone-5PH; cd01296
261594009083	active site
261594009084	urocanate hydratase; Provisional; Region: PRK05414
261594009085	Phenylalanine ammonia-lyase (PAL) and histidine ammonia-lyase (HAL); Region: PAL-HAL; cd00332
261594009086	active sites [active]
261594009087	tetramer interface [polypeptide binding]; other site
261594009088	Histidine Utilizing Protein, the hut operon positive regulatory protein; Region: HutP; cd11640
261594009089	hexamer interface [polypeptide binding]; other site
261594009090	RNA binding site [nucleotide binding]; other site
261594009091	Histidine-zinc binding site [chemical binding]; other site
261594009092	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594009093	S-adenosylmethionine binding site [chemical binding]; other site
261594009094	DJ-1 family protein; Region: not_thiJ; TIGR01383
261594009095	Type 1 glutamine amidotransferase (GATase1)-like domain found in a subgroup of proteins similar to PfpI from Pyrococcus furiosus; Region: GATase1_PfpI_3; cd03140
261594009096	conserved cys residue [active]
261594009097	Nucleoside/nucleotide kinase (NK) is a protein superfamily consisting of multiple families of enzymes that share structural similarity and are functionally related to the catalysis of the reversible phosphate group transfer from nucleoside triphosphates...; Region: NK; cl17190
261594009098	AAA domain; Region: AAA_28; pfam13521
261594009099	active site
261594009100	Protein of unknown function (DUF2621); Region: DUF2621; pfam11084
261594009101	Protein of unknown function (DUF1453); Region: DUF1453; pfam07301
261594009102	Cytochrome c biogenesis protein [Posttranslational modification, protein turnover, chaperones]; Region: CcdA; COG0785
261594009103	Cytochrome C biogenesis protein transmembrane region; Region: DsbD; pfam02683
261594009104	DNA-binding transcriptional regulator HcaR; Provisional; Region: PRK09906
261594009105	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
261594009106	The C-terminal substrate binding domain of LysR-type trnascriptional regulator AlsR, which regulates acetoin formation under stationary phase growth conditions; contains the type 2 periplasmic binding fold; Region: PBP2_AlsR; cd08452
261594009107	putative dimerization interface [polypeptide binding]; other site
261594009108	putative substrate binding pocket [chemical binding]; other site
261594009109	holin-like protein; Validated; Region: PRK01658
261594009110	Putative effector of murein hydrolase [Cell envelope biogenesis, outer membrane]; Region: LrgB; COG1346
261594009111	Nudix hydrolase is a superfamily of enzymes found in all three kingdoms of life, and it catalyzes the hydrolysis of NUcleoside DIphosphates linked to other moieties, X. Enzymes belonging to this superfamily require a divalent cation, such as Mg2+ or Mn2+...; Region: Nudix_Hydrolase; cd02883
261594009112	nudix motif; other site
261594009113	Domain of unknown function (DUF3903); Region: DUF3903; pfam13043
261594009114	Peptidoglycan recognition proteins (PGRPs) are pattern recognition receptors that bind, and in certain cases, hydrolyze peptidoglycans (PGNs) of bacterial cell walls. PGRPs have been divided into three classes: short PGRPs (PGRP-S), that are small (20...; Region: PGRP; cd06583
261594009115	amidase catalytic site [active]
261594009116	Zn binding residues [ion binding]; other site
261594009117	substrate binding site [chemical binding]; other site
261594009118	S-layer homology domain; Region: SLH; pfam00395
261594009119	S-layer homology domain; Region: SLH; pfam00395
261594009120	S-layer homology domain; Region: SLH; pfam00395
261594009121	Nuclease-related domain; Region: NERD; pfam08378
261594009122	ABC-type multidrug transport system, ATPase and permease components [Defense mechanisms]; Region: MdlB; COG1132
261594009123	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
261594009124	ATP-binding cassette domain of glucan transporter and related proteins, subfamily C; Region: ABCC_Glucan_exporter_like; cd03254
261594009125	Walker A/P-loop; other site
261594009126	ATP binding site [chemical binding]; other site
261594009127	Q-loop/lid; other site
261594009128	ABC transporter signature motif; other site
261594009129	Walker B; other site
261594009130	D-loop; other site
261594009131	H-loop/switch region; other site
261594009132	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
261594009133	putative multidrug transporter membrane\ATP-binding components; Provisional; Region: PRK10789
261594009134	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
261594009135	Walker A/P-loop; other site
261594009136	ATP binding site [chemical binding]; other site
261594009137	Q-loop/lid; other site
261594009138	ABC transporter signature motif; other site
261594009139	Walker B; other site
261594009140	D-loop; other site
261594009141	H-loop/switch region; other site
261594009142	hypothetical protein; Provisional; Region: PRK01844
261594009143	Protein of unknown function (DUF2522); Region: DUF2522; pfam10747
261594009144	Transketolase [Carbohydrate transport and metabolism]; Region: TktA; COG0021
261594009145	Thiamine pyrophosphate (TPP) family, Transketolase (TK) subfamily, TPP-binding module; TK catalyzes the transfer of a two-carbon unit from ketose phosphates to aldose phosphates. In heterotrophic organisms, TK provides a link between glycolysis and the...; Region: TPP_TK; cd02012
261594009146	TPP-binding site [chemical binding]; other site
261594009147	dimer interface [polypeptide binding]; other site
261594009148	Pyrimidine (PYR) binding domain of 1-deoxy-D-xylulose-5-phosphate synthase (DXS), transketolase (TK), and related proteins; Region: TPP_PYR_DXS_TK_like; cd07033
261594009149	PYR/PP interface [polypeptide binding]; other site
261594009150	dimer interface [polypeptide binding]; other site
261594009151	TPP binding site [chemical binding]; other site
261594009152	Transketolase, C-terminal domain; Region: Transketolase_C; pfam02780
261594009153	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG0675
261594009154	Helix-turn-helix domain; Region: HTH_OrfB_IS605; pfam12323
261594009155	Probable transposase; Region: OrfB_IS605; pfam01385
261594009156	phosphonate ABC transporter, permease protein PhnE; Region: PhnE; TIGR01097
261594009157	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
261594009158	dimer interface [polypeptide binding]; other site
261594009159	conserved gate region; other site
261594009160	ABC-ATPase subunit interface; other site
261594009161	phosphonate ABC transporter, permease protein PhnE; Region: PhnE; TIGR01097
261594009162	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
261594009163	dimer interface [polypeptide binding]; other site
261594009164	conserved gate region; other site
261594009165	ABC-ATPase subunit interface; other site
261594009166	ABC-type phosphate/phosphonate transport system, ATPase component [Inorganic ion transport and metabolism]; Region: COG3638
261594009167	ATP-binding cassette domain of the binding protein-dependent phosphonate transport system; Region: ABC_PhnC_transporter; cd03256
261594009168	Walker A/P-loop; other site
261594009169	ATP binding site [chemical binding]; other site
261594009170	Q-loop/lid; other site
261594009171	ABC transporter signature motif; other site
261594009172	Walker B; other site
261594009173	D-loop; other site
261594009174	H-loop/switch region; other site
261594009175	ABC-type phosphate/phosphonate transport system, periplasmic component [Inorganic ion transport and metabolism]; Region: PhnD; COG3221
261594009176	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
261594009177	membrane-bound complex binding site; other site
261594009178	hypothetical protein; Provisional; Region: PRK01546
261594009179	Site-specific recombinases, DNA invertase Pin homologs [DNA replication, recombination, and repair]; Region: PinR; COG1961
261594009180	Serine Recombinase family, catalytic domain; a DNA binding domain may be present either N- or C-terminal to the catalytic domain. These enzymes perform site-specific recombination of DNA molecules by a concerted, four-strand cleavage and rejoining...; Region: Ser_Recombinase; cd00338
261594009181	catalytic residues [active]
261594009182	catalytic nucleophile [active]
261594009183	LexA repressor; Validated; Region: PRK00215
261594009184	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
261594009185	putative DNA binding site [nucleotide binding]; other site
261594009186	putative Zn2+ binding site [ion binding]; other site
261594009187	Peptidase S24 LexA-like proteins are involved in the SOS response leading to the repair of single-stranded DNA within the bacterial cell. This family includes: the lambda repressor CI/C2 family and related bacterial prophage repressor proteins; LexA (EC...; Region: S24_LexA-like; cd06529
261594009188	Catalytic site [active]
261594009189	Domain of unknown function (DUF4097); Region: DUF4097; pfam13349
261594009190	Domain of unknown function (DUF4098); Region: DUF4098; pfam13345
261594009191	Protein of unknown function (DUF1700); Region: DUF1700; pfam08006
261594009192	Predicted transcriptional regulators [Transcription]; Region: COG1695
261594009193	Transcriptional regulator PadR-like family; Region: PadR; pfam03551
261594009194	'lysogenic prophage region PHAGE04; Best Hits not completed. attL/R=ggatat[ca]ttccgcacacaagttcaccaatgggaacgcgatcaatatat gtctcttta.  attL occurs within, but close to the terminus of the 3' end of ORF03960, a good house-keeping gene?'
261594009195	Tetratricopeptide repeat; Region: TPR_12; pfam13424
261594009196	Helix-turn-helix domain; Region: HTH_17; pfam12728
261594009197	Helix-turn-helix domain; Region: HTH_17; pfam12728
261594009198	Peptidoglycan recognition proteins (PGRPs) are pattern recognition receptors that bind, and in certain cases, hydrolyze peptidoglycans (PGNs) of bacterial cell walls. PGRPs have been divided into three classes: short PGRPs (PGRP-S), that are small (20...; Region: PGRP; cd06583
261594009199	amidase catalytic site [active]
261594009200	Zn binding residues [ion binding]; other site
261594009201	substrate binding site [chemical binding]; other site
261594009202	Bacterial SH3 domain; Region: SH3_3; cl17532
261594009203	Bacterial SH3 domain; Region: SH3_3; pfam08239
261594009204	Phage-related holin (Lysis protein) [General function prediction only]; Region: COG4824
261594009205	Antidote-toxin recognition MazE; Region: Antitoxin-MazE; cl00877
261594009206	Phage-related protein [Function unknown]; Region: COG5412
261594009207	membrane protein P6; Region: PHA01399
261594009208	Phage-related minor tail protein [Function unknown]; Region: COG5280
261594009209	phage major tail protein, phi13 family; Region: maj_tail_phi13; TIGR01603
261594009210	DsrH like protein; Region: DsrH; cl17347
261594009211	Phage head-tail joining protein; Region: Phage_H_T_join; cl11461
261594009212	uncharacterized phage protein (possible DNA packaging); Region: put_DNA_pack; TIGR01560
261594009213	phage major capsid protein, HK97 family; Region: major_cap_HK97; TIGR01554
261594009214	Phage capsid family; Region: Phage_capsid; pfam05065
261594009215	Caudovirus prohead protease; Region: Peptidase_U35; pfam04586
261594009216	Phage portal protein; Region: Phage_portal; pfam04860
261594009217	Phage-related protein [Function unknown]; Region: COG4695; cl01923
261594009218	Phage terminase-like protein, large subunit [General function prediction only]; Region: COG4626
261594009219	Uncharacterized protein family (UPF0150); Region: UPF0150; pfam03681
261594009220	Helix-turn-helix domain; Region: HTH_17; pfam12728
261594009221	HNH endonuclease; Region: HNH_2; pfam13391
261594009222	Nucleoside Triphosphate Pyrophosphohydrolase (EC 3.6.1.8) MazG-like domain found in mouse RS21-C6 protein and its homologs; Region: NTP-PPase_RS21-C6_like; cd11537
261594009223	homodimer interface [polypeptide binding]; other site
261594009224	chemical substrate binding site [chemical binding]; other site
261594009225	oligomer interface [polypeptide binding]; other site
261594009226	metal binding site [ion binding]; metal-binding site
261594009227	Predicted restriction endonuclease [Defense mechanisms]; Region: COG3183
261594009228	HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cd00085
261594009229	active site
261594009230	AIPR protein; Region: AIPR; pfam10592
261594009231	positive control sigma-like factor; Validated; Region: PRK06930
261594009232	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
261594009233	DNA binding residues [nucleotide binding]
261594009234	Lecithin:cholesterol acyltransferase; Region: LACT; pfam02450
261594009235	PGAP1-like protein; Region: PGAP1; pfam07819
261594009236	phage transcriptional regulator, ArpU family; Region: phage_arpU; TIGR01637
261594009237	Superfamily of nucleases including Short Patch Repair (Vsr) Endonucleases, archaeal Holliday junction resolvases, MutH methy-directed DNA mismatch-repair endonucleases, and catalytic domains of many restriction endonucleases, such as EcoRI, BamHI, and...; Region: Restriction_endonuclease_like; cl00277
261594009238	thymidylate synthase, flavin-dependent; Region: thyX; TIGR02170
261594009239	Cytosine-C5 specific DNA methylases; Methyl transfer reactions play an important role in many aspects of biology. Cytosine-specific DNA methylases are found both in prokaryotes and eukaryotes. DNA methylation, or the covalent addition of a methyl group...; Region: Cyt_C5_DNA_methylase; cd00315
261594009240	Site-specific DNA methylase [DNA replication, recombination, and repair]; Region: Dcm; COG0270
261594009241	cofactor binding site; other site
261594009242	DNA binding site [nucleotide binding]
261594009243	substrate interaction site [chemical binding]; other site
261594009244	dUTPase; Region: dUTPase_2; pfam08761
261594009245	Nucleoside Triphosphate Pyrophosphohydrolase (EC 3.6.1.8) MazG-like domain found in dimeric 2-Deoxyuridine 5'-triphosphate nucleotidohydrolase and similar proteins; Region: NTP-PPase_dUTPase; cd11527
261594009246	active site
261594009247	homodimer interface [polypeptide binding]; other site
261594009248	metal binding site [ion binding]; metal-binding site
261594009249	Nucleoside Triphosphate Pyrophosphohydrolase (EC 3.6.1.8) MazG-like domain superfamily; Region: NTP-PPase; cl16941
261594009250	Uncharacterized Zn-finger containing protein [General function prediction only]; Region: COG1645
261594009251	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
261594009252	ATPases associated with a variety of cellular activities; Region: AAA; smart00382
261594009253	Walker A motif; other site
261594009254	ATP binding site [chemical binding]; other site
261594009255	Walker B motif; other site
261594009256	phage conserved hypothetical protein, C-terminal domain; Region: phg_TIGR02220
261594009257	Protein of unknown function (DUF1071); Region: DUF1071; pfam06378
261594009258	Siphovirus Gp157; Region: Sipho_Gp157; pfam05565
261594009259	Domain of unknown function (DUF771); Region: DUF771; pfam05595
261594009260	Phage regulatory protein Rha (Phage_pRha); Region: Phage_pRha; cl10713
261594009261	ORF6C domain; Region: ORF6C; pfam10552
261594009262	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
261594009263	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
261594009264	non-specific DNA binding site [nucleotide binding]; other site
261594009265	salt bridge; other site
261594009266	sequence-specific DNA binding site [nucleotide binding]; other site
261594009267	Domain of unknown function (DUF955); Region: DUF955; cl01076
261594009268	glutamine synthetase, type I; Region: GlnA; TIGR00653
261594009269	Glutamine synthetase, beta-Grasp domain; Region: Gln-synt_N; pfam03951
261594009270	Glutamine synthetase, catalytic domain; Region: Gln-synt_C; pfam00120
261594009271	Helix-Turn-Helix DNA binding domain of GlnR-like transcription regulators; Region: HTH_GlnR-like; cd01105
261594009272	MerR HTH family regulatory protein; Region: MerR_1; pfam13411
261594009273	DNA binding residues [nucleotide binding]
261594009274	Cystathionine beta-lyase family protein involved in aluminum resistance [Inorganic ion transport and metabolism]; Region: COG4100
261594009275	Aluminium resistance protein; Region: Alum_res; pfam06838
261594009276	Predicted membrane protein [Function unknown]; Region: COG2860
261594009277	UPF0126 domain; Region: UPF0126; pfam03458
261594009278	UPF0126 domain; Region: UPF0126; pfam03458
261594009279	stage V sporulation protein K; Region: spore_V_K; TIGR02881
261594009280	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
261594009281	Walker A motif; other site
261594009282	ATP binding site [chemical binding]; other site
261594009283	Walker B motif; other site
261594009284	arginine finger; other site
261594009285	Phage integrase, N-terminal SAM-like domain; Region: Phage_integr_N2; pfam13495
261594009286	DNA breaking-rejoining enzymes, intergrase/recombinases, C-terminal catalytic domain. The tyrosine recombinase/integrase family share the same catalytic domain containing six conserved active site residues. The best-studied members of this diverse family...; Region: INT_REC_C; cd01182
261594009287	active site
261594009288	catalytic residues [active]
261594009289	DNA binding site [nucleotide binding]
261594009290	Int/Topo IB signature motif; other site
261594009291	Carbohydrate Binding Module 6 (CBM6) and CBM35_like superfamily; Region: CBM6-CBM35-CBM36_like; cl14880
261594009292	bacterial Hfq-like; Region: Hfq; cd01716
261594009293	hexamer interface [polypeptide binding]; other site
261594009294	Sm1 motif; other site
261594009295	RNA binding site [nucleotide binding]; other site
261594009296	Sm2 motif; other site
261594009297	tRNA delta(2)-isopentenylpyrophosphate transferase; Reviewed; Region: miaA; PRK00091
261594009298	tRNA delta(2)-isopentenylpyrophosphate transferase [Translation, ribosomal structure and biogenesis]; Region: MiaA; COG0324
261594009299	Bacterial SH3 domain; Region: SH3_3; pfam08239
261594009300	Bacterial SH3 domain; Region: SH3_3; pfam08239
261594009301	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3584
261594009302	PTS system 2-O-a-mannosyl-D-glycerate specific transporter subunit IIABC; Provisional; Region: PRK09765
261594009303	PTS_IIA, PTS system, fructose/mannitol specific IIA subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This...; Region: PTS_IIA_fru; cd00211
261594009304	active site
261594009305	phosphorylation site [posttranslational modification]
261594009306	PTS_IIB_fructose: subunit IIB of enzyme II (EII) of the fructose-specific phosphoenolpyruvate:carbohydrate phosphotransferase system (PTS). In this system, EII (also referred to as FruAB) is a fructose-specific permease made up of two proteins (FruA and...; Region: PTS_IIB_fructose; cd05569
261594009307	active site
261594009308	P-loop; other site
261594009309	phosphorylation site [posttranslational modification]
261594009310	Phosphotransferase system, fructose-specific IIC component [Carbohydrate transport and metabolism]; Region: FruA; cl17425
261594009311	Fructose-1-phosphate kinase and related fructose-6-phosphate kinase (PfkB) [Carbohydrate transport and metabolism]; Region: FruK; COG1105
261594009312	1-phosphofructokinase (FruK), minor 6-phosphofructokinase (pfkB) and related sugar kinases. FruK plays an important role in the predominant pathway for fructose utilisation.This group also contains tagatose-6-phophate kinase, an enzyme of the tagatose...; Region: FruK_PfkB_like; cd01164
261594009313	putative substrate binding site [chemical binding]; other site
261594009314	putative ATP binding site [chemical binding]; other site
261594009315	Transcriptional regulators of sugar metabolism [Transcription / Carbohydrate transport and metabolism]; Region: GlpR; COG1349
261594009316	helix_turn_helix, Deoxyribose operon repressor; Region: HTH_DEOR; smart00420
261594009317	DeoR C terminal sensor domain; Region: DeoRC; pfam00455
261594009318	Predicted membrane protein [Function unknown]; Region: COG2322
261594009319	gamma-aminobutyrate permease; Region: GABAperm; TIGR01773
261594009320	GH18 domain of Chitinase D (ChiD).  ChiD, a chitinase found in Bacillus circulans, hydrolyzes the 1,4-beta-linkages of N-acetylglucosamine in chitin and chitodextrins.  The domain architecture of ChiD includes a catalytic glycosyl hydrolase family 18; Region: GH18_chitinase_D-like; cd02871
261594009321	Glyco_18 domain; Region: Glyco_18; smart00636
261594009322	putative active site [active]
261594009323	Bacillus subtilis YkuE and related proteins, C-terminal metallophosphatase domain; Region: MPP_YkuE_C; cd07385
261594009324	Calcineurin-like phosphoesterase; Region: Metallophos; pfam00149
261594009325	putative active site [active]
261594009326	putative metal binding site [ion binding]; other site
261594009327	Formate/nitrite transporter; Region: Form_Nir_trans; pfam01226
261594009328	Integration host factor (IHF) and HU are small heterodimeric members of the DNABII protein family that bind and bend DNA, functioning as architectural factors in many cellular processes including transcription, site-specific recombination, and...; Region: HU_IHF; cd00591
261594009329	IHF dimer interface [polypeptide binding]; other site
261594009330	IHF - DNA interface [nucleotide binding]; other site
261594009331	Cation transport ATPase [Inorganic ion transport and metabolism]; Region: ZntA; COG2217
261594009332	Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371
261594009333	metal-binding site [ion binding]
261594009334	Cation transport ATPase [Inorganic ion transport and metabolism]; Region: ZntA; COG2217
261594009335	Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371
261594009336	metal-binding site [ion binding]
261594009337	E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122
261594009338	Soluble P-type ATPase [General function prediction only]; Region: COG4087
261594009339	Cation transport ATPase [Inorganic ion transport and metabolism]; Region: ZntA; COG2217
261594009340	Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371
261594009341	metal-binding site [ion binding]
261594009342	Transcriptional regulators CsoR (copper-sensitive operon repressor), RcnR, and FrmR, and related domains; this domain superfamily was previously known as DUF156; Region: CsoR-like_DUF156; cl00846
261594009343	putative homodimer interface [polypeptide binding]; other site
261594009344	putative homotetramer interface [polypeptide binding]; other site
261594009345	putative allosteric switch controlling residues; other site
261594009346	putative metal binding site [ion binding]; other site
261594009347	putative homodimer-homodimer interface [polypeptide binding]; other site
261594009348	Predicted hydrolase of the alpha/beta superfamily [General function prediction only]; Region: COG2819
261594009349	ABC-type cobalamin/Fe3+-siderophores transport systems, ATPase components [Inorganic ion transport and metabolism / Coenzyme metabolism]; Region: FepC; COG1120
261594009350	ATP-binding component of iron-siderophores, vitamin B12 and hemin transporters and related proteins; Region: ABC_Iron-Siderophores_B12_Hemin; cd03214
261594009351	Walker A/P-loop; other site
261594009352	ATP binding site [chemical binding]; other site
261594009353	Q-loop/lid; other site
261594009354	ABC transporter signature motif; other site
261594009355	Walker B; other site
261594009356	D-loop; other site
261594009357	H-loop/switch region; other site
261594009358	ABC-type enterobactin transport system, permease component [Inorganic ion transport and metabolism]; Region: FepG; COG4779
261594009359	Transmembrane subunit (TM), of Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters involved in the uptake of siderophores, heme, vitamin B12, or the divalent cations Mg2+ and Zn2+. PBP-dependent ABC transporters consist of...; Region: TM_ABC_iron-siderophores_like; cd06550
261594009360	ABC-ATPase subunit  interface; other site
261594009361	dimer interface [polypeptide binding]; other site
261594009362	putative PBP binding regions; other site
261594009363	ABC-type enterobactin transport system, permease component [Inorganic ion transport and metabolism]; Region: FepG; COG4779
261594009364	Transmembrane subunit (TM), of Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters involved in the uptake of siderophores, heme, vitamin B12, or the divalent cations Mg2+ and Zn2+. PBP-dependent ABC transporters consist of...; Region: TM_ABC_iron-siderophores_like; cd06550
261594009365	ABC-ATPase subunit  interface; other site
261594009366	dimer interface [polypeptide binding]; other site
261594009367	putative PBP binding regions; other site
261594009368	Human Ape1-like subfamily of the ExoIII family purinic/apyrimidinic (AP) endonucleases; Region: Ape1-like_AP-endo; cd09087
261594009369	active site
261594009370	putative catalytic site [active]
261594009371	DNA binding site [nucleotide binding]
261594009372	putative phosphate binding site [ion binding]; other site
261594009373	metal binding site A [ion binding]; metal-binding site
261594009374	AP binding site [nucleotide binding]; other site
261594009375	metal binding site B [ion binding]; metal-binding site
261594009376	Adenosine deaminase [Nucleotide transport and metabolism]; Region: Ada; COG2169
261594009377	Metal binding domain of Ada; Region: Ada_Zn_binding; pfam02805
261594009378	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
261594009379	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
261594009380	6-O-methylguanine DNA methyltransferase, ribonuclease-like domain; Region: Methyltransf_1N; pfam02870
261594009381	The DNA repair protein O6-alkylguanine-DNA alkyltransferase (ATase; also known as AGT, AGAT and MGMT) reverses O6-alkylation DNA damage by transferring O6-alkyl adducts to an active site cysteine irreversibly, without inducing DNA strand breaks. ATases...; Region: ATase; cd06445
261594009382	DNA binding site [nucleotide binding]
261594009383	active site
261594009384	8-oxoguanine DNA glycosylase, N-terminal domain; Region: OGG_N; pfam07934
261594009385	endonuclease III; includes endonuclease III (DNA-(apurinic or apyrimidinic site) lyase), alkylbase DNA glycosidases (Alka-family) and other DNA glycosidases; Region: ENDO3c; cd00056
261594009386	endonuclease III; Region: ENDO3c; smart00478
261594009387	minor groove reading motif; other site
261594009388	helix-hairpin-helix signature motif; other site
261594009389	substrate binding pocket [chemical binding]; other site
261594009390	active site
261594009391	peptidase T; Region: peptidase-T; TIGR01882
261594009392	M20 Peptidase T specifically cleaves tripeptides; Region: M20_peptT; cd03892
261594009393	metal binding site [ion binding]; metal-binding site
261594009394	dimer interface [polypeptide binding]; other site
261594009395	Predicted membrane protein [Function unknown]; Region: COG2364
261594009396	Uncharacterized BCR, YitT family COG1284; Region: DUF161; pfam02588
261594009397	hypothetical protein; Provisional; Region: PRK06764
261594009398	Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067
261594009399	catalytic core [active]
261594009400	Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596
261594009401	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
261594009402	This domain superfamily is found in a variety of structurally related metalloproteins, including the type I extradiol dioxygenases, glyoxalase I and a group of antibiotic resistance proteins; Region: Glo_EDI_BRP_like; cd06587
261594009403	active site
261594009404	PAS domain S-box; Region: sensory_box; TIGR00229
261594009405	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
261594009406	putative active site [active]
261594009407	heme pocket [chemical binding]; other site
261594009408	c-di-GMP synthetase (diguanylate cyclase, GGDEF domain) [Signal    transduction mechanisms]; Region: COG2199
261594009409	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
261594009410	metal binding site [ion binding]; metal-binding site
261594009411	active site
261594009412	I-site; other site
261594009413	EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2).  The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cd01948
261594009414	Protein of unknown function (DUF2515); Region: DUF2515; pfam10720
261594009415	Uncharacterized protein from bacillus cereus group; Region: YfmQ; pfam10787
261594009416	Putative effector of murein hydrolase [Cell envelope biogenesis, outer membrane]; Region: LrgB; COG1346
261594009417	holin-like protein; Validated; Region: PRK01658
261594009418	Transcriptional regulators containing a DNA-binding HTH domain and an aminotransferase domain (MocR family) and their eukaryotic orthologs [Transcription / Amino acid transport and metabolism]; Region: ARO8; COG1167
261594009419	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
261594009420	DNA-binding site [nucleotide binding]; DNA binding site
261594009421	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
261594009422	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594009423	homodimer interface [polypeptide binding]; other site
261594009424	catalytic residue [active]
261594009425	Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596
261594009426	Novel bacterial esterase that cleaves esters on halogenated cyclic compounds; Region: Esterase_713_like; cl17303
261594009427	bacillithiol biosynthesis deacetylase BshB2; Region: thiol_BshB2; TIGR04000
261594009428	Catalytic domain of prokaryotic and eukaryotic phosphoinositide-specific phospholipase C; Region: PI-PLCc; cd00137
261594009429	active site
261594009430	catalytic site [active]
261594009431	Peptidase S8 family domain, uncharacterized subfamily 11; Region: Peptidases_S8_11; cd04843
261594009432	putative active site [active]
261594009433	putative catalytic triad [active]
261594009434	Bacterial pre-peptidase C-terminal domain; Region: PPC; pfam04151
261594009435	Lysine Motif is a small domain involved in binding peptidoglycan; Region: LysM; cd00118
261594009436	FOG: LysM repeat [Cell envelope biogenesis, outer membrane]; Region: LytE; COG1388
261594009437	Lysine Motif is a small domain involved in binding peptidoglycan; Region: LysM; cd00118
261594009438	Cell Wall Hydrolase; Region: Hydrolase_2; pfam07486
261594009439	Uncharacterized FAD-dependent dehydrogenases [General function prediction only]; Region: COG2509
261594009440	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; pfam13450
261594009441	Phosphoglycerol transferase and related proteins, alkaline phosphatase superfamily [Cell envelope biogenesis, outer membrane]; Region: MdoB; COG1368
261594009442	Sulfatase; Region: Sulfatase; pfam00884
261594009443	Tetratricopeptide repeat; Region: TPR_16; pfam13432
261594009444	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cd00189
261594009445	binding surface
261594009446	TPR motif; other site
261594009447	Rat sarcoma (Ras)-like superfamily of small guanosine triphosphatases (GTPases); Region: Ras_like_GTPase; cl17170
261594009448	G1 box; other site
261594009449	GTP/Mg2+ binding site [chemical binding]; other site
261594009450	Switch I region; other site
261594009451	G3 box; other site
261594009452	Switch II region; other site
261594009453	G4 box; other site
261594009454	G5 box; other site
261594009455	Linear amide C-N hydrolases, choloylglycine hydrolase family; Region: CBAH; pfam02275
261594009456	Penicillin V acylase (PVA), also known as conjugated bile salt acid hydrolase (CBAH), catalyzes the hydrolysis of penicillin V to yield 6-amino penicillanic acid (6-APA), an important key intermediate of semisynthetic penicillins.  PVA has an N-terminal...; Region: Ntn_PVA; cd00542
261594009457	active site
261594009458	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
261594009459	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
261594009460	dimer interface [polypeptide binding]; other site
261594009461	phosphorylation site [posttranslational modification]
261594009462	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594009463	ATP binding site [chemical binding]; other site
261594009464	Mg2+ binding site [ion binding]; other site
261594009465	G-X-G motif; other site
261594009466	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
261594009467	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594009468	active site
261594009469	phosphorylation site [posttranslational modification]
261594009470	intermolecular recognition site; other site
261594009471	dimerization interface [polypeptide binding]; other site
261594009472	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
261594009473	DNA binding site [nucleotide binding]
261594009474	lantibiotic protection ABC transporter permease subunit, MutG family; Region: lanti_perm_MutG; TIGR03733
261594009475	ABC-2 family transporter protein; Region: ABC2_membrane_4; pfam12730
261594009476	lantibiotic protection ABC transporter permease subunit, MutE/EpiE family; Region: lanti_perm_MutE; TIGR03732
261594009477	ABC-2 family transporter protein; Region: ABC2_membrane_4; pfam12730
261594009478	gallidermin-class lantibiotic protection ABC transporter, ATP-binding subunit; Region: galliderm_ABC; TIGR03740
261594009479	ATP-binding cassette domain of the bacitracin-resistance transporter; Region: ABC_BcrA_bacitracin_resist; cd03268
261594009480	Walker A/P-loop; other site
261594009481	ATP binding site [chemical binding]; other site
261594009482	Q-loop/lid; other site
261594009483	ABC transporter signature motif; other site
261594009484	Walker B; other site
261594009485	D-loop; other site
261594009486	H-loop/switch region; other site
261594009487	DNA mismatch repair protein; Reviewed; Region: mutL; PRK00095
261594009488	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594009489	ATP binding site [chemical binding]; other site
261594009490	Mg2+ binding site [ion binding]; other site
261594009491	G-X-G motif; other site
261594009492	MutL_Trans: transducer domain, having a ribosomal S5 domain 2-like fold, conserved in the C-terminal domain of DNA mismatch repair (MutL/MLH1/PMS2) family. This transducer domain is homologous to the second domain of the DNA gyrase B subunit, which is...; Region: MutL_Trans; cd00782
261594009493	ATP binding site [chemical binding]; other site
261594009494	MutL C terminal dimerisation domain; Region: MutL_C; pfam08676
261594009495	DNA mismatch repair protein MutS; Provisional; Region: PRK05399
261594009496	MutS domain I; Region: MutS_I; pfam01624
261594009497	MutS domain II; Region: MutS_II; pfam05188
261594009498	MutS domain III; Region: MutS_III; pfam05192
261594009499	ATP-binding cassette domain of MutS1 homolog; Region: ABC_MutS1; cd03284
261594009500	Walker A/P-loop; other site
261594009501	ATP binding site [chemical binding]; other site
261594009502	Q-loop/lid; other site
261594009503	ABC transporter signature motif; other site
261594009504	Walker B; other site
261594009505	D-loop; other site
261594009506	H-loop/switch region; other site
261594009507	Outer spore coat protein E (CotE); Region: CotE; pfam10628
261594009508	Predicted membrane protein [Function unknown]; Region: COG4550
261594009509	(dimethylallyl)adenosine tRNA methylthiotransferase; Provisional; Region: PRK14327
261594009510	Uncharacterized protein family UPF0004; Region: UPF0004; pfam00919
261594009511	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
261594009512	FeS/SAM binding site; other site
261594009513	TRAM domain; Region: TRAM; pfam01938
261594009514	2-oxoglutarate ferredoxin oxidoreductase subunit beta; Reviewed; Region: PRK11867
261594009515	Thiamine pyrophosphate (TPP family), 2-oxoglutarate ferredoxin oxidoreductase (OGFOR) subfamily, TPP-binding module; OGFOR catalyzes the oxidative decarboxylation of 2-oxo-acids, with ferredoxin acting as an electron acceptor. In the TCA cycle, OGFOR...; Region: TPP_OGFOR; cd03375
261594009516	TPP-binding site [chemical binding]; other site
261594009517	Pyruvate ferredoxin oxidoreductase beta subunit C terminal; Region: PFO_beta_C; pfam12367
261594009518	2-oxoacid:acceptor oxidoreductase, alpha subunit; Region: OAFO_sf; TIGR03710
261594009519	Pyruvate:ferredoxin oxidoreductase and related 2-oxoacid:ferredoxin oxidoreductases, gamma subunit [Energy production and conversion]; Region: PorG; COG1014
261594009520	Pyrimidine (PYR) binding domain of pyruvate ferredoxin oxidoreductase (PFOR), indolepyruvate ferredoxin oxidoreductase alpha subunit (IOR-alpha), and related proteins; Region: TPP_PYR_PFOR_IOR-alpha_like; cd07034
261594009521	dimer interface [polypeptide binding]; other site
261594009522	PYR/PP interface [polypeptide binding]; other site
261594009523	TPP binding site [chemical binding]; other site
261594009524	substrate binding site [chemical binding]; other site
261594009525	Transketolase, C-terminal domain; Region: Transketolase_C; pfam02780
261594009526	Zn-dependent dipeptidase, microsomal dipeptidase homolog [Amino acid transport and metabolism]; Region: COG2355
261594009527	renal dipeptidase (rDP), best studied in mammals and also called membrane or microsomal dipeptidase, is a membrane-bound glycoprotein hydrolyzing dipeptides and is involved in hydrolytic metabolism of penem and carbapenem beta-lactam antibiotics; Region: rDP_like; cd01301
261594009528	active site
261594009529	dimer interface [polypeptide binding]; other site
261594009530	Stage V sporulation protein S (SpoVS); Region: SpoVS; pfam04232
261594009531	Deinococcus radiodurans DR1281 and related proteins, metallophosphatase domain; Region: MPP_DR1281; cd07382
261594009532	Calcineurin-like phosphoesterase; Region: Metallophos; pfam00149
261594009533	putative active site [active]
261594009534	metal binding site [ion binding]; metal-binding site
261594009535	homodimer binding site [polypeptide binding]; other site
261594009536	phosphodiesterase; Provisional; Region: PRK12704
261594009537	Uncharacterized conserved protein [Function unknown]; Region: COG3334
261594009538	Metal dependent phosphohydrolases with conserved 'HD' motif; Region: HDc; cd00077
261594009539	Zn2+ binding site [ion binding]; other site
261594009540	Mg2+ binding site [ion binding]; other site
261594009541	competence damage-inducible protein A; Provisional; Region: PRK00549
261594009542	Competence-damaged protein. CinA is the first gene in the competence- inducible (cin) operon and is thought to be specifically required at some stage in the process of transformation. This domain is closely related to a domain, found in a variety of...; Region: cinA; cd00885
261594009543	putative MPT binding site; other site
261594009544	Competence-damaged protein; Region: CinA; pfam02464
261594009545	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase; Region: pgsA; TIGR00560
261594009546	Predicted transcriptional regulator contains Xre-like HTH domain [Function unknown]; Region: COG1426
261594009547	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
261594009548	non-specific DNA binding site [nucleotide binding]; other site
261594009549	salt bridge; other site
261594009550	sequence-specific DNA binding site [nucleotide binding]; other site
261594009551	Domain of unknown function (DUF4115); Region: DUF4115; pfam13464
261594009552	ACT domains are commonly involved in specifically binding an amino acid or other small ligand leading to regulation of the enzyme; Region: ACT; cl09141
261594009553	Protein of unknown function (DUF3388); Region: DUF3388; pfam11868
261594009554	Protein of unknown function (DUF3243); Region: DUF3243; pfam11588
261594009555	3-ketoacyl-(acyl-carrier-protein) reductase; Provisional; Region: fabG; PRK05565
261594009556	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
261594009557	NAD(P) binding site [chemical binding]; other site
261594009558	active site
261594009559	Predicted Zn-dependent peptidases [General function prediction only]; Region: PqqL; COG0612
261594009560	Insulinase (Peptidase family M16); Region: Peptidase_M16; pfam00675
261594009561	Peptidase M16 inactive domain; Region: Peptidase_M16_C; pfam05193
261594009562	Predicted Zn-dependent peptidases [General function prediction only]; Region: PqqL; COG0612
261594009563	Peptidase M16 inactive domain; Region: Peptidase_M16_C; pfam05193
261594009564	ABC-type uncharacterized transport systems, ATPase components [General function prediction only]; Region: COG3845
261594009565	First domain of the ATP-binding cassette component of monosaccharide transport system; Region: ABC_Carb_Monos_I; cd03216
261594009566	Walker A/P-loop; other site
261594009567	ATP binding site [chemical binding]; other site
261594009568	Q-loop/lid; other site
261594009569	ABC transporter signature motif; other site
261594009570	Walker B; other site
261594009571	D-loop; other site
261594009572	H-loop/switch region; other site
261594009573	Second domain of the ATP-binding cassette component of monosaccharide transport system; Region: ABC_Carb_Monos_II; cd03215
261594009574	Uncharacterized ABC-type transport system, periplasmic component/surface lipoprotein [General function prediction only]; Region: Med; COG1744
261594009575	Periplasmic binding domain of basic membrane lipoprotein, PnrA, in Treponema pallidum and its homologs from other bacteria and Archaea; Region: PBP1_BmpA_PnrA_like; cd06354
261594009576	ligand binding site [chemical binding]; other site
261594009577	Transcriptional regulators [Transcription]; Region: PhnF; COG2188
261594009578	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
261594009579	DNA-binding site [nucleotide binding]; DNA binding site
261594009580	UTRA domain; Region: UTRA; pfam07702
261594009581	Tetraspanin family; Region: Tetraspannin; pfam00335
261594009582	DNA segregation ATPase FtsK/SpoIIIE and related proteins [Cell division and chromosome partitioning]; Region: FtsK; COG1674
261594009583	FtsK/SpoIIIE family; Region: FtsK_SpoIIIE; pfam01580
261594009584	Ftsk gamma domain; Region: Ftsk_gamma; pfam09397
261594009585	YlzJ-like protein; Region: YlzJ; pfam14035
261594009586	Clp protease; Region: CLP_protease; pfam00574
261594009587	Caseinolytic protease (ClpP) is an ATP-dependent protease; Region: Clp_protease_like; cl15763
261594009588	active site
261594009589	mRNA degradation ribonucleases J1/J2 (metallo-beta-lactamase superfamily) [Translation, ribosomal structure and biogenesis; Replication, recombination and repair]; Region: COG0595
261594009590	Metallo-beta-lactamase superfamily; Region: Lactamase_B; smart00849
261594009591	RNA-metabolising metallo-beta-lactamase; Region: RMMBL; pfam07521
261594009592	Dihydrodipicolinate synthase (DHDPS); Region: DHDPS; cd00950
261594009593	dihydrodipicolinate synthase; Region: dapA; TIGR00674
261594009594	dimer interface [polypeptide binding]; other site
261594009595	active site
261594009596	catalytic residue [active]
261594009597	aspartate kinase I; Reviewed; Region: PRK08210
261594009598	Amino Acid Kinases (AAK) superfamily, catalytic domain; present in such enzymes like N-acetylglutamate kinase (NAGK), carbamate kinase (CK), aspartokinase (AK), glutamate-5-kinase (G5K) and UMP kinase (UMPK). The AAK superfamily includes kinases that...; Region: AAK; cl00452
261594009599	nucleotide binding site [chemical binding]; other site
261594009600	substrate binding site [chemical binding]; other site
261594009601	ACT domains of the diaminopimelate-sensitive aspartokinase (AK) isoenzyme AKI; Region: ACT_AKi-DapG-BS_1; cd04914
261594009602	ACT domains of the diaminopimelate-sensitive aspartokinase (AK) isoenzyme AKI; Region: ACT_AKi-DapG-BS_2; cd04937
261594009603	aspartate-semialdehyde dehydrogenase; Provisional; Region: PRK14874
261594009604	Semialdehyde dehydrogenase, NAD binding domain; Region: Semialdhyde_dh; smart00859
261594009605	dipicolinate synthase subunit B; Reviewed; Region: spoVFB; PRK08305
261594009606	dipicolinate synthase subunit A; Reviewed; Region: PRK08306
261594009607	Alanine dehydrogenase/PNT, C-terminal domain; Region: AlaDh_PNT_C; smart01002
261594009608	sporulation protein, YlmC/YmxH family; Region: spore_YlmC_YmxH; TIGR02888
261594009609	Predicted Zn-dependent peptidases [General function prediction only]; Region: PqqL; COG0612
261594009610	Insulinase (Peptidase family M16); Region: Peptidase_M16; pfam00675
261594009611	Peptidase M16 inactive domain; Region: Peptidase_M16_C; pfam05193
261594009612	probable sporulation protein, polysaccharide deacetylase family; Region: spore_ylxY; TIGR02873
261594009613	Putative catalytic NodB homology domain of uncharacterized protein YlxY from Bacillus subtilis and its bacterial homologs; Region: CE4_BsYlxY_like; cd10950
261594009614	NodB motif; other site
261594009615	polynucleotide phosphorylase/polyadenylase; Provisional; Region: PRK11824
261594009616	Polyribonucleotide nucleotidyltransferase, repeat 1; Region: RNase_PH_PNPase_1; cd11363
261594009617	RNase E interface [polypeptide binding]; other site
261594009618	trimer interface [polypeptide binding]; other site
261594009619	Polyribonucleotide nucleotidyltransferase, RNA binding domain; Region: PNPase; pfam03726
261594009620	Polyribonucleotide nucleotidyltransferase, repeat 2; Region: RNase_PH_PNPase_2; cd11364
261594009621	RNase E interface [polypeptide binding]; other site
261594009622	trimer interface [polypeptide binding]; other site
261594009623	active site
261594009624	Polynucleotide phosphorylase (PNPase) K homology RNA-binding domain (KH). PNPase is a polyribonucleotide nucleotidyl transferase that degrades mRNA in prokaryotes and plant chloroplasts. The C-terminal region of PNPase contains domains homologous to...; Region: PNPase_KH; cd02393
261594009625	putative nucleic acid binding region [nucleotide binding]; other site
261594009626	G-X-X-G motif; other site
261594009627	S1_PNPase: Polynucleotide phosphorylase (PNPase), ), S1-like RNA-binding domain. PNPase  is a polyribonucleotide nucleotidyl transferase that degrades mRNA. It is a trimeric multidomain protein. The C-terminus contains the S1 domain which binds ssRNA; Region: S1_PNPase; cd04472
261594009628	RNA binding site [nucleotide binding]; other site
261594009629	domain interface; other site
261594009630	Ribosomal protein S15 (prokaryotic)_S13 (eukaryotic) binds the central domain of 16S rRNA and is required for assembly of the small ribosomal subunit and for intersubunit association, thus representing a key element in the assembly of the whole ribosome; Region: Ribosomal_S15p_S13e; cd00353
261594009631	16S/18S rRNA binding site [nucleotide binding]; other site
261594009632	S13e-L30e interaction site [polypeptide binding]; other site
261594009633	25S rRNA binding site [nucleotide binding]; other site
261594009634	bifunctional riboflavin kinase/FMN adenylyltransferase; Reviewed; Region: PRK05627
261594009635	FAD synthetase, N-terminal domain of the bifunctional enzyme; Region: FAD_synthetase_N; cd02064
261594009636	active site
261594009637	Riboflavin kinase; Region: Flavokinase; smart00904
261594009638	tRNA pseudouridine synthase B; Provisional; Region: truB; PRK01550
261594009639	Pseudouridine synthase, Escherichia coli TruB like; Region: PseudoU_synth_EcTruB; cd02573
261594009640	RNA binding site [nucleotide binding]; other site
261594009641	active site
261594009642	ribosome-binding factor A; Validated; Region: rbfA; PRK00521
261594009643	Protein of unknown function (DUF503); Region: DUF503; pfam04456
261594009644	Translation initiation factor IF-2, N-terminal region; Region: IF2_N; pfam04760
261594009645	translation initiation factor IF-2; Region: IF-2; TIGR00487
261594009646	Translation initiation factor IF-2, N-terminal region; Region: IF2_N; pfam04760
261594009647	Initiation Factor 2 (IF2)/ eukaryotic Initiation Factor 5B (eIF5B) family; Region: IF2_eIF5B; cd01887
261594009648	G1 box; other site
261594009649	putative GEF interaction site [polypeptide binding]; other site
261594009650	GTP/Mg2+ binding site [chemical binding]; other site
261594009651	Switch I region; other site
261594009652	G2 box; other site
261594009653	G3 box; other site
261594009654	Switch II region; other site
261594009655	G4 box; other site
261594009656	G5 box; other site
261594009657	This family represents the domain II of bacterial Initiation Factor 2 (IF2) and its eukaryotic mitochondrial homologue mtIF2. IF2, the largest initiation factor is an essential GTP binding protein. In E. coli three natural forms of IF2 exist in the cell; Region: IF2_mtIF2_II; cd03702
261594009658	Translation-initiation factor 2; Region: IF-2; pfam11987
261594009659	mtIF2_IVc: this family represents the C2 subdomain of domain IV of mitochondrial translation initiation factor 2 (mtIF2) which adopts a beta-barrel fold displaying a high degree of structural similarity with domain II of the translation elongation factor...; Region: mtIF2_IVc; cd03692
261594009660	hypothetical protein; Provisional; Region: PRK07714
261594009661	Ylxr homologs; group of conserved hypothetical bacterial proteins of unknown function; structure revealed putative RNA binding cleft; proteins are encoded by an operon that includes other proteins involved in transcription and/or translation; Region: YlxR; cd00279
261594009662	putative RNA binding cleft [nucleotide binding]; other site
261594009663	transcription elongation factor NusA; Provisional; Region: nusA; PRK12327
261594009664	NusA N-terminal domain; Region: NusA_N; pfam08529
261594009665	S1_NusA: N-utilizing substance A protein (NusA), S1-like RNA-binding domain. S1-like RNA-binding domains are found in a wide variety of RNA-associated proteins. NusA is a transcription elongation factor containing an N-terminal catalytic domain and three...; Region: S1_NusA; cd04455
261594009666	RNA binding site [nucleotide binding]; other site
261594009667	homodimer interface [polypeptide binding]; other site
261594009668	NusA_K homology RNA-binding domain (KH). NusA is an essential multifunctional transcription elongation factor that is universally conserved among prokaryotes and archaea. NusA anti-termination function plays an important role in the expression of...; Region: NusA_KH; cd02134
261594009669	G-X-X-G motif; other site
261594009670	NusA_K homology RNA-binding domain (KH). NusA is an essential multifunctional transcription elongation factor that is universally conserved among prokaryotes and archaea. NusA anti-termination function plays an important role in the expression of...; Region: NusA_KH; cd02134
261594009671	G-X-X-G motif; other site
261594009672	ribosome maturation protein RimP; Reviewed; Region: PRK00092
261594009673	Sm and related proteins; Region: Sm_like; cl00259
261594009674	Bacillus subtilis YxlS-like, C-terminal domain; Region: YlxS_C; cd01734
261594009675	putative oligomer interface [polypeptide binding]; other site
261594009676	putative RNA binding site [nucleotide binding]; other site
261594009677	DNA polymerase III PolC; Validated; Region: polC; PRK00448
261594009678	DNA polymerase III polC-type N-terminus; Region: DNA_pol3_alph_N; pfam11490
261594009679	polC_OBF: A subfamily of OB folds corresponding to the N-terminal OB-fold nucleic acid binding domain of Bacillus subtilis type C replicative DNA polymerase III alpha subunit (polC). Replication in B. subtilis and Staphylococcus aureus requires two...; Region: polC_OBF; cd04484
261594009680	generic binding surface II; other site
261594009681	generic binding surface I; other site
261594009682	Polymerase and Histidinol Phosphatase domain; Region: PHP; cl17102
261594009683	active site
261594009684	DEDDh 3'-5' exonuclease domain family; Region: DEDDh; cd06127
261594009685	active site
261594009686	catalytic site [active]
261594009687	substrate binding site [chemical binding]; other site
261594009688	Polymerase and Histidinol Phosphatase domain of alpha-subunit of bacterial polymerase III at PolC gene; Region: PHP_PolIIIA_POLC; cd07435
261594009689	prolyl-tRNA synthetase; Provisional; Region: PRK09194
261594009690	Prolyl-tRNA synthetase (ProRS) class II core catalytic domain. ProRS is a homodimer. It is responsible for the attachment of proline to the 3' OH group of ribose of the appropriate tRNA. This domain is primarily responsible for ATP-dependent...; Region: ProRS_core_prok; cd00779
261594009691	dimer interface [polypeptide binding]; other site
261594009692	motif 1; other site
261594009693	active site
261594009694	motif 2; other site
261594009695	INS is an amino acid-editing domain inserted (INS) into the bacterial class II prolyl-tRNA synthetase (ProRS) however, this CD is not exclusively bacterial. It is also found at the N-terminus of the eukaryotic/archaea-like ProRS's of yeasts and...; Region: ProRS-INS; cd04334
261594009696	putative deacylase active site [active]
261594009697	Class II tRNA amino-acyl synthetase-like catalytic core domain. Class II amino acyl-tRNA synthetases (aaRS) share a common fold and generally attach an amino acid to the 3' OH of ribose of the appropriate tRNA.   PheRS is an exception in that it...; Region: class_II_aaRS-like_core; cl00268
261594009698	active site
261594009699	motif 3; other site
261594009700	ProRS Prolyl-anticodon binding domain, short version found predominantly in bacteria. ProRS belongs to class II aminoacyl-tRNA synthetases (aaRS). This alignment contains the anticodon binding domain, which is responsible for specificity in tRNA-binding; Region: ProRS_anticodon_short; cd00861
261594009701	anticodon binding site; other site
261594009702	RIP metalloprotease RseP; Region: TIGR00054
261594009703	RseP-like Site-2 proteases (S2P), zinc metalloproteases (MEROPS family M50A), cleave transmembrane domains of substrate proteins, regulating intramembrane proteolysis (RIP) of diverse signal transduction mechanisms. In Escherichia coli, the S2P homolog...; Region: S2P-M50_PDZ_RseP-like; cd06163
261594009704	active site
261594009705	Site-2 protease (S2P) class of zinc metalloproteases (MEROPS family M50) cleaves transmembrane domains of substrate proteins, regulating intramembrane proteolysis (RIP) of diverse signal transduction mechanisms. Members of this family use proteolytic...; Region: S2P-M50; cl10020
261594009706	PDZ domain of bacterial and plant zinc metalloprotases, presumably membrane-associated or integral membrane proteases, which may be involved in signalling and regulatory mechanisms. May be responsible for substrate recognition and/or binding, as most PDZ...; Region: PDZ_metalloprotease; cd00989
261594009707	protein binding site [polypeptide binding]; other site
261594009708	RseP-like Site-2 proteases (S2P), zinc metalloproteases (MEROPS family M50A), cleave transmembrane domains of substrate proteins, regulating intramembrane proteolysis (RIP) of diverse signal transduction mechanisms. In Escherichia coli, the S2P homolog...; Region: S2P-M50_PDZ_RseP-like; cd06163
261594009709	putative substrate binding region [chemical binding]; other site
261594009710	1-deoxy-D-xylulose 5-phosphate reductoisomerase; Provisional; Region: PRK05447
261594009711	1-deoxy-D-xylulose 5-phosphate reductoisomerase; Region: DXP_reductoisom; pfam02670
261594009712	1-deoxy-D-xylulose 5-phosphate reductoisomerase C-terminal; Region: DXP_redisom_C; pfam08436
261594009713	DXP reductoisomerase C-terminal domain; Region: DXPR_C; pfam13288
261594009714	CDP-diglyceride synthetase [Lipid metabolism]; Region: CdsA; COG0575
261594009715	Cytidylyltransferase family; Region: CTP_transf_1; pfam01148
261594009716	Undecaprenyl pyrophosphate synthase [Lipid metabolism]; Region: UppS; COG0020
261594009717	Cis (Z)-Isoprenyl Diphosphate Synthases (cis-IPPS); homodimers which catalyze the successive 1'-4 condensation of the isopentenyl diphosphate (IPP) molecule to trans,trans-farnesyl diphosphate (FPP) or to cis,trans-FPP to form long-chain polyprenyl...; Region: CIS_IPPS; cd00475
261594009718	catalytic residue [active]
261594009719	putative FPP diphosphate  binding site; other site
261594009720	putative FPP binding hydrophobic cleft; other site
261594009721	dimer interface [polypeptide binding]; other site
261594009722	putative IPP diphosphate binding site; other site
261594009723	ribosome recycling factor; Reviewed; Region: frr; PRK00083
261594009724	Ribosome recycling factor (RRF). Ribosome recycling factor dissociates the posttermination complex, composed of the ribosome, deacylated tRNA, and mRNA, after termination of translation.  Thus ribosomes are "recycled" and ready for another...; Region: RRF; cd00520
261594009725	hinge region; other site
261594009726	UMP kinase (UMPK)-Ec, the microbial/chloroplast uridine monophosphate kinase (uridylate kinase) enzyme that catalyzes UMP phosphorylation and plays a key role in pyrimidine nucleotide biosynthesis; regulation of this process is via feed-back control and...; Region: AAK_UMPK-PyrH-Ec; cd04254
261594009727	putative nucleotide binding site [chemical binding]; other site
261594009728	uridine monophosphate binding site [chemical binding]; other site
261594009729	homohexameric interface [polypeptide binding]; other site
261594009730	elongation factor Ts; Provisional; Region: tsf; PRK09377
261594009731	UBA/TS-N domain; Region: UBA; pfam00627
261594009732	Elongation factor TS; Region: EF_TS; pfam00889
261594009733	Elongation factor TS; Region: EF_TS; pfam00889
261594009734	Ribosomal protein S2 (RPS2), involved in formation of the translation initiation complex, where it might contact the messenger RNA and several components of the ribosome. It has been shown that in Escherichia coli RPS2 is essential for the binding of...; Region: RPS2; cd01425
261594009735	rRNA interaction site [nucleotide binding]; other site
261594009736	S8 interaction site; other site
261594009737	putative laminin-1 binding site; other site
261594009738	transcriptional repressor CodY; Validated; Region: PRK04158
261594009739	CodY GAF-like domain; Region: CodY; pfam06018
261594009740	CodY helix-turn-helix domain; Region: HTH_CodY; pfam08222
261594009741	ATP-dependent protease ATP-binding subunit HslU; Provisional; Region: hslU; PRK05201
261594009742	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
261594009743	Walker A motif; other site
261594009744	ATP binding site [chemical binding]; other site
261594009745	AAA domain (Cdc48 subfamily); Region: AAA_2; pfam07724
261594009746	C-terminal, D2-small domain, of ClpB protein; Region: ClpB_D2-small; smart01086
261594009747	Protease HslV and the ATPase/chaperone HslU are part of an ATP-dependent proteolytic system that is the prokaryotic homolog of the proteasome. HslV is a dimer of hexamers (a dodecamer) that forms a central proteolytic chamber with active sites on the...; Region: protease_HslV; cd01913
261594009748	active site
261594009749	HslU subunit interaction site [polypeptide binding]; other site
261594009750	site-specific tyrosine recombinase XerC; Reviewed; Region: xerC; PRK00236
261594009751	XerD and XerC integrases, DNA breaking-rejoining enzymes, N- and C-terminal domains. XerD-like integrases are involved in the site-specific integration and excision of lysogenic bacteriophage genomes, transposition of conjugative transposons, termination...; Region: INT_XerDC; cd00798
261594009752	active site
261594009753	Int/Topo IB signature motif; other site
261594009754	tRNA (uracil-5-)-methyltransferase Gid; Reviewed; Region: PRK05335
261594009755	Glucose inhibited division protein A; Region: GIDA; pfam01134
261594009756	DNA topoisomerase I; Validated; Region: PRK05582
261594009757	TOPRIM_TopoIA_TopoI: The topoisomerase-primase (TORPIM) domain found in members of the type IA family of DNA topoisomerases (Topo IA) similar to Escherichia coli DNA topoisomerase I.   Type IA DNA topoisomerases remove (relax) negative supercoils in the...; Region: TOPRIM_TopoIA_TopoI; cd03363
261594009758	active site
261594009759	interdomain interaction site; other site
261594009760	putative metal-binding site [ion binding]; other site
261594009761	nucleotide binding site [chemical binding]; other site
261594009762	DNA Topoisomerase, subtype IA; DNA-binding, ATP-binding and catalytic domain of bacterial DNA topoisomerases I and III, and eukaryotic DNA topoisomerase III and eubacterial and archael reverse gyrases. Topoisomerases clevage single or double stranded DNA...; Region: TOP1Ac; cd00186
261594009763	domain I; other site
261594009764	DNA binding groove [nucleotide binding]
261594009765	phosphate binding site [ion binding]; other site
261594009766	domain II; other site
261594009767	domain III; other site
261594009768	nucleotide binding site [chemical binding]; other site
261594009769	catalytic site [active]
261594009770	domain IV; other site
261594009771	Topoisomerase DNA binding C4 zinc finger; Region: zf-C4_Topoisom; pfam01396
261594009772	Topoisomerase DNA binding C4 zinc finger; Region: zf-C4_Topoisom; pfam01396
261594009773	succinyl-CoA synthetase subunit alpha; Validated; Region: PRK05678
261594009774	CoA binding domain; Region: CoA_binding; smart00881
261594009775	CoA-ligase; Region: Ligase_CoA; pfam00549
261594009776	succinyl-CoA synthetase subunit beta; Provisional; Region: sucC; PRK00696
261594009777	ATP-grasp domain; Region: ATP-grasp_2; pfam08442
261594009778	CoA-ligase; Region: Ligase_CoA; pfam00549
261594009779	bacterial Ribonuclease HII-like; Region: RNase_HII_bacteria_HII_like; cd07182
261594009780	RNA/DNA hybrid binding site [nucleotide binding]; other site
261594009781	active site
261594009782	GTPase YlqF; Reviewed; Region: rbgA; PRK09563
261594009783	Circularly permuted YlqF GTPase; Region: YlqF; cd01856
261594009784	GTP/Mg2+ binding site [chemical binding]; other site
261594009785	G4 box; other site
261594009786	G5 box; other site
261594009787	50S ribosome-binding GTPase; Region: MMR_HSR1; pfam01926
261594009788	G1 box; other site
261594009789	G1 box; other site
261594009790	GTP/Mg2+ binding site [chemical binding]; other site
261594009791	Switch I region; other site
261594009792	G2 box; other site
261594009793	G2 box; other site
261594009794	G3 box; other site
261594009795	G3 box; other site
261594009796	Switch II region; other site
261594009797	Switch II region; other site
261594009798	G4 box; other site
261594009799	signal peptidase I, bacterial type; Region: sigpep_I_bact; TIGR02227
261594009800	The S26 Type I signal peptidase (SPase; LepB; leader peptidase B; leader peptidase I; EC 3.4.21.89) family members are essential membrane-bound serine proteases that function to cleave the amino-terminal signal peptide extension from proteins that are...; Region: S26_SPase_I; cd06530
261594009801	Catalytic site [active]
261594009802	The S26 Type I signal peptidase (SPase; LepB; leader peptidase B; leader peptidase I; EC 3.4.21.89) family members are essential membrane-bound serine proteases that function to cleave the amino-terminal signal peptide extension from proteins that are...; Region: S26_SPase_I; cd06530
261594009803	50S ribosomal protein L19; Provisional; Region: rplS; PRK05338
261594009804	tRNA (guanine-N(1)-)-methyltransferase; Reviewed; Region: trmD; PRK00026
261594009805	16S rRNA-processing protein RimM; Provisional; Region: rimM; PRK00122
261594009806	RimM N-terminal domain; Region: RimM; pfam01782
261594009807	PRC-barrel domain; Region: PRC; pfam05239
261594009808	Predicted RNA-binding protein (contains KH domain) [General function prediction only]; Region: COG1837
261594009809	KH domain; Region: KH_4; pfam13083
261594009810	G-X-X-G motif; other site
261594009811	30S ribosomal protein S16; Reviewed; Region: rpsP; PRK00040
261594009812	signal recognition particle protein; Provisional; Region: PRK10867
261594009813	SRP54-type protein, helical bundle domain; Region: SRP54_N; smart00963
261594009814	The signal recognition particle (SRP) mediates the transport to or across the plasma membrane in bacteria and the endoplasmic reticulum in eukaryotes. SRP recognizes N-terminal sighnal sequences of newly synthesized polypeptides at the ribosome. The...; Region: SRP; cd03115
261594009815	P loop; other site
261594009816	GTP binding site [chemical binding]; other site
261594009817	Signal peptide binding domain; Region: SRP_SPB; pfam02978
261594009818	putative DNA-binding protein; Validated; Region: PRK00118
261594009819	Putative helix-turn-helix protein, YlxM / p13 like; Region: UPF0122; pfam04297
261594009820	signal recognition particle-docking protein FtsY; Provisional; Region: PRK10416
261594009821	SRP54-type protein, helical bundle domain; Region: SRP54_N; pfam02881
261594009822	The signal recognition particle (SRP) mediates the transport to or across the plasma membrane in bacteria and the endoplasmic reticulum in eukaryotes. SRP recognizes N-terminal sighnal sequences of newly synthesized polypeptides at the ribosome. The...; Region: SRP; cd03115
261594009823	P loop; other site
261594009824	GTP binding site [chemical binding]; other site
261594009825	chromosome segregation protein SMC, common bacterial type; Region: SMC_prok_B; TIGR02168
261594009826	ATP-binding cassette domain of barmotin, a member of the SMC protein family; Region: ABC_SMC_barmotin; cd03278
261594009827	Walker A/P-loop; other site
261594009828	ATP binding site [chemical binding]; other site
261594009829	Q-loop/lid; other site
261594009830	SMC proteins Flexible Hinge Domain; Region: SMC_hinge; smart00968
261594009831	ATP-binding cassette domain of barmotin, a member of the SMC protein family; Region: ABC_SMC_barmotin; cd03278
261594009832	ABC transporter signature motif; other site
261594009833	Walker B; other site
261594009834	D-loop; other site
261594009835	H-loop/switch region; other site
261594009836	ribonuclease III, bacterial; Region: RNaseIII; TIGR02191
261594009837	RIBOc. Ribonuclease III C terminal domain. This group consists of eukaryotic, bacterial and archeal ribonuclease III (RNAse III) proteins. RNAse III is a double stranded RNA-specific endonuclease. Prokaryotic RNAse III is important in...; Region: RIBOc; cd00593
261594009838	dimerization interface [polypeptide binding]; other site
261594009839	active site
261594009840	metal binding site [ion binding]; metal-binding site
261594009841	Double-stranded RNA binding motif. Binding is not sequence specific but is highly specific for double stranded RNA. Found in a variety of proteins including dsRNA dependent protein kinase PKR, RNA helicases, Drosophila staufen protein, E. coli RNase III; Region: DSRM; cd00048
261594009842	dsRNA binding site [nucleotide binding]; other site
261594009843	acyl carrier protein; Provisional; Region: acpP; PRK00982
261594009844	3-ketoacyl-(acyl-carrier-protein) reductase; Validated; Region: fabG; PRK05557
261594009845	beta-Keto acyl carrier protein reductase (BKR), involved in Type II FAS, classical (c) SDRs; Region: BKR_SDR_c; cd05333
261594009846	NAD(P) binding site [chemical binding]; other site
261594009847	homotetramer interface [polypeptide binding]; other site
261594009848	homodimer interface [polypeptide binding]; other site
261594009849	active site
261594009850	(acyl-carrier-protein) S-malonyltransferase [Lipid metabolism]; Region: FabD; COG0331
261594009851	malonyl CoA-acyl carrier protein transacylase; Region: fabD; TIGR00128
261594009852	putative phosphate acyltransferase; Provisional; Region: PRK05331
261594009853	fatty acid biosynthesis transcriptional regulator; Provisional; Region: PRK04424
261594009854	The hotdog fold was initially identified in the E. coli FabA (beta-hydroxydecanoyl-acyl carrier protein (ACP)-dehydratase) structure and subsequently in 4HBT (4-hydroxybenzoyl-CoA thioesterase) from Pseudomonas. A number of other seemingly unrelated...; Region: hot_dog; cd03440
261594009855	active site 2 [active]
261594009856	active site 1 [active]
261594009857	ATP-dependent DNA helicase RecG; Provisional; Region: PRK10917
261594009858	RecG_wedge_OBF: A subfamily of OB folds corresponding to the OB fold found in the N-terminal (wedge) domain of Escherichia coli RecG. RecG is a branched-DNA-specific helicase, which catalyzes the interconversion of a DNA replication fork to a...; Region: RecG_wedge_OBF; cd04488
261594009859	generic binding surface II; other site
261594009860	ssDNA binding site; other site
261594009861	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
261594009862	ATP binding site [chemical binding]; other site
261594009863	putative Mg++ binding site [ion binding]; other site
261594009864	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
261594009865	nucleotide binding region [chemical binding]; other site
261594009866	ATP-binding site [chemical binding]; other site
261594009867	DAK2 domain fusion protein YloV; Region: YloV; TIGR03599
261594009868	DAK2 domain; Region: Dak2; pfam02734
261594009869	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG1302
261594009870	50S ribosomal protein L28; Reviewed; Region: rpmB; PRK00359
261594009871	Thiamine pyrophosphokinase; Region: TPK; cd07995
261594009872	thiamine pyrophosphokinase; Region: thi_PPkinase; TIGR01378
261594009873	active site
261594009874	dimerization interface [polypeptide binding]; other site
261594009875	thiamine binding site [chemical binding]; other site
261594009876	Pentose-5-phosphate-3-epimerase [Carbohydrate transport and metabolism]; Region: Rpe; COG0036
261594009877	Ribulose-5-phosphate 3-epimerase (RPE). This enzyme catalyses the interconversion of D-ribulose 5-phosphate (Ru5P) into D-xylulose 5-phosphate, as part of the Calvin cycle (reductive pentose phosphate pathway) in chloroplasts and in the oxidative pentose...; Region: RPE; cd00429
261594009878	substrate binding site [chemical binding]; other site
261594009879	hexamer interface [polypeptide binding]; other site
261594009880	metal binding site [ion binding]; metal-binding site
261594009881	GTPase RsgA; Reviewed; Region: PRK00098
261594009882	S1_YloQ_GTPase: YloQ GTase family (also known as YjeQ and CpgA), S1-like RNA-binding domain. Proteins in the YloQ GTase family bind the ribosome and have GTPase activity. The precise role of this family is unknown. The protein structure is composed of...; Region: S1_YloQ_GTPase; cd04466
261594009883	RNA binding site [nucleotide binding]; other site
261594009884	homodimer interface [polypeptide binding]; other site
261594009885	Ribosomal interacting GTPase YjeQ/EngC, a circularly permuted subfamily of the Ras GTPases; Region: YjeQ_EngC; cd01854
261594009886	GTPase/Zn-binding domain interface [polypeptide binding]; other site
261594009887	GTP/Mg2+ binding site [chemical binding]; other site
261594009888	G4 box; other site
261594009889	G5 box; other site
261594009890	G1 box; other site
261594009891	Switch I region; other site
261594009892	G2 box; other site
261594009893	G3 box; other site
261594009894	Switch II region; other site
261594009895	Serine/Threonine protein kinases, catalytic domain; Region: S_TKc; smart00220
261594009896	Catalytic domain of Protein Kinases; Region: PKc; cd00180
261594009897	active site
261594009898	ATP binding site [chemical binding]; other site
261594009899	substrate binding site [chemical binding]; other site
261594009900	activation loop (A-loop); other site
261594009901	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2815
261594009902	PASTA domain of bacterial serine/threonine kinase pknB-like proteins. PknB is a member of a group of related transmembrane sensor kinases present in many gram positive bacteria, which has been shown to regulate cell shape in Mycobacterium tubercolosis; Region: PASTA_pknB; cd06577
261594009903	PASTA domain; Region: PASTA; pfam03793
261594009904	PASTA domain of bacterial serine/threonine kinase pknB-like proteins. PknB is a member of a group of related transmembrane sensor kinases present in many gram positive bacteria, which has been shown to regulate cell shape in Mycobacterium tubercolosis; Region: PASTA_pknB; cd06577
261594009905	Protein phosphatase 2C; Region: PP2C; pfam00481
261594009906	Serine/threonine phosphatases, family 2C, catalytic domain; The protein architecture and deduced catalytic mechanism of PP2C phosphatases are similar to the PP1, PP2A, PP2B family of protein Ser/Thr phosphatases, with which PP2C shares no sequence...; Region: PP2Cc; cd00143
261594009907	active site
261594009908	ribosomal RNA large subunit methyltransferase N; Provisional; Region: PRK14455
261594009909	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
261594009910	FeS/SAM binding site; other site
261594009911	16S rRNA methyltransferase B; Provisional; Region: PRK14902
261594009912	NusB family; Region: NusB; pfam01029
261594009913	putative RNA binding site [nucleotide binding]; other site
261594009914	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594009915	S-adenosylmethionine binding site [chemical binding]; other site
261594009916	methionyl-tRNA formyltransferase; Reviewed; Region: fmt; PRK00005
261594009917	Methionyl-tRNA formyltransferase, N-terminal hydrolase domain; Region: FMT_core_Met-tRNA-FMT_N; cd08646
261594009918	putative active site [active]
261594009919	substrate binding site [chemical binding]; other site
261594009920	putative cosubstrate binding site; other site
261594009921	catalytic site [active]
261594009922	C-terminal domain of Formyltransferase and other enzymes; Region: Met_tRNA_FMT_C; cd08704
261594009923	substrate binding site [chemical binding]; other site
261594009924	Polypeptide or peptide deformylase; a family of metalloenzymes that catalyzes the removal of the N-terminal formyl group in a growing polypeptide chain following translation initiation during protein synthesis in prokaryotes. These enzymes utilize Fe(II)...; Region: Pep_deformylase; cd00487
261594009925	active site
261594009926	catalytic residues [active]
261594009927	metal binding site [ion binding]; metal-binding site
261594009928	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
261594009929	primosomal protein N' Region: priA; TIGR00595
261594009930	ATP binding site [chemical binding]; other site
261594009931	putative Mg++ binding site [ion binding]; other site
261594009932	helicase superfamily c-terminal domain; Region: HELICc; smart00490
261594009933	nucleotide binding region [chemical binding]; other site
261594009934	ATP-binding site [chemical binding]; other site
261594009935	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate synthase; Validated; Region: PRK05579
261594009936	Flavoprotein; Region: Flavoprotein; pfam02441
261594009937	DNA / pantothenate metabolism flavoprotein; Region: DFP; pfam04127
261594009938	DNA-directed RNA polymerase subunit omega; Reviewed; Region: rpoZ; PRK00392
261594009939	Guanylate kinase [Nucleotide transport and metabolism]; Region: Gmk; COG0194
261594009940	Guanosine monophosphate kinase (GMPK, EC 2.7.4.8), also known as guanylate kinase (GKase), catalyzes the reversible phosphoryl transfer from adenosine triphosphate (ATP) to guanosine monophosphate (GMP) to yield adenosine diphosphate (ADP) and guanosine...; Region: GMPK; cd00071
261594009941	catalytic site [active]
261594009942	G-X2-G-X-G-K; other site
261594009943	hypothetical protein; Provisional; Region: PRK04323
261594009944	hypothetical protein; Provisional; Region: PRK11820
261594009945	YicC-like family, N-terminal region; Region: YicC_N; pfam03755
261594009946	Domain of unknown function (DUF1732); Region: DUF1732; pfam08340
261594009947	Cation transport ATPase [Inorganic ion transport and metabolism]; Region: MgtA; COG0474
261594009948	Cation transporter/ATPase, N-terminus; Region: Cation_ATPase_N; smart00831
261594009949	E1-E2 ATPase; Region: E1-E2_ATPase; pfam00122
261594009950	Putative hydrolase of sodium-potassium ATPase alpha subunit; Region: Hydrolase_like2; pfam13246
261594009951	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
261594009952	motif II; other site
261594009953	Cation transporting ATPase, C-terminus; Region: Cation_ATPase_C; pfam00689
261594009954	Fibronectin-binding protein A N-terminus (FbpA); Region: FbpA; pfam05833
261594009955	Domain of unknown function (DUF814); Region: DUF814; pfam05670
261594009956	Xaa-Pro aminopeptidase [Amino acid transport and metabolism]; Region: PepP; COG0006
261594009957	Creatinase/Prolidase N-terminal domain; Region: Creatinase_N; pfam01321
261594009958	Similar to Prolidase and Aminopeptidase P. The members of this subfamily presumably catalyse hydrolysis of Xaa-Pro dipeptides and/or release of any N-terminal amino acid, including proline, that is linked with proline; Region: APP-like; cd01092
261594009959	active site
261594009960	YoqO-like protein; Region: YoqO; pfam14037
261594009961	YoqO-like protein; Region: YoqO; pfam14037
261594009962	TRAP-type C4-dicarboxylate transport system, large permease component [Carbohydrate transport and metabolism]; Region: DctQ; cl17274
261594009963	Protein of unknown function (DUF2651); Region: DUF2651; pfam10852
261594009964	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
261594009965	active site
261594009966	Orotidine 5'-phosphate decarboxylase (ODCase) is a dimeric enzyme that decarboxylates orotidine 5'-monophosphate (OMP) to form uridine 5'-phosphate (UMP), an essential step in the pyrimidine biosynthetic pathway. In mammals, UMP synthase...; Region: OMP_decarboxylase_like; cd04725
261594009967	active site
261594009968	dimer interface [polypeptide binding]; other site
261594009969	dihydroorotate dehydrogenase (subfamily 1) family protein; Region: pyrD_sub1_fam; TIGR01037
261594009970	Dihydroorotate dehydrogenase (DHOD) class 1B FMN-binding domain. DHOD catalyzes the oxidation of (S)-dihydroorotate to orotate. This is the fourth step and the only redox reaction in the de novo biosynthesis of UMP, the precursor of all pyrimidine...; Region: DHOD_1B_like; cd04740
261594009971	heterodimer interface [polypeptide binding]; other site
261594009972	active site
261594009973	FMN binding site [chemical binding]; other site
261594009974	homodimer interface [polypeptide binding]; other site
261594009975	substrate binding site [chemical binding]; other site
261594009976	dihydroorotate dehydrogenase electron transfer subunit; Reviewed; Region: PRK00054
261594009977	FAD/NAD binding domain in the electron transfer subunit of dihydroorotate dehydrogenase. Dihydroorotate dehydrogenases (DHODs) catalyze the only redox reaction in pyrimidine de novo biosynthesis. They catalyze the oxidation of (S)-dihydroorotate to...; Region: DHOD_e_trans; cd06218
261594009978	FAD binding pocket [chemical binding]; other site
261594009979	FAD binding motif [chemical binding]; other site
261594009980	phosphate binding motif [ion binding]; other site
261594009981	beta-alpha-beta structure motif; other site
261594009982	NAD binding pocket [chemical binding]; other site
261594009983	Iron coordination center [ion binding]; other site
261594009984	carbamoyl phosphate synthase large subunit; Reviewed; Region: carB; PRK05294
261594009985	Carbamoyl-phosphate synthase L chain, N-terminal domain; Region: CPSase_L_chain; pfam00289
261594009986	Carbamoyl-phosphate synthase L chain, ATP binding domain; Region: CPSase_L_D2; pfam02786
261594009987	Carbamoyl-phosphate synthetase large chain, oligomerisation domain; Region: CPSase_L_D3; pfam02787
261594009988	Carbamoyl-phosphate synthase L chain, N-terminal domain; Region: CPSase_L_chain; pfam00289
261594009989	ATP-grasp domain; Region: ATP-grasp_4; cl17255
261594009990	Methylglyoxal synthase-like domain from type II glutamine-dependent carbamoyl phosphate synthetase (CSP). CSP, a CarA and CarB heterodimer, catalyzes the production of carbamoyl phosphate which is subsequently employed in the metabolic pathways...; Region: MGS_CPS_II; cd01424
261594009991	IMP binding site; other site
261594009992	dimer interface [polypeptide binding]; other site
261594009993	interdomain contacts; other site
261594009994	partial ornithine binding site; other site
261594009995	carbamoyl phosphate synthase small subunit; Reviewed; Region: PRK12564
261594009996	Carbamoyl-phosphate synthase small chain, CPSase domain; Region: CPSase_sm_chain; smart01097
261594009997	Small chain of the glutamine-dependent form of carbamoyl phosphate synthase, CPSase II; Region: GATase1_CPSase; cd01744
261594009998	catalytic site [active]
261594009999	subunit interface [polypeptide binding]; other site
261594010000	dihydroorotase; Validated; Region: pyrC; PRK09357
261594010001	Superfamily of metallo-dependent hydrolases (also called amidohydrolase superfamily) is a large group of proteins that show conservation in their 3-dimensional fold (TIM barrel) and in details of their active site. The vast majority of the members have a...; Region: metallo-dependent_hydrolases; cl00281
261594010002	Dihydroorotase (DHOase), subgroup IIa; DHOases catalyze the reversible interconversion of carbamoyl aspartate to dihydroorotate, a key reaction in pyrimidine biosynthesis. This subgroup also contains proteins that lack the active site, like unc-33, a C; Region: DHOase_IIa; cd01317
261594010003	active site
261594010004	aspartate carbamoyltransferase catalytic subunit; Provisional; Region: pyrB; PRK00856
261594010005	Aspartate/ornithine carbamoyltransferase, carbamoyl-P binding domain; Region: OTCace_N; pfam02729
261594010006	Aspartate/ornithine carbamoyltransferase, Asp/Orn binding domain; Region: OTCace; pfam00185
261594010007	uracil transporter; Provisional; Region: PRK10720
261594010008	Pyrimidine operon attenuation protein/uracil phosphoribosyltransferase [Nucleotide transport and metabolism]; Region: PyrR; COG2065
261594010009	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
261594010010	active site
261594010011	pseudouridine synthase, RluA family; Region: rluA_subfam; TIGR00005
261594010012	S4/Hsp/ tRNA synthetase RNA-binding domain; The domain surface is populated by conserved, charged residues that define a likely RNA-binding site;  Found in stress proteins, ribosomal proteins and tRNA synthetases; This may imply a hitherto unrecognized...; Region: S4; cd00165
261594010013	RNA binding surface [nucleotide binding]; other site
261594010014	Pseudouridine synthase, RsuA/RluD family; Region: PseudoU_synth_RluCD_like; cd02869
261594010015	active site
261594010016	lipoprotein signal peptidase; Reviewed; Region: lspA; PRK00376
261594010017	lipoprotein signal peptidase; Provisional; Region: PRK14787
261594010018	Prokaryotic dksA/traR C4-type zinc finger; Region: zf-dskA_traR; cl00755
261594010019	isoleucyl-tRNA synthetase; Reviewed; Region: ileS; PRK05743
261594010020	nucleotidyl transferase superfamily; Region: nt_trans; cl00015
261594010021	active site
261594010022	HIGH motif; other site
261594010023	nucleotide binding site [chemical binding]; other site
261594010024	Leucyl-tRNA synthetase, Domain 2; Region: tRNA-synt_1_2; pfam13603
261594010025	catalytic core domain of isoleucyl-tRNA synthetases; Region: IleRS_core; cd00818
261594010026	active site
261594010027	KMSKS motif; other site
261594010028	Anticodon-binding domain of bacterial and eukaryotic mitochondrial isoleucyl tRNA synthetases; Region: Anticodon_Ia_Ile_BEm; cd07960
261594010029	tRNA binding surface [nucleotide binding]; other site
261594010030	anticodon binding site; other site
261594010031	Zinc finger found in FPG and IleRS; Region: zf-FPG_IleRS; pfam06827
261594010032	DivIVA protein; Region: DivIVA; pfam05103
261594010033	DivIVA domain; Region: DivI1A_domain; TIGR03544
261594010034	The band 7 domain of flotillin (reggie) like proteins. This group contains proteins similar to stomatin, prohibitin, flotillin, HlfK/C and podicin.  Many of these band 7 domain-containing proteins are lipid raft-associated.  Individual proteins of this...; Region: Band_7; cl02525
261594010035	Uncharacterized conserved protein, contains S4-like domain [Function unknown]; Region: COG2302
261594010036	S4/Hsp/ tRNA synthetase RNA-binding domain; The domain surface is populated by conserved, charged residues that define a likely RNA-binding site;  Found in stress proteins, ribosomal proteins and tRNA synthetases; This may imply a hitherto unrecognized...; Region: S4; cd00165
261594010037	RNA binding surface [nucleotide binding]; other site
261594010038	YGGT family; Region: YGGT; pfam02325
261594010039	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG1799
261594010040	Type III Pyridoxal 5-phosphate (PLP)-Dependent Enzymes, YBL036c-like proteins; Region: PLPDE_III_YBL036c_like; cd00635
261594010041	pyridoxal 5'-phosphate (PLP) binding site [chemical binding]; other site
261594010042	catalytic residue [active]
261594010043	Multicopper polyphenol oxidase (laccase) [Secondary metabolites biosynthesis, transport and catabolism]; Region: yfiH; COG1496
261594010044	Multi-copper polyphenol oxidoreductase laccase; Region: Cu-oxidase_4; pfam02578
261594010045	sporulation protein, YlmC/YmxH family; Region: spore_YlmC_YmxH; TIGR02888
261594010046	sporulation sigma factor SigG; Reviewed; Region: PRK08215
261594010047	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
261594010048	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
261594010049	DNA binding residues [nucleotide binding]
261594010050	sporulation sigma factor SigE; Reviewed; Region: PRK08301
261594010051	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
261594010052	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
261594010053	DNA binding residues [nucleotide binding]
261594010054	Sporulation factor SpoIIGA; Region: Peptidase_U4; pfam03419
261594010055	sigma-E processing peptidase SpoIIGA; Region: spore_II_GA; TIGR02854
261594010056	cell division protein FtsZ; Validated; Region: PRK09330
261594010057	FtsZ is a GTPase that is similar to the eukaryotic tubulins and is essential for cell division in prokaryotes.  FtsZ is capable of polymerizing in a GTP-driven process into structures similar to those formed by tubulin. FtsZ forms a ring-shaped septum at...; Region: FtsZ_type1; cd02201
261594010058	nucleotide binding site [chemical binding]; other site
261594010059	SulA interaction site; other site
261594010060	Cell division ATPase FtsA [Cell division and chromosome partitioning]; Region: ftsA; COG0849
261594010061	Nucleotide-Binding Domain of the sugar kinase/HSP70/actin superfamily; Region: NBD_sugar-kinase_HSP70_actin; cd00012
261594010062	nucleotide binding site [chemical binding]; other site
261594010063	SHS2 domain inserted in FTSA; Region: SHS2_FTSA; pfam02491
261594010064	Cell division protein FtsA; Region: FtsA; pfam14450
261594010065	POTRA domain, FtsQ-type; Region: POTRA_1; pfam08478
261594010066	Cell division protein FtsQ; Region: FtsQ; pfam03799
261594010067	UDP-N-acetylenolpyruvoylglucosamine reductase; Provisional; Region: murB; PRK13905
261594010068	FAD binding domain; Region: FAD_binding_4; pfam01565
261594010069	UDP-N-acetylenolpyruvoylglucosamine reductase, C-terminal domain; Region: MurB_C; pfam02873
261594010070	undecaprenyldiphospho-muramoylpentapeptide beta-N- acetylglucosaminyltransferase; Provisional; Region: murG; PRK00726
261594010071	MurG is an N-acetylglucosaminyltransferase, the last enzyme involved in the intracellular phase of peptidoglycan biosynthesis. It transfers N-acetyl-D-glucosamine (GlcNAc) from UDP-GlcNAc to the C4 hydroxyl of a lipid-linked N-acetylmuramoyl pentapeptide...; Region: GT1_MurG; cd03785
261594010072	active site
261594010073	homodimer interface [polypeptide binding]; other site
261594010074	Cell cycle protein; Region: FTSW_RODA_SPOVE; cl00511
261594010075	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate synthetase; Provisional; Region: murD; PRK02472
261594010076	Alanine dehydrogenase/PNT, C-terminal domain; Region: AlaDh_PNT_C; smart01002
261594010077	Mur ligase middle domain; Region: Mur_ligase_M; pfam08245
261594010078	Mur ligase family, glutamate ligase domain; Region: Mur_ligase_C; pfam02875
261594010079	phospho-N-acetylmuramoyl-pentapeptide-transferase; Provisional; Region: mraY; PRK00108
261594010080	Phospho-N-acetylmuramoyl-pentapeptide-transferase (mraY) is an enzyme responsible for the formation of the first lipid intermediate in the synthesis of bacterial cell wall peptidoglycan. It catalyzes the formation of...; Region: GT_MraY; cd06852
261594010081	Mg++ binding site [ion binding]; other site
261594010082	putative catalytic motif [active]
261594010083	putative substrate binding site [chemical binding]; other site
261594010084	UDP-N-acetylmuramoylalanyl-D-glutamate--2, 6-diaminopimelate ligase; Provisional; Region: murE; PRK00139
261594010085	Mur ligase family, catalytic domain; Region: Mur_ligase; pfam01225
261594010086	Mur ligase middle domain; Region: Mur_ligase_M; pfam08245
261594010087	Mur ligase family, glutamate ligase domain; Region: Mur_ligase_C; pfam02875
261594010088	stage V sporulation protein D; Region: spoVD_pbp; TIGR02214
261594010089	Penicillin-binding Protein dimerisation domain; Region: PBP_dimer; pfam03717
261594010090	Penicillin binding protein transpeptidase domain; Region: Transpeptidase; pfam00905
261594010091	PASTA domain. This domain is found at the C-termini of several Penicillin-binding proteins (PBPs) and bacterial serine/threonine kinases. It is a small globular fold consisting of 3 beta-sheets and an alpha-helix. The name PASTA is derived from PBP and...; Region: PASTA; cd06573
261594010092	Cell division protein FtsI/penicillin-binding protein 2 [Cell envelope biogenesis, outer membrane]; Region: FtsI; COG0768
261594010093	Penicillin-binding Protein dimerisation domain; Region: PBP_dimer; pfam03717
261594010094	Penicillin binding protein transpeptidase domain; Region: Transpeptidase; pfam00905
261594010095	PASTA domain of PBP2x-like proteins, first repeat. Penicillin-binding proteins (PBPs) are the major targets for beta-lactam antibiotics, like penicillins and cephalosporins. Beta-lactam antibiotics specifically inhibit transpeptidase activity by...; Region: PASTA_Pbp2x-like_1; cd06576
261594010096	PASTA domain of PBP2x-like proteins, second repeat. Penicillin-binding proteins (PBPs) are the major targets for beta-lactam antibiotics, like penicillins and cephalosporins. Beta-lactam antibiotics specifically inhibit transpeptidase activity by...; Region: PASTA_Pbp2x-like_2; cd06575
261594010097	Cell division protein FtsL; Region: FtsL; cl11433
261594010098	MraW methylase family; Region: Methyltransf_5; pfam01795
261594010099	16S rRNA m(4)C1402 methyltranserfase; Provisional; Region: PRK00050
261594010100	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4365
261594010101	bacillithiol biosynthesis cysteine-adding enzyme BshC; Region: thiol_BshC; TIGR03998
261594010102	2-dehydropantoate 2-reductase; Reviewed; Region: PRK06522
261594010103	Ketopantoate reductase PanE/ApbA; Region: ApbA; pfam02558
261594010104	Ketopantoate reductase PanE/ApbA C terminal; Region: ApbA_C; pfam08546
261594010105	hypothetical protein; Provisional; Region: PRK13688
261594010106	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594010107	Coenzyme A binding pocket [chemical binding]; other site
261594010108	transcription factor, RsfA family; Region: DNA_bind_RsfA; TIGR02894
261594010109	putative spore coat protein regulator protein YlbO; Provisional; Region: PRK13923
261594010110	50S ribosomal protein L32; Reviewed; Region: rpmF; PRK12286
261594010111	Predicted metal-binding, possibly nucleic acid-binding protein [General function prediction only]; Region: COG1399
261594010112	lysogenic prophage region PHAGE03; Best Hits not completed.   attL/R=ND
261594010113	Replication-relaxation; Region: Replic_Relax; pfam13814
261594010114	FtsK/SpoIIIE family; Region: FtsK_SpoIIIE; pfam01580
261594010115	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
261594010116	non-specific DNA binding site [nucleotide binding]; other site
261594010117	salt bridge; other site
261594010118	sequence-specific DNA binding site [nucleotide binding]; other site
261594010119	hypothetical protein; Region: PHA02436
261594010120	Peptidoglycan recognition proteins (PGRPs) are pattern recognition receptors that bind, and in certain cases, hydrolyze peptidoglycans (PGNs) of bacterial cell walls. PGRPs have been divided into three classes: short PGRPs (PGRP-S), that are small (20...; Region: PGRP; cd06583
261594010121	amidase catalytic site [active]
261594010122	Zn binding residues [ion binding]; other site
261594010123	substrate binding site [chemical binding]; other site
261594010124	N-acetylmuramoyl-l-alanine amidase; Region: Amidase02_C; pfam12123
261594010125	Holin family; Region: Phage_holin_4; pfam05105
261594010126	Site-specific recombinase XerD [DNA replication, recombination, and repair]; Region: XerD; COG4974
261594010127	DNA breaking-rejoining enzymes, intergrase/recombinases, C-terminal catalytic domain. The tyrosine recombinase/integrase family share the same catalytic domain containing six conserved active site residues. The best-studied members of this diverse family...; Region: INT_REC_C; cd01182
261594010128	active site
261594010129	catalytic residues [active]
261594010130	DNA binding site [nucleotide binding]
261594010131	Int/Topo IB signature motif; other site
261594010132	Reovirus sigma C capsid protein; Region: Reo_sigmaC; pfam04582
261594010133	phage minor structural protein, N-terminal region; Region: put_anti_recept; TIGR01665
261594010134	putative phage tail component, N-terminal domain; Region: phi3626_gp14_N; TIGR01633
261594010135	Phage tail protein; Region: Sipho_tail; cl17486
261594010136	Phage-related minor tail protein; Region: PhageMin_Tail; pfam10145
261594010137	phage major tail protein, phi13 family; Region: maj_tail_phi13; TIGR01603
261594010138	short chain acyl-CoA synthetase; Reviewed; Region: PRK06087
261594010139	phage protein, HK97 gp10 family; Region: phge_HK97_gp10; TIGR01725
261594010140	Phage head-tail joining protein; Region: Phage_H_T_join; pfam05521
261594010141	Head-Tail Connector Protein gp6 of Bacteriophage HK97 and similar proteins; Region: gp6; cd08054
261594010142	oligomerization interface [polypeptide binding]; other site
261594010143	phage major capsid protein, HK97 family; Region: major_cap_HK97; TIGR01554
261594010144	Phage capsid family; Region: Phage_capsid; pfam05065
261594010145	Protease subunit of ATP-dependent Clp proteases [Posttranslational modification, protein turnover, chaperones / Intracellular trafficking and secretion]; Region: ClpP; COG0740
261594010146	Caseinolytic protease (ClpP) is an ATP-dependent, highly conserved serine protease; Region: S14_ClpP_1; cd07016
261594010147	oligomer interface [polypeptide binding]; other site
261594010148	active site residues [active]
261594010149	Phage-related protein [Function unknown]; Region: COG4695
261594010150	Phage portal protein; Region: Phage_portal; pfam04860
261594010151	Phage terminase-like protein, large subunit [General function prediction only]; Region: COG4626
261594010152	Phage terminase, small subunit; Region: Terminase_4; pfam05119
261594010153	HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cd00085
261594010154	active site
261594010155	Predicted nucleotide-binding protein containing TIR-like domain; Region: TIR-like; pfam10137
261594010156	INT_SG3, DNA breaking-rejoining enzymes, integrase/recombinases subgroup 3, catalytic domain. The CD contains various predicted bacterial and phage integrase/recombinase sequences for which not much experimental characterization is available; Region: INT_SG3_C; cd01186
261594010157	Int/Topo IB signature motif; other site
261594010158	phage transcriptional regulator, ArpU family; Region: phage_arpU; TIGR01637
261594010159	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
261594010160	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
261594010161	non-specific DNA binding site [nucleotide binding]; other site
261594010162	salt bridge; other site
261594010163	sequence-specific DNA binding site [nucleotide binding]; other site
261594010164	Helix-Turn-Helix DNA binding domain of transcription regulators from the MerR superfamily; Region: HTH_MerR-SF; cl02600
261594010165	fosfomycin resistance protein FosB; Provisional; Region: PRK04101
261594010166	This domain superfamily is found in a variety of structurally related metalloproteins, including the type I extradiol dioxygenases, glyoxalase I and a group of antibiotic resistance proteins; Region: Glo_EDI_BRP_like; cl14632
261594010167	active site
261594010168	metal binding site [ion binding]; metal-binding site
261594010169	Trimeric dUTP diphosphatases; Region: trimeric_dUTPase; cd07557
261594010170	trimer interface [polypeptide binding]; other site
261594010171	active site
261594010172	RNA polymerase sigma-70 factor, sigma-B/F/G subfamily; Region: SigBFG; TIGR02980
261594010173	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
261594010174	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
261594010175	sequence-specific DNA binding site [nucleotide binding]; other site
261594010176	salt bridge; other site
261594010177	Helix-turn-helix domain of Hin and related proteins, a family of DNA-binding domains unique to bacteria and represented by the Hin protein of Salmonella. The basic HTH domain is a simple fold comprised of three core helices that form a right-handed...; Region: HTH_Hin_like; cl17393
261594010178	Protein of unknown function (DUF3954); Region: DUF3954; pfam13128
261594010179	hypothetical protein; Validated; Region: PRK08116
261594010180	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
261594010181	Walker A motif; other site
261594010182	ATP binding site [chemical binding]; other site
261594010183	Helix-turn-helix domain; Region: HTH_36; pfam13730
261594010184	Replication initiation and membrane attachment; Region: DnaB_2; pfam07261
261594010185	Inositol polyphosphate kinase; Region: IPK; cl12283
261594010186	Helix-turn-helix domain; Region: HTH_17; pfam12728
261594010187	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
261594010188	non-specific DNA binding site [nucleotide binding]; other site
261594010189	salt bridge; other site
261594010190	sequence-specific DNA binding site [nucleotide binding]; other site
261594010191	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
261594010192	non-specific DNA binding site [nucleotide binding]; other site
261594010193	salt bridge; other site
261594010194	sequence-specific DNA binding site [nucleotide binding]; other site
261594010195	V-type ATP synthase subunit I; Validated; Region: PRK05771
261594010196	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
261594010197	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
261594010198	non-specific DNA binding site [nucleotide binding]; other site
261594010199	salt bridge; other site
261594010200	sequence-specific DNA binding site [nucleotide binding]; other site
261594010201	tyrosine recombinase XerD; Region: recomb_XerD; TIGR02225
261594010202	phiLC3 phage and phage-related integrases, site-specific recombinases, DNA breaking-rejoining enzymes, C-terminal catalytic domain. This CD includes various bacterial (mainly gram positive) and phage integrases, including those similar to Lactococcus...; Region: INT_phiLC3_C; cd01189
261594010203	Int/Topo IB signature motif; other site
261594010204	hypothetical protein; Provisional; Region: PRK13670
261594010205	HIGH Nucleotidyl Transferase; Region: HIGH_NTase1; cl17673
261594010206	Predicted secreted protein containing a PDZ domain [Signal transduction mechanisms]; Region: SdrC; COG3480
261594010207	PDZ domain of ATP-dependent LON serine proteases. Most PDZ domains bind C-terminal polypeptides, though binding to internal (non-C-terminal) polypeptides and even to lipids has been demonstrated. In this bacterial subfamily of protease-associated PDZ...; Region: PDZ_LON_protease; cd00986
261594010208	protein binding site [polypeptide binding]; other site
261594010209	Lon protease (S16) C-terminal proteolytic domain; Region: Lon_C; pfam05362
261594010210	Predicted esterase of the alpha-beta hydrolase superfamily [General function prediction only]; Region: RssA; COG1752
261594010211	Patatins and Phospholipases; Region: Patatin_and_cPLA2; cl11396
261594010212	active site
261594010213	nucleophile elbow; other site
261594010214	sporulation integral membrane protein YlbJ; Region: spore_ylbJ; TIGR02871
261594010215	Nucleoside recognition; Region: Gate; pfam07670
261594010216	Nucleoside recognition; Region: Gate; pfam07670
261594010217	phosphopantetheine adenylyltransferase; Provisional; Region: coaD; PRK00168
261594010218	Phosphopantetheine adenylyltransferase; Region: PPAT; cd02163
261594010219	active site
261594010220	(T/H)XGH motif; other site
261594010221	N6-adenine-specific methylase [DNA replication, recombination, and repair]; Region: COG0742
261594010222	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594010223	S-adenosylmethionine binding site [chemical binding]; other site
261594010224	hypothetical protein; Provisional; Region: PRK02886
261594010225	Protein of unknown function (DUF964); Region: DUF964; pfam06133
261594010226	Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067
261594010227	catalytic core [active]
261594010228	YlbE-like protein; Region: YlbE; pfam14003
261594010229	Putative coat protein; Region: YlbD_coat; pfam14071
261594010230	Uncharacterized protein with SCP/PR1 domains [Function unknown]; Region: COG2340
261594010231	SCP_bacterial: SCP-like extracellular protein domain, as found in bacteria and archaea. The wider family of SCP containing proteins includes plant pathogenesis-related protein 1 (PR-1), CRISPs, mammalian cysteine-rich secretory proteins, and allergen 5...; Region: SCP_bacterial; cd05379
261594010232	YugN-like family; Region: YugN; pfam08868
261594010233	formamidase; Provisional; Region: amiF; PRK13287
261594010234	aliphatic amidases (class 2 nitrilases); Region: aliphatic_amidase; cd07565
261594010235	multimer interface [polypeptide binding]; other site
261594010236	active site
261594010237	catalytic triad [active]
261594010238	dimer interface [polypeptide binding]; other site
261594010239	cytochrome c oxidase assembly factor CtaG; Region: caa3_CtaG; TIGR02737
261594010240	Prokaryotic Cytochrome C oxidase subunit IV; Region: COX4_pro; cl01204
261594010241	Ubiquinol oxidase subunit III subfamily. Ubiquinol oxidase, the terminal oxidase in the respiratory chains of aerobic bacteria, is a multi-chain transmembrane protein located in the cell membrane.  It catalyzes the reduction of O2 and simultaneously...; Region: Ubiquinol_oxidase_III; cd02863
261594010242	Subunit I/III interface [polypeptide binding]; other site
261594010243	Subunit III/IV interface [polypeptide binding]; other site
261594010244	Heme/copper-type cytochrome/quinol oxidases, subunit 1 [Energy production and conversion]; Region: CyoB; COG0843
261594010245	Ubiquinol oxidase subunit I.  Ubiquinol oxidase, the terminal oxidase in the respiratory chains of aerobic bacteria, is a multi-chain transmembrane protein located in the cell membrane.  It catalyzes the reduction of O2 and simultaneously pumps protons...; Region: Ubiquinol_Oxidase_I; cd01662
261594010246	D-pathway; other site
261594010247	Putative ubiquinol binding site [chemical binding]; other site
261594010248	Low-spin heme (heme b) binding site [chemical binding]; other site
261594010249	Putative water exit pathway; other site
261594010250	Binuclear center (heme o3/CuB) [ion binding]; other site
261594010251	K-pathway; other site
261594010252	Putative proton exit pathway; other site
261594010253	Heme/copper-type cytochrome/quinol oxidases, subunit 2 [Energy production and conversion]; Region: CyoA; COG1622
261594010254	Cytochrome C oxidase subunit II, periplasmic domain; Region: COX2; pfam00116
261594010255	Cytochrome c, mono- and diheme variants [Energy production and conversion]; Region: CccA; COG2010
261594010256	Cytochrome c; Region: Cytochrom_C; pfam00034
261594010257	protoheme IX farnesyltransferase; Provisional; Region: PRK04375
261594010258	UbiA prenyltransferase family; Region: UbiA; pfam01040
261594010259	Cytochrome oxidase assembly protein; Region: COX15-CtaA; pfam02628
261594010260	Uncharacterized protein required for cytochrome oxidase assembly [Posttranslational modification, protein turnover, chaperones]; Region: CtaA; COG1612
261594010261	pyruvate carboxylase; Reviewed; Region: PRK12999
261594010262	Carbamoyl-phosphate synthase L chain, N-terminal domain; Region: CPSase_L_chain; pfam00289
261594010263	Carbamoyl-phosphate synthase L chain, ATP binding domain; Region: CPSase_L_D2; pfam02786
261594010264	Biotin carboxylase C-terminal domain; Region: Biotin_carb_C; smart00878
261594010265	Pyruvate carboxylase and Transcarboxylase 5S, carboxyltransferase domain; Region: DRE_TIM_PC_TC_5S; cd07937
261594010266	active site
261594010267	catalytic residues [active]
261594010268	metal binding site [ion binding]; metal-binding site
261594010269	homodimer binding site [polypeptide binding]; other site
261594010270	The biotinyl-domain or biotin carboxyl carrier protein (BCCP) domain is present in all biotin-dependent enzymes, such as acetyl-CoA carboxylase, pyruvate carboxylase, propionyl-CoA carboxylase, methylcrotonyl-CoA carboxylase, geranyl-CoA carboxylase; Region: biotinyl_domain; cd06850
261594010271	carboxyltransferase (CT) interaction site; other site
261594010272	biotinylation site [posttranslational modification]; other site
261594010273	Bacterial cell division membrane protein [Cell division and chromosome partitioning]; Region: FtsW; COG0772
261594010274	hypothetical protein; Provisional; Region: PRK13666
261594010275	Sulfite oxidase (SO) family, molybdopterin binding domain. This molybdopterin cofactor (Moco) binding domain is found in a variety of oxidoreductases, main members of this family are nitrate reductase (NR) and sulfite oxidase (SO). SO catalyzes the...; Region: SO_family_Moco; cl00199
261594010276	NYN ribonuclease and ATPase of PhoH family domains [General    function prediction only]; Region: COG1875
261594010277	PIN domain of bacterial Smg6-like homologs with PhoH-like ATPase domains; Region: PIN_PhoHL-ATPase; cd09883
261594010278	putative active site [active]
261594010279	PhoH-like protein; Region: PhoH; pfam02562
261594010280	hypothetical protein; Provisional; Region: PRK06733
261594010281	Uncharacterized protein conserved in bacteria (DUF2197); Region: DUF2197; pfam09963
261594010282	YlaH-like protein; Region: YlaH; pfam14036
261594010283	Predicted membrane GTPase involved in stress response [Signal transduction mechanisms]; Region: TypA; COG1217
261594010284	Tyrosine phosphorylated protein A (TypA)/BipA family belongs to ribosome-binding GTPases; Region: TypA_BipA; cd01891
261594010285	G1 box; other site
261594010286	putative GEF interaction site [polypeptide binding]; other site
261594010287	GTP/Mg2+ binding site [chemical binding]; other site
261594010288	Switch I region; other site
261594010289	G2 box; other site
261594010290	G3 box; other site
261594010291	Switch II region; other site
261594010292	G4 box; other site
261594010293	G5 box; other site
261594010294	BipA_TypA_II: domain II of BipA (also called TypA) having homology to domain II of the elongation factors (EFs) EF-G and EF-Tu.  BipA is a highly conserved protein with global regulatory properties in Escherichia coli. BipA is phosphorylated on a...; Region: BipA_TypA_II; cd03691
261594010295	BipA_TypA_C: a C-terminal portion of BipA or TypA having homology to the C terminal domains of the elongation factors EF-G and EF-2. A member of the ribosome binding GTPase superfamily, BipA is widely distributed in bacteria and plants.  BipA is a highly...; Region: BipA_TypA_C; cd03710
261594010296	Archaeal fructose-1,6-bisphosphatase and related enzymes of inositol monophosphatase family [Carbohydrate transport and metabolism]; Region: SuhB; COG0483
261594010297	Inositol-monophosphatase-like domains. This family of phosphatases is dependent on bivalent metal ions such as Mg++, and many members are inhibited by Li+ (which is thought to displace a bivalent ion in the active site). Substrates include fructose-1; Region: IMPase_like; cd01637
261594010298	active site
261594010299	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4493
261594010300	Protein of unknown function (DUF1054); Region: DUF1054; pfam06335
261594010301	hypothetical protein; Provisional; Region: PRK04387
261594010302	Arginine/lysine/ornithine decarboxylases [Amino acid transport and metabolism]; Region: LdcC; COG1982
261594010303	Ornithine decarboxylase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD corresponds to ornithine decarboxylase (ODC), arginine decarboxylase (ADC) and lysine...; Region: Orn_deC_like; cd00615
261594010304	homodimer interface [polypeptide binding]; other site
261594010305	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594010306	catalytic residue [active]
261594010307	Orn/Lys/Arg decarboxylase, C-terminal domain; Region: OKR_DC_1_C; pfam03711
261594010308	transglutaminase; Provisional; Region: tgl; PRK03187
261594010309	Domain of unknown function (DUF4182); Region: DUF4182; pfam13790
261594010310	Domain of unknown function (DUF4182); Region: DUF4182; pfam13790
261594010311	Protein of unknown function (DUF3055); Region: DUF3055; pfam11256
261594010312	Domain of unknown function (DUF1885); Region: DUF1885; pfam08968
261594010313	dihydrolipoamide dehydrogenase; Reviewed; Region: PRK06416
261594010314	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
261594010315	Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain; Region: Pyr_redox_dim; pfam02852
261594010316	branched-chain alpha-keto acid dehydrogenase subunit E2; Reviewed; Region: PRK11856
261594010317	Lipoyl domain of the dihydrolipoyl acyltransferase component (E2) of 2-oxo acid dehydrogenases. 2-oxo acid dehydrogenase multienzyme complexes, like pyruvate dehydrogenase (PDH), 2-oxoglutarate dehydrogenase (OGDH) and branched-chain 2-oxo acid...; Region: lipoyl_domain; cd06849
261594010318	E3 interaction surface; other site
261594010319	lipoyl attachment site [posttranslational modification]; other site
261594010320	e3 binding domain; Region: E3_binding; pfam02817
261594010321	2-oxoacid dehydrogenases acyltransferase (catalytic domain); Region: 2-oxoacid_dh; pfam00198
261594010322	Pyruvate/2-oxoglutarate dehydrogenase complex, dehydrogenase (E1) component, eukaryotic type, beta subunit [Energy production and conversion]; Region: AcoB; COG0022
261594010323	Pyrimidine (PYR) binding domain of the beta subunits of the E1 components of human pyruvate dehydrogenase complex (E1- PDHc) and related proteins; Region: TPP_PYR_E1-PDHc-beta_like; cd07036
261594010324	alpha subunit interface [polypeptide binding]; other site
261594010325	TPP binding site [chemical binding]; other site
261594010326	heterodimer interface [polypeptide binding]; other site
261594010327	Transketolase, C-terminal domain; Region: Transketolase_C; pfam02780
261594010328	pyruvate dehydrogenase E1 component, alpha subunit; Region: PDH_E1_alph_x; TIGR03181
261594010329	Thiamine pyrophosphate (TPP) family, E1 of PDC_ADC_BCADC subfamily, TPP-binding module; composed of proteins similar to the E1 components of the human pyruvate dehydrogenase complex (PDC), the acetoin dehydrogenase complex (ADC) and the branched chain...; Region: TPP_E1_PDC_ADC_BCADC; cd02000
261594010330	TPP-binding site [chemical binding]; other site
261594010331	heterodimer interface [polypeptide binding]; other site
261594010332	tetramer interface [polypeptide binding]; other site
261594010333	phosphorylation loop region [posttranslational modification]
261594010334	Polypeptide or peptide deformylase; a family of metalloenzymes that catalyzes the removal of the N-terminal formyl group in a growing polypeptide chain following translation initiation during protein synthesis in prokaryotes. These enzymes utilize Fe(II)...; Region: Pep_deformylase; cd00487
261594010335	active site
261594010336	catalytic residues [active]
261594010337	metal binding site [ion binding]; metal-binding site
261594010338	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
261594010339	haloacid dehalogenase-like hydrolase; Region: Hydrolase_3; pfam08282
261594010340	active site
261594010341	motif I; other site
261594010342	motif II; other site
261594010343	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
261594010344	hypothetical protein; Provisional; Region: PRK13667
261594010345	mRNA degradation ribonucleases J1/J2 (metallo-beta-lactamase superfamily) [Translation, ribosomal structure and biogenesis; Replication, recombination and repair]; Region: COG0595
261594010346	Metallo-beta-lactamase superfamily; Region: Lactamase_B; smart00849
261594010347	RNA-metabolising metallo-beta-lactamase; Region: RMMBL; pfam07521
261594010348	K+ transport systems, NAD-binding component [Inorganic ion transport and metabolism]; Region: TrkA; COG0569
261594010349	TrkA-N domain; Region: TrkA_N; pfam02254
261594010350	TrkA-C domain; Region: TrkA_C; pfam02080
261594010351	Cytochrome bd-type quinol oxidase, subunit 2 [Energy production and conversion]; Region: AppB; COG1294
261594010352	Metal-dependent amidase/aminoacylase/carboxypeptidase [General function prediction only]; Region: AbgB; COG1473
261594010353	M20 Peptidase Aminoacyclase-1 YkuR-like proteins, including YkuR and Ama/HipO/HyuC proteins; Region: M20_Acy1_YkuR_like; cd05670
261594010354	metal binding site [ion binding]; metal-binding site
261594010355	putative dimer interface [polypeptide binding]; other site
261594010356	Tetrahydrodipicolinate succinyltransferase N-terminal; Region: DapH_N; pfam08503
261594010357	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase; Region: DapD_Ac; TIGR03532
261594010358	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate (THDP) N-succinyltransferase (also called THP succinyltransferase): THDP N-succinyltransferase catalyzes the conversion of tetrahydrodipicolinate and succinyl-CoA to N-succinyltetrahydrodipicolinate and CoA; Region: LbH_THP_succinylT; cd03350
261594010359	trimer interface [polypeptide binding]; other site
261594010360	active site
261594010361	substrate binding site [chemical binding]; other site
261594010362	CoA binding site [chemical binding]; other site
261594010363	Transcriptional regulator [Transcription]; Region: LysR; COG0583
261594010364	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
261594010365	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cd05466
261594010366	dimerization interface [polypeptide binding]; other site
261594010367	FOG: CBS domain [General function prediction only]; Region: COG0517
261594010368	The CBS domain, named after human CBS, is a small domain originally identified in cystathionine beta-synthase and is subsequently found in a wide range of different proteins. CBS domains usually occur in tandem repeats. They associate to form a so-called...; Region: CBS_pair_30; cd04643
261594010369	Antirepressor AbbA; Region: AbbA_antirepres; pfam14156
261594010370	Protein of unknown function (DUF458); Region: DUF458; pfam04308
261594010371	Protein of unknown function (DUF1797); Region: DUF1797; pfam08796
261594010372	NrdH-redoxin (NrdH) family; NrdH is a small monomeric protein with a conserved redox active CXXC motif within a TRX fold, characterized by a glutaredoxin (GRX)-like sequence and TRX-like activity profile. In vitro, it displays protein disulfide reductase...; Region: NrdH; cd02976
261594010373	catalytic residues [active]
261594010374	Protein of unknown function (DUF3993); Region: DUF3993; pfam13158
261594010375	EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2).  The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cd01948
261594010376	EAL-domain associated signalling protein domain; Region: YkuI_C; pfam10388
261594010377	Trans-2-enoyl-CoA reductase (TER) and 2,4-dienoyl-CoA reductase (DECR), atypical (a) SDR; Region: TER_DECR_SDR_a; cd05369
261594010378	short chain dehydrogenase; Provisional; Region: PRK07677
261594010379	NAD(P) binding site [chemical binding]; other site
261594010380	substrate binding site [chemical binding]; other site
261594010381	homotetramer interface [polypeptide binding]; other site
261594010382	active site
261594010383	homodimer interface [polypeptide binding]; other site
261594010384	phosphodiesterase YaeI; Provisional; Region: PRK11340
261594010385	Bacillus subtilis YkuE and related proteins, C-terminal metallophosphatase domain; Region: MPP_YkuE_C; cd07385
261594010386	putative active site [active]
261594010387	putative metal binding site [ion binding]; other site
261594010388	polyphosphate kinase; Provisional; Region: PRK05443
261594010389	Polyphosphate kinase N-terminal domain; Region: PP_kinase_N; pfam13089
261594010390	Polyphosphate kinase middle domain; Region: PP_kinase; pfam02503
261594010391	Catalytic C-terminal domain, first repeat, of Pseudomonas aeruginosa polyphosphate kinase 1 and similar proteins; Region: PLDc_PaPPK1_C1_like; cd09165
261594010392	putative domain interface [polypeptide binding]; other site
261594010393	putative active site [active]
261594010394	catalytic site [active]
261594010395	Catalytic C-terminal domain, second repeat, of Pseudomonas aeruginosa polyphosphate kinase 1 and similar proteins; Region: PLDc_PaPPK1_C2_like; cd09168
261594010396	putative domain interface [polypeptide binding]; other site
261594010397	putative active site [active]
261594010398	catalytic site [active]
261594010399	exopolyphosphatase; Region: exo_poly_only; TIGR03706
261594010400	Nucleotide-Binding Domain of the sugar kinase/HSP70/actin superfamily; Region: NBD_sugar-kinase_HSP70_actin; cd00012
261594010401	nucleotide binding site [chemical binding]; other site
261594010402	YkyB-like protein; Region: YkyB; pfam14177
261594010403	Putative cell-wall binding lipoprotein; Region: YkyA; pfam10368
261594010404	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
261594010405	I-site; other site
261594010406	active site
261594010407	metal binding site [ion binding]; metal-binding site
261594010408	Phage lysis protein, holin; Region: Phage_holin; cl04675
261594010409	Major Facilitator Superfamily; Region: MFS_1; pfam07690
261594010410	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594010411	putative substrate translocation pore; other site
261594010412	Predicted transcriptional regulators [Transcription]; Region: COG1695
261594010413	Transcriptional regulator PadR-like family; Region: PadR; cl17335
261594010414	5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase; Provisional; Region: PRK05222
261594010415	CIMS - Cobalamine-independent methonine synthase, or MetE, N-terminal domain_like. Many members have been characterized as 5-methyltetrahydropteroyltriglutamate-homocysteine methyltransferases, EC:2.1.1.14, mostly from bacteria and plants. This enzyme...; Region: CIMS_N_terminal_like; cd03312
261594010416	THF binding site; other site
261594010417	CIMS - Cobalamine-independent methonine synthase, or MetE, C-terminal domain_like. Many members have been characterized as 5-methyltetrahydropteroyltriglutamate-homocysteine methyltransferases, EC:2.1.1.14, mostly from bacteria and plants. This enzyme...; Region: CIMS_C_terminal_like; cd03311
261594010418	substrate binding site [chemical binding]; other site
261594010419	THF binding site; other site
261594010420	zinc-binding site [ion binding]; other site
261594010421	Competence protein J (ComJ); Region: ComJ; pfam11033
261594010422	Deoxyribonuclease NucA/NucB; Region: DNase_NucA_NucB; pfam14040
261594010423	Protein of unknown function (DUF3967); Region: DUF3967; pfam13152
261594010424	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
261594010425	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
261594010426	dimer interface [polypeptide binding]; other site
261594010427	phosphorylation site [posttranslational modification]
261594010428	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594010429	ATP binding site [chemical binding]; other site
261594010430	Mg2+ binding site [ion binding]; other site
261594010431	G-X-G motif; other site
261594010432	aminotransferase A; Validated; Region: PRK07683
261594010433	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
261594010434	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594010435	homodimer interface [polypeptide binding]; other site
261594010436	catalytic residue [active]
261594010437	Transcriptional regulators [Transcription]; Region: PurR; COG1609
261594010438	Helix-turn-helix (HTH) DNA binding domain of the LacI family of transcriptional regulators; Region: HTH_LacI; cd01392
261594010439	DNA binding site [nucleotide binding]
261594010440	domain linker motif; other site
261594010441	Ligand-binding domain of uncharacterized transcription regulator ycjW which is a member of the LacI-GalR family repressors; Region: PBP1_ycjW_transcription_regulator_like; cd06294
261594010442	putative dimerization interface [polypeptide binding]; other site
261594010443	putative ligand binding site [chemical binding]; other site
261594010444	ABC-type sugar transport system, permease component [Carbohydrate transport and metabolism]; Region: UgpE; COG0395
261594010445	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
261594010446	dimer interface [polypeptide binding]; other site
261594010447	conserved gate region; other site
261594010448	putative PBP binding loops; other site
261594010449	ABC-ATPase subunit interface; other site
261594010450	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
261594010451	dimer interface [polypeptide binding]; other site
261594010452	conserved gate region; other site
261594010453	putative PBP binding loops; other site
261594010454	ABC-ATPase subunit interface; other site
261594010455	Maltose-binding periplasmic proteins/domains [Carbohydrate transport and metabolism]; Region: MalE; COG2182
261594010456	Bacterial extracellular solute-binding protein; Region: SBP_bac_1; pfam01547
261594010457	N-terminal Early set domain associated with the catalytic domain of cyclomaltodextrinase and pullulan-degrading enzymes; Region: E_set_CDase_PDE_N; cd02857
261594010458	homodimer interface [polypeptide binding]; other site
261594010459	maltodextrin glucosidase; Provisional; Region: PRK10785
261594010460	Alpha amylase catalytic domain found in cyclomaltodextrinases and related proteins; Region: AmyAc_CMD; cd11338
261594010461	active site
261594010462	homodimer interface [polypeptide binding]; other site
261594010463	catalytic site [active]
261594010464	alpha,alpha-phosphotrehalase; Region: trehalose_treC; TIGR02403
261594010465	Alpha amylase catalytic domain found in Sucrose isomerases, oligo-1,6-glucosidase (also called isomaltase; sucrase-isomaltase; alpha-limit dextrinase), dextran glucosidase (also called glucan 1,6-alpha-glucosidase), and related proteins; Region: AmyAc_SI_OligoGlu_DGase; cd11333
261594010466	Ca binding site [ion binding]; other site
261594010467	active site
261594010468	catalytic site [active]
261594010469	glycerol-3-phosphate transporter ATP-binding subunit; Provisional; Region: ugpC; PRK11650
261594010470	The N-terminal ATPase domain of the maltose transporter, MalK; Region: ABC_MalK_N; cd03301
261594010471	Walker A/P-loop; other site
261594010472	ATP binding site [chemical binding]; other site
261594010473	Q-loop/lid; other site
261594010474	ABC transporter signature motif; other site
261594010475	Walker B; other site
261594010476	D-loop; other site
261594010477	H-loop/switch region; other site
261594010478	TOBE domain; Region: TOBE_2; pfam08402
261594010479	hypothetical protein; Provisional; Region: PRK06720
261594010480	NAD(P) binding site [chemical binding]; other site
261594010481	RDD family; Region: RDD; pfam06271
261594010482	Prokaryotic membrane lipoprotein lipid attachment site; Region: LPAM_1; pfam08139
261594010483	Protein of unknown function (DUF3997); Region: DUF3997; pfam13162
261594010484	Domain of unknown function (DUF4184); Region: DUF4184; pfam13803
261594010485	Predicted ATPase [General function prediction only]; Region: COG3910
261594010486	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
261594010487	Walker A/P-loop; other site
261594010488	ATP binding site [chemical binding]; other site
261594010489	Q-loop/lid; other site
261594010490	ABC transporter signature motif; other site
261594010491	Walker B; other site
261594010492	D-loop; other site
261594010493	H-loop/switch region; other site
261594010494	putative acyltransferase; Provisional; Region: PRK05790
261594010495	Thiolase are ubiquitous enzymes that catalyze the reversible thiolytic cleavage of 3-ketoacyl-CoA into acyl-CoA and acetyl-CoA, a 2-step reaction involving a covalent intermediate formed with a catalytic cysteine. They are found in prokaryotes and...; Region: thiolase; cd00751
261594010496	dimer interface [polypeptide binding]; other site
261594010497	active site
261594010498	Members of the Nudix hydrolase superfamily catalyze the hydrolysis of NUcleoside DIphosphates linked to other moieties, X. Enzymes belonging to this superfamily require a divalent cation, such as Mg2+ or Mn2+, for their activity and contain a highly...; Region: Nudix_Hydrolase_18; cd04677
261594010499	nudix motif; other site
261594010500	Protein of unknown function (DUF3928); Region: DUF3928; pfam13065
261594010501	hypothetical protein; Validated; Region: PRK07668
261594010502	hypothetical protein; Validated; Region: PRK07668
261594010503	hypothetical protein; Validated; Region: PRK07668
261594010504	Predicted transcriptional regulators [Transcription]; Region: COG1695
261594010505	Transcriptional regulator PadR-like family; Region: PadR; pfam03551
261594010506	3-hydroxybutyrate dehydrogenase; Provisional; Region: PRK12429
261594010507	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
261594010508	NAD(P) binding site [chemical binding]; other site
261594010509	active site
261594010510	YvrJ protein family; Region: YvrJ; pfam12841
261594010511	methylthioribose-1-phosphate isomerase; Reviewed; Region: mtnA; PRK05720
261594010512	S-methyl-5-thioribose-1-phosphate isomerase; Region: salvage_mtnA; TIGR00512
261594010513	methylthioribose kinase; Reviewed; Region: mtnK; PRK09550
261594010514	Phosphotransferase enzyme family; Region: APH; pfam01636
261594010515	Predicted amidohydrolase [General function prediction only]; Region: COG0388
261594010516	Uncharacterized subgroup of the nitrilase superfamily (putative class 13 nitrilases); Region: nitrilase_5; cd07583
261594010517	putative active site [active]
261594010518	catalytic triad [active]
261594010519	putative dimer interface [polypeptide binding]; other site
261594010520	transaminase; Reviewed; Region: PRK08068
261594010521	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
261594010522	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594010523	homodimer interface [polypeptide binding]; other site
261594010524	catalytic residue [active]
261594010525	2,3-diketo-5-methylthiopentyl-1-phosphate enolase; Reviewed; Region: mtnW; PRK09549
261594010526	2,3-diketo-5-methylthiopentyl-1-phosphate enolase; Region: RLP_DK-MTP-1-P-enolase; cd08209
261594010527	dimer interface [polypeptide binding]; other site
261594010528	active site
261594010529	catalytic residue [active]
261594010530	metal binding site [ion binding]; metal-binding site
261594010531	2-hydroxy-3-keto-5-methylthiopentenyl-1-phosphate phosphatase; Reviewed; Region: mtnX; PRK09552
261594010532	haloacid dehalogenase-like hydrolase; Region: Hydrolase; pfam00702
261594010533	methylthioribulose-1-phosphate dehydratase; Reviewed; Region: mtnB; PRK06754
261594010534	intersubunit interface [polypeptide binding]; other site
261594010535	active site
261594010536	Zn2+ binding site [ion binding]; other site
261594010537	ARD/ARD' family; Region: ARD; pfam03079
261594010538	Cupin domain; Region: Cupin_2; pfam07883
261594010539	Protein of unknown function (DUF3909); Region: DUF3909; pfam13077
261594010540	c-di-GMP synthetase (diguanylate cyclase, GGDEF domain) [Signal    transduction mechanisms]; Region: COG2199
261594010541	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
261594010542	metal binding site [ion binding]; metal-binding site
261594010543	active site
261594010544	I-site; other site
261594010545	Nitroreductase-like family 1. A subfamily of the nitroreductase family containing uncharacterized proteins that are similar to nitroreductase. Nitroreductase catalyzes the reduction of nitroaromatic compounds such as nitrotoluenes, nitrofurans and...; Region: Nitroreductase_1; cd02137
261594010546	dimer interface [polypeptide binding]; other site
261594010547	FMN binding site [chemical binding]; other site
261594010548	Protein of unknown function (DUF3915); Region: DUF3915; pfam13054
261594010549	Phosphoenolpyruvate-protein kinase (PTS system EI component in bacteria) [Carbohydrate transport and metabolism]; Region: PtsA; COG1080
261594010550	PEP-utilising enzyme, N-terminal; Region: PEP-utilisers_N; pfam05524
261594010551	PEP-utilising enzyme, mobile domain; Region: PEP-utilizers; pfam00391
261594010552	PEP-utilising enzyme, TIM barrel domain; Region: PEP-utilizers_C; pfam02896
261594010553	Histidine-containing phosphocarrier protein (HPr)-like proteins. HPr is a central component of the bacterial phosphoenolpyruvate sugar phosphotransferase system (PTS). The PTS catalyses the phosphorylation of sugar substrates during their translocation...; Region: PTS-HPr_like; cd00367
261594010554	dimerization domain swap beta strand [polypeptide binding]; other site
261594010555	regulatory protein interface [polypeptide binding]; other site
261594010556	active site
261594010557	regulatory phosphorylation site [posttranslational modification]; other site
261594010558	Phosphotransferase system IIC components, glucose/maltose/N-acetylglucosamine-specific [Carbohydrate transport and metabolism]; Region: PtsG; COG1263
261594010559	PTS system, glucose-specific IIBC component; Region: PTS-II-BC-glcB; TIGR02002
261594010560	PTS_IIB, PTS system, glucose/sucrose specific IIB subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This family...; Region: PTS_IIB_glc; cd00212
261594010561	active site turn [active]
261594010562	phosphorylation site [posttranslational modification]
261594010563	PTS_IIA, PTS system, glucose/sucrose specific IIA subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This family...; Region: PTS_IIA_glc; cd00210
261594010564	HPr interaction site; other site
261594010565	glycerol kinase (GK) interaction site [polypeptide binding]; other site
261594010566	active site
261594010567	phosphorylation site [posttranslational modification]
261594010568	transcriptional antiterminator BglG; Provisional; Region: PRK09772
261594010569	CAT RNA binding domain; Region: CAT_RBD; smart01061
261594010570	PRD domain; Region: PRD; pfam00874
261594010571	PRD domain; Region: PRD; pfam00874
261594010572	haloacid dehalogenase-like hydrolase; Region: Hydrolase_3; pfam08282
261594010573	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
261594010574	active site
261594010575	motif I; other site
261594010576	motif II; other site
261594010577	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
261594010578	Transcriptional regulators [Transcription]; Region: PhnF; COG2188
261594010579	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
261594010580	DNA-binding site [nucleotide binding]; DNA binding site
261594010581	The UbiC transcription regulator-associated (UTRA) domain is a conserved ligand-binding domain; Region: UTRA; smart00866
261594010582	6-phosphogluconolactonase/Glucosamine-6-phosphate isomerase/deaminase [Carbohydrate transport and metabolism]; Region: NagB; COG0363
261594010583	GlcN6P_deaminase: Glucosamine-6-phosphate (GlcN6P) deaminase subfamily; GlcN6P deaminase catalyzes the reversible conversion of GlcN6P to D-fructose-6-phosphate (Fru6P) and ammonium. The reaction is an aldo-keto isomerization coupled with an amination or...; Region: GlcN6P_deaminase; cd01399
261594010584	active site
261594010585	trimer interface [polypeptide binding]; other site
261594010586	allosteric site; other site
261594010587	active site lid [active]
261594010588	hexamer (dimer of trimers) interface [polypeptide binding]; other site
261594010589	N-acetylglucosamine-6-phosphate deacetylase, NagA, catalyzes the hydrolysis of the N-acetyl group of N-acetyl-glucosamine-6-phosphate (GlcNAc-6-P) to glucosamine 6-phosphate and acetate. This is the first committed step in the biosynthetic pathway to...; Region: NagA; cd00854
261594010590	N-acetylglucosamine-6-phosphate deacetylase [Carbohydrate transport and metabolism]; Region: NagA; COG1820
261594010591	active site
261594010592	dimer interface [polypeptide binding]; other site
261594010593	Predicted hydrolase (metallo-beta-lactamase superfamily) [General function prediction only]; Region: ComEC; COG2333
261594010594	Metallo-beta-lactamase superfamily; Region: Lactamase_B; smart00849
261594010595	segregation and condensation protein B; Reviewed; Region: scpB; PRK00135
261594010596	segregation and condensation protein A; Reviewed; Region: scpA; PRK00104
261594010597	Domain of unknown function (DUF309); Region: DUF309; pfam03745
261594010598	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594010599	Coenzyme A binding pocket [chemical binding]; other site
261594010600	cyclophilin: cyclophilin-type peptidylprolyl cis- trans isomerases. This family contains eukaryotic, bacterial and archeal proteins which exhibit a peptidylprolyl cis- trans isomerases activity (PPIase, Rotamase) and in addition bind the...; Region: cyclophilin; cd00317
261594010601	active site
261594010602	Predicted secreted protein [Function unknown]; Region: COG4086
261594010603	Protein of unknown function (DUF1002); Region: DUF1002; pfam06207
261594010604	haloacid dehalogenase-like hydrolase; Region: Hydrolase_3; pfam08282
261594010605	trehalose-6-phosphate phosphatase; Provisional; Region: PRK10187; cl17105
261594010606	haloacid dehalogenase-like hydrolase; Region: HAD; cl17202
261594010607	Bacillus/Clostridium GerA spore germination protein; Region: GerA; pfam03323
261594010608	Stage V sporulation protein AE1; Region: SpoVAE; pfam14097
261594010609	stage V sporulation protein AE; Region: spore_V_AE; TIGR02839
261594010610	stage V sporulation protein AD; Validated; Region: PRK08304
261594010611	stage V sporulation protein AD; Provisional; Region: PRK12404
261594010612	stage V sporulation protein AC; Region: spore_V_AC; TIGR02838
261594010613	Stage V sporulation protein AB; Region: SpoVAB; pfam13782
261594010614	Stage V sporulation protein AA; Region: SporV_AA; pfam12164
261594010615	uncharacterized bacterial and archaeal solute carrier 6 subfamily; solute-binding domain; Region: SLC6sbd_u1; cd10334
261594010616	Na2 binding site [ion binding]; other site
261594010617	putative substrate binding site 1 [chemical binding]; other site
261594010618	Na binding site 1 [ion binding]; other site
261594010619	putative substrate binding site 2 [chemical binding]; other site
261594010620	sporulation sigma factor SigF; Validated; Region: PRK05572
261594010621	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
261594010622	Sigma-70 region 3; Region: Sigma70_r3; pfam04539
261594010623	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
261594010624	DNA binding residues [nucleotide binding]
261594010625	Anti-sigma regulatory factor (Ser/Thr protein kinase) [Signal transduction mechanisms]; Region: RsbW; COG2172
261594010626	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594010627	ATP binding site [chemical binding]; other site
261594010628	Mg2+ binding site [ion binding]; other site
261594010629	G-X-G motif; other site
261594010630	anti-sigma F factor antagonist; Region: spore_II_AA; TIGR02886
261594010631	D-alanyl-D-alanine carboxypeptidase [Cell envelope biogenesis, outer membrane]; Region: DacC; COG1686
261594010632	Beta-lactamase enzyme family; Region: Beta-lactamase2; cl17872
261594010633	Penicillin-binding protein 5, C-terminal domain; Region: PBP5_C; pfam07943
261594010634	Predicted transcriptional regulators [Transcription]; Region: COG1725
261594010635	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
261594010636	DNA-binding site [nucleotide binding]; DNA binding site
261594010637	ABC-type multidrug transport system, ATPase component [Defense mechanisms]; Region: CcmA; COG1131
261594010638	ATP-binding cassette domain of the drug resistance transporter and related proteins, subfamily A; Region: ABC_DR_subfamily_A; cd03230
261594010639	Walker A/P-loop; other site
261594010640	ATP binding site [chemical binding]; other site
261594010641	Q-loop/lid; other site
261594010642	ABC transporter signature motif; other site
261594010643	Walker B; other site
261594010644	D-loop; other site
261594010645	H-loop/switch region; other site
261594010646	ABC-2 family transporter protein; Region: ABC2_membrane_4; pfam12730
261594010647	helix_turn_helix multiple antibiotic resistance protein; Region: HTH_MARR; smart00347
261594010648	MarR family; Region: MarR; pfam01047
261594010649	MarR family; Region: MarR_2; cl17246
261594010650	Protein of unknown function (DUF541); Region: SIMPL; pfam04402
261594010651	Xanthine/uracil/vitamin C permease [Nucleotide transport and    metabolism]; Region: COG2252
261594010652	Uncharacterized bacterial subfamily of the Thermotoga maritima CorA-like family; Region: TmCorA-like_u2; cd12831
261594010653	CorA-like Mg2+ transporter protein; Region: CorA; pfam01544
261594010654	oligomer interface [polypeptide binding]; other site
261594010655	metal binding site [ion binding]; metal-binding site
261594010656	metal binding site [ion binding]; metal-binding site
261594010657	putative Cl binding site [ion binding]; other site
261594010658	aspartate ring; other site
261594010659	basic sphincter; other site
261594010660	hydrophobic gate; other site
261594010661	periplasmic entrance; other site
261594010662	pyrimidine-nucleoside phosphorylase; Reviewed; Region: PRK06078
261594010663	Glycosyl transferase family, helical bundle domain; Region: Glycos_trans_3N; pfam02885
261594010664	Glycosyl transferase family, a/b domain; Region: Glycos_transf_3; pfam00591
261594010665	Pyrimidine nucleoside phosphorylase C-terminal domain; Region: PYNP_C; pfam07831
261594010666	purine nucleoside phosphorylase; Provisional; Region: PRK08202
261594010667	phosphopentomutase; Provisional; Region: PRK05362
261594010668	Metalloenzyme superfamily; Region: Metalloenzyme; pfam01676
261594010669	YtkA-like; Region: YtkA; pfam13115
261594010670	YtkA-like; Region: YtkA; pfam13115
261594010671	XerD and XerC integrases, DNA breaking-rejoining enzymes, N- and C-terminal domains. XerD-like integrases are involved in the site-specific integration and excision of lysogenic bacteriophage genomes, transposition of conjugative transposons, termination...; Region: INT_XerDC; cd00798
261594010672	tyrosine recombinase XerD; Region: recomb_XerD; TIGR02225
261594010673	active site
261594010674	Int/Topo IB signature motif; other site
261594010675	Protein of unknown function (DUF4227); Region: DUF4227; pfam14004
261594010676	ferric uptake regulator; Provisional; Region: fur; PRK09462
261594010677	Ferric uptake regulator(Fur) and related metalloregulatory proteins; typically iron-dependent, DNA-binding repressors and activators; Region: Fur_like; cd07153
261594010678	metal binding site 2 [ion binding]; metal-binding site
261594010679	putative DNA binding helix; other site
261594010680	metal binding site 1 [ion binding]; metal-binding site
261594010681	dimer interface [polypeptide binding]; other site
261594010682	structural Zn2+ binding site [ion binding]; other site
261594010683	stage II sporulation protein M; Region: spo_II_M; TIGR02831
261594010684	Acetyltransferase (GNAT) domain; Region: Acetyltransf_3; pfam13302
261594010685	Acetyltransferase (GNAT) family; Region: Acetyltransf_1; pfam00583
261594010686	ADP-ribose pyrophosphatase (ADPRase) catalyzes the hydrolysis of ADP-ribose and a variety of additional ADP-sugar conjugates to AMP and ribose-5-phosphate. Like other members of the Nudix hydrolase superfamily, it requires a divalent cation, such as Mg2+; Region: ADPRase_NUDT5; cd03424
261594010687	dimer interface [polypeptide binding]; other site
261594010688	ADP-ribose binding site [chemical binding]; other site
261594010689	active site
261594010690	nudix motif; other site
261594010691	metal binding site [ion binding]; metal-binding site
261594010692	Protein of unknown function (DUF3936); Region: DUF3936; pfam13072
261594010693	Aldo-keto reductases (AKRs) are a superfamily of soluble NAD(P)(H) oxidoreductases whose chief purpose is to reduce aldehydes and ketones to primary and secondary alcohols. AKRs are present in all phyla and are of importance to both health and industrial...; Region: Aldo_ket_red; cd06660
261594010694	Aldo/keto reductase family; Region: Aldo_ket_red; pfam00248
261594010695	active site
261594010696	catalytic tetrad [active]
261594010697	Aldo-keto reductases (AKRs) are a superfamily of soluble NAD(P)(H) oxidoreductases whose chief purpose is to reduce aldehydes and ketones to primary and secondary alcohols. AKRs are present in all phyla and are of importance to both health and industrial...; Region: Aldo_ket_red; cd06660
261594010698	Aldo/keto reductase family; Region: Aldo_ket_red; pfam00248
261594010699	active site
261594010700	catalytic tetrad [active]
261594010701	Uncharacterized protein family (UPF0157); Region: UPF0157; pfam04229
261594010702	Protein of unknown function (DUF3886); Region: DUF3886; pfam13025
261594010703	5'-nucleotidase/2',3'-cyclic phosphodiesterase and related esterases [Nucleotide transport and metabolism]; Region: UshA; COG0737
261594010704	Bacillus subtilis YhcR endonuclease and related proteins, N-terminal metallophosphatase domain; Region: MPP_YhcR_N; cd07412
261594010705	putative active site [active]
261594010706	putative metal binding site [ion binding]; other site
261594010707	5'-nucleotidase, C-terminal domain; Region: 5_nucleotid_C; pfam02872
261594010708	Ribbon-helix-helix domain; Region: RHH_3; pfam12651
261594010709	proline-specific peptidase, Bacillus coagulans-type subfamily; Region: pro_imino_pep_2; TIGR01250
261594010710	Predicted permease [General function prediction only]; Region: COG2056
261594010711	Na+-H+ antiporter family; Region: Na_H_antiport_2; pfam13726
261594010712	TRAP-type C4-dicarboxylate transport system, large permease component [Carbohydrate transport and metabolism]; Region: DctQ; cl17274
261594010713	Transcriptional regulators [Transcription]; Region: PurR; COG1609
261594010714	Helix-turn-helix (HTH) DNA binding domain of the LacI family of transcriptional regulators; Region: HTH_LacI; cd01392
261594010715	DNA binding site [nucleotide binding]
261594010716	domain linker motif; other site
261594010717	Ligand binding domain of the LacI tanscriptional regulator family belonging to the type I periplasmic-binding fold protein superfamily; Region: PBP1_LacI_sugar_binding_like; cd06267
261594010718	dimerization interface [polypeptide binding]; other site
261594010719	ligand binding site [chemical binding]; other site
261594010720	Acetyltransferases [General function prediction only]; Region: RimI; COG0456
261594010721	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594010722	Coenzyme A binding pocket [chemical binding]; other site
261594010723	Alpha/beta hydrolase family; Region: Abhydrolase_5; pfam12695
261594010724	Protein of unknown function (DUF2552); Region: DUF2552; pfam10827
261594010725	Iron-binding zinc finger CDGSH type; Region: zf-CDGSH; pfam09360
261594010726	riboflavin biosynthesis protein RibD; Region: eubact_ribD; TIGR00326
261594010727	Riboflavin-specific deaminase. Riboflavin biosynthesis protein RibD (Diaminohydroxyphosphoribosylaminopyrimidine deaminase) catalyzes the deamination of 2,5-diamino-6-ribosylamino-4(3H)-pyrimidinone 5'-phosphate, which is an intermediate step in the...; Region: Riboflavin_deaminase-reductase; cd01284
261594010728	catalytic motif [active]
261594010729	Zn binding site [ion binding]; other site
261594010730	RibD C-terminal domain; Region: RibD_C; cl17279
261594010731	riboflavin synthase subunit alpha; Provisional; Region: PRK09289
261594010732	Lumazine binding domain; Region: Lum_binding; pfam00677
261594010733	Lumazine binding domain; Region: Lum_binding; pfam00677
261594010734	bifunctional 3,4-dihydroxy-2-butanone 4-phosphate synthase/GTP cyclohydrolase II protein; Provisional; Region: PRK09311
261594010735	3,4-dihydroxy-2-butanone 4-phosphate synthase; Region: DHBP_synthase; pfam00926
261594010736	GTP cyclohydrolase II (RibA).  GTP cyclohydrolase II catalyzes the conversion of GTP to 2,5-diamino-6-ribosylamino-4(3H)-pyrimidinone 5' phosphate, formate, pyrophosphate (APy), and GMP in the biosynthetic pathway of riboflavin. Riboflavin is the...; Region: GTP_cyclohydro2; cd00641
261594010737	dimerization interface [polypeptide binding]; other site
261594010738	active site
261594010739	lumazine synthase (6,7-dimethyl-8-ribityllumazine synthase, LS), catalyzes the penultimate step in the biosynthesis of riboflavin (vitamin B2); type-I; Region: Lumazine_synthase-I; cd09209
261594010740	homopentamer interface [polypeptide binding]; other site
261594010741	active site
261594010742	biotin synthase; Validated; Region: PRK06256
261594010743	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
261594010744	FeS/SAM binding site; other site
261594010745	Biotin and Thiamin Synthesis associated domain; Region: BATS; pfam06968
261594010746	biotin biosynthesis protein BioC; Region: BioC; TIGR02072
261594010747	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594010748	S-adenosylmethionine binding site [chemical binding]; other site
261594010749	Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596
261594010750	TAP-like protein; Region: Abhydrolase_4; pfam08386
261594010751	pyridoxal phosphate-dependent acyltransferase, putative; Region: gly_Cac_T_rel; TIGR01825
261594010752	KBL_like; this family belongs to the pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD corresponds to serine palmitoyltransferase (SPT), 5-aminolevulinate synthase (ALAS); Region: KBL_like; cd06454
261594010753	substrate-cofactor binding pocket; other site
261594010754	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594010755	catalytic residue [active]
261594010756	dithiobiotin synthetase; Reviewed; Region: bioD; PRK00090
261594010757	AAA domain; Region: AAA_26; pfam13500
261594010758	adenosylmethionine--8-amino-7-oxononanoate transaminase; Provisional; Region: PRK06916
261594010759	Acetyl ornithine aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to ornithine aminotransferase, acetylornithine aminotransferase; Region: OAT_like; cd00610
261594010760	inhibitor-cofactor binding pocket; inhibition site
261594010761	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594010762	catalytic residue [active]
261594010763	Na+/H+ antiporter NhaC; Region: antiport_nhaC; TIGR00931
261594010764	bifunctional 2',3'-cyclic nucleotide 2'-phosphodiesterase/3'-nucleotidase precursor protein; Reviewed; Region: PRK09418
261594010765	Escherichia coli CpdB and related proteins, N-terminal metallophosphatase domain; Region: MPP_CpdB_N; cd07410
261594010766	active site
261594010767	metal binding site [ion binding]; metal-binding site
261594010768	5'-nucleotidase, C-terminal domain; Region: 5_nucleotid_C; pfam02872
261594010769	SGNH_hydrolase, or GDSL_hydrolase, is a diverse family of lipases and esterases. The tertiary fold of the enzyme is substantially different from that of the alpha/beta hydrolase family and unique among all known hydrolases; its active site closely...; Region: SGNH_hydrolase; cl01053
261594010770	active site
261594010771	catalytic triad [active]
261594010772	oxyanion hole [active]
261594010773	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
261594010774	dimerization interface [polypeptide binding]; other site
261594010775	putative DNA binding site [nucleotide binding]; other site
261594010776	helix_turn_helix multiple antibiotic resistance protein; Region: HTH_MARR; smart00347
261594010777	putative Zn2+ binding site [ion binding]; other site
261594010778	ornithine carbamoyltransferase; Provisional; Region: PRK00779
261594010779	Aspartate/ornithine carbamoyltransferase, carbamoyl-P binding domain; Region: OTCace_N; pfam02729
261594010780	Aspartate/ornithine carbamoyltransferase, Asp/Orn binding domain; Region: OTCace; pfam00185
261594010781	acetylornithine aminotransferase; Provisional; Region: argD; PRK02936
261594010782	Acetyl ornithine aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to ornithine aminotransferase, acetylornithine aminotransferase; Region: OAT_like; cd00610
261594010783	inhibitor-cofactor binding pocket; inhibition site
261594010784	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594010785	catalytic residue [active]
261594010786	AAK_NAGK-like: N-Acetyl-L-glutamate kinase (NAGK)-like . Included in this CD are the Escherichia coli and Pseudomonas aeruginosa type NAGKs which catalyze the phosphorylation of N-acetyl-L-glutamate (NAG) by ATP in the second step of arginine...; Region: AAK_NAGK-like; cd04238
261594010787	nucleotide binding site [chemical binding]; other site
261594010788	N-acetyl-L-glutamate binding site [chemical binding]; other site
261594010789	Ornithine acetyltransferase (OAT) family; also referred to as ArgJ. OAT catalyzes the first and fifth steps in arginine biosynthesis, coupling acetylation of glutamate with deacetylation of N-acetylornithine, which allows recycling of the acetyl group in...; Region: OAT; cd02152
261594010790	heterotetramer interface [polypeptide binding]; other site
261594010791	active site pocket [active]
261594010792	cleavage site
261594010793	N-acetyl-gamma-glutamyl-phosphate reductase; Validated; Region: argC; PRK00436
261594010794	Semialdehyde dehydrogenase, NAD binding domain; Region: Semialdhyde_dh; smart00859
261594010795	YqzH-like protein; Region: YqzH; pfam14164
261594010796	Short-chain dehydrogenases of various substrate specificities [General function prediction only]; Region: DltE; COG0300
261594010797	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
261594010798	NAD(P) binding site [chemical binding]; other site
261594010799	active site
261594010800	pyrroline-5-carboxylate reductase; Reviewed; Region: PRK07679
261594010801	Pyrroline-5-carboxylate reductase [Amino acid transport and metabolism]; Region: ProC; COG0345
261594010802	Serine dehydratase alpha chain; Region: SDH_alpha; cl12120
261594010803	L-serine deaminase [Amino acid transport and metabolism]; Region: SdaA; COG1760
261594010804	L-serine dehydratase, iron-sulfur-dependent, beta subunit; Region: sda_beta; TIGR00719
261594010805	Serine dehydratase beta chain; Region: SDH_beta; pfam03315
261594010806	C-terminal ACT domain of the L-serine dehydratase (LSD), iron-sulfur-dependent, beta subunit; Region: ACT_LSD; cd04903
261594010807	putative L-serine binding site [chemical binding]; other site
261594010808	ribonuclease Z; Region: RNase_Z; TIGR02651
261594010809	Protein of unknown function (DUF3932); Region: DUF3932; pfam13068
261594010810	DNA polymerase IV; Validated; Region: PRK01810
261594010811	DNA Polymerase IV/Kappa; Region: PolY_Pol_IV_kappa; cd03586
261594010812	active site
261594010813	DNA binding site [nucleotide binding]
261594010814	Domain of unknown function (DUF4113); Region: DUF4113; pfam13438
261594010815	M20 Peptidase T like enzymes specifically cleave tripeptides; Region: M20_peptT_like; cd05683
261594010816	peptidase T-like protein; Region: PepT-like; TIGR01883
261594010817	metal binding site [ion binding]; metal-binding site
261594010818	putative dimer interface [polypeptide binding]; other site
261594010819	Acetyltransferases, including N-acetylases of ribosomal proteins [Translation, ribosomal structure and biogenesis]; Region: RimL; COG1670
261594010820	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cl17182
261594010821	Protein of unknown function (DUF3894); Region: DUF3894; pfam13033
261594010822	Uncharacterized protein conserved in bacteria [Function unknown]; Region: ErfK; COG1376
261594010823	L,D-transpeptidase catalytic domain; Region: YkuD; pfam03734
261594010824	Predicted membrane protein [Function unknown]; Region: COG4129
261594010825	Bacterial protein of unknown function (DUF939); Region: DUF939; pfam06081
261594010826	DUF939 C-terminal domain; Region: DUF939_C; pfam11728
261594010827	ABC-type polar amino acid transport system, ATPase component [Amino acid transport and metabolism]; Region: GlnQ; COG1126
261594010828	ATP-binding cassette domain of the histidine and glutamine transporters; Region: ABC_HisP_GlnQ; cd03262
261594010829	Walker A/P-loop; other site
261594010830	ATP binding site [chemical binding]; other site
261594010831	Q-loop/lid; other site
261594010832	ABC transporter signature motif; other site
261594010833	Walker B; other site
261594010834	D-loop; other site
261594010835	H-loop/switch region; other site
261594010836	ABC-type arginine transport system, permease component [Amino acid transport and metabolism]; Region: ArtQ; COG4215
261594010837	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
261594010838	dimer interface [polypeptide binding]; other site
261594010839	conserved gate region; other site
261594010840	putative PBP binding loops; other site
261594010841	ABC-ATPase subunit interface; other site
261594010842	Bacterial extracellular solute-binding proteins, family 3; Region: SBP_bac_3; pfam00497
261594010843	Bacterial periplasmic transport systems use membrane-bound complexes and substrate-bound, membrane-associated, periplasmic binding proteins (PBPs) to transport a wide variety of  substrates, such as, amino acids, peptides, sugars, vitamins and inorganic...; Region: PBPb; cd00134
261594010844	substrate binding pocket [chemical binding]; other site
261594010845	membrane-bound complex binding site; other site
261594010846	hinge residues; other site
261594010847	Disulphide isomerase; Region: Disulph_isomer; pfam06491
261594010848	Protein of unknown function (DUF2992); Region: DUF2992; pfam11208
261594010849	Members of the Nudix hydrolase superfamily catalyze the hydrolysis of NUcleoside DIphosphates linked to other moieties, X. Enzymes belonging to this superfamily require a divalent cation, such as Mg2+ or Mn2+, for their activity and contain a highly...; Region: Nudix_Hydrolase_18; cd04677
261594010850	nudix motif; other site
261594010851	rod shape-determining protein RodA; Region: rodA_shape; TIGR02210
261594010852	branched-chain alpha-keto acid dehydrogenase subunit E2; Reviewed; Region: PRK11856
261594010853	Lipoyl domain of the dihydrolipoyl acyltransferase component (E2) of 2-oxo acid dehydrogenases. 2-oxo acid dehydrogenase multienzyme complexes, like pyruvate dehydrogenase (PDH), 2-oxoglutarate dehydrogenase (OGDH) and branched-chain 2-oxo acid...; Region: lipoyl_domain; cd06849
261594010854	E3 interaction surface; other site
261594010855	lipoyl attachment site [posttranslational modification]; other site
261594010856	e3 binding domain; Region: E3_binding; pfam02817
261594010857	2-oxoacid dehydrogenases acyltransferase (catalytic domain); Region: 2-oxoacid_dh; pfam00198
261594010858	Pyruvate/2-oxoglutarate dehydrogenase complex, dehydrogenase (E1) component, eukaryotic type, beta subunit [Energy production and conversion]; Region: AcoB; COG0022
261594010859	Pyrimidine (PYR) binding domain of the beta subunits of the E1 components of human pyruvate dehydrogenase complex (E1- PDHc) and related proteins; Region: TPP_PYR_E1-PDHc-beta_like; cd07036
261594010860	alpha subunit interface [polypeptide binding]; other site
261594010861	TPP binding site [chemical binding]; other site
261594010862	heterodimer interface [polypeptide binding]; other site
261594010863	Transketolase, C-terminal domain; Region: Transketolase_C; pfam02780
261594010864	Pyruvate/2-oxoglutarate dehydrogenase complex, dehydrogenase (E1) component, eukaryotic type, alpha subunit [Energy production and conversion]; Region: AcoA; COG1071
261594010865	Thiamine pyrophosphate (TPP) family, E1 of PDC_ADC_BCADC subfamily, TPP-binding module; composed of proteins similar to the E1 components of the human pyruvate dehydrogenase complex (PDC), the acetoin dehydrogenase complex (ADC) and the branched chain...; Region: TPP_E1_PDC_ADC_BCADC; cd02000
261594010866	tetramer interface [polypeptide binding]; other site
261594010867	TPP-binding site [chemical binding]; other site
261594010868	heterodimer interface [polypeptide binding]; other site
261594010869	phosphorylation loop region [posttranslational modification]
261594010870	dihydrolipoamide dehydrogenase; Validated; Region: PRK05976
261594010871	Anaerobic glycerol-3-phosphate dehydrogenase [Amino acid transport and metabolism]; Region: GlpB; cl17730
261594010872	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
261594010873	Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain; Region: Pyr_redox_dim; pfam02852
261594010874	Nucleotide-Binding Domain of the sugar kinase/HSP70/actin superfamily; Region: NBD_sugar-kinase_HSP70_actin; cd00012
261594010875	nucleotide binding site [chemical binding]; other site
261594010876	Acetokinase family; Region: Acetate_kinase; cl17229
261594010877	Glutamate dehydrogenase/leucine dehydrogenase [Amino acid transport and metabolism]; Region: GdhA; COG0334
261594010878	Glu/Leu/Phe/Val dehydrogenase, dimerisation domain; Region: ELFV_dehydrog_N; pfam02812
261594010879	NAD(P) binding domain of leucine dehydrogenase, phenylalanine dehydrogenase, and valine dehydrogenase; Region: NAD_bind_Leu_Phe_Val_DH; cd01075
261594010880	NAD binding site [chemical binding]; other site
261594010881	Phe binding site; other site
261594010882	phosphate butyryltransferase; Validated; Region: PRK07742
261594010883	Transcriptional regulator containing PAS, AAA-type ATPase, and DNA-binding domains [Transcription / Signal transduction mechanisms]; Region: RocR; COG3829
261594010884	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
261594010885	putative active site [active]
261594010886	heme pocket [chemical binding]; other site
261594010887	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
261594010888	putative active site [active]
261594010889	heme pocket [chemical binding]; other site
261594010890	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
261594010891	Walker A motif; other site
261594010892	ATP binding site [chemical binding]; other site
261594010893	Walker B motif; other site
261594010894	arginine finger; other site
261594010895	Bacterial regulatory protein, Fis family; Region: HTH_8; pfam02954
261594010896	Protein of unknown function (DUF2627); Region: DUF2627; pfam11118
261594010897	Glycerophosphoryl diester phosphodiesterase [Energy production and conversion]; Region: UgpQ; COG0584
261594010898	Glycerophosphodiester phosphodiesterase domain of Thermoanaerobacter tengcongensis and similar proteins; Region: GDPD_TtGDE_like; cd08563
261594010899	active site
261594010900	catalytic site [active]
261594010901	metal binding site [ion binding]; metal-binding site
261594010902	dimer interface [polypeptide binding]; other site
261594010903	YycC-like protein; Region: YycC; pfam14174
261594010904	conserved hypothetical integral membrane protein; Region: TIGR03766
261594010905	sporulation transcription factor Spo0A; Region: spore_0_A; TIGR02875
261594010906	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594010907	active site
261594010908	phosphorylation site [posttranslational modification]
261594010909	intermolecular recognition site; other site
261594010910	dimerization interface [polypeptide binding]; other site
261594010911	Sporulation initiation factor Spo0A C terminal; Region: Spo0A_C; pfam08769
261594010912	stage IV sporulation protein B; Region: spore_IV_B; TIGR02860
261594010913	PDZ domain of bacterial and plant zinc metalloprotases, presumably membrane-associated or integral membrane proteases, which may be involved in signalling and regulatory mechanisms. May be responsible for substrate recognition and/or binding, as most PDZ...; Region: PDZ_metalloprotease; cd00989
261594010914	SpoIVB peptidase S55; Region: Peptidase_S55; pfam05580
261594010915	ATPase involved in DNA repair [DNA replication, recombination, and repair]; Region: RecN; COG0497
261594010916	ATP-binding cassette domain of RecN; Region: ABC_RecN; cd03241
261594010917	Walker A/P-loop; other site
261594010918	ATP binding site [chemical binding]; other site
261594010919	Q-loop/lid; other site
261594010920	ATP-binding cassette domain of RecN; Region: ABC_RecN; cd03241
261594010921	ABC transporter signature motif; other site
261594010922	Walker B; other site
261594010923	D-loop; other site
261594010924	H-loop/switch region; other site
261594010925	Arginine repressor, DNA binding domain; Region: Arg_repressor; pfam01316
261594010926	arginine repressor; Provisional; Region: PRK04280
261594010927	Arginine repressor, C-terminal domain; Region: Arg_repressor_C; pfam02863
261594010928	Predicted rRNA methylase [Translation, ribosomal structure and biogenesis]; Region: COG1189
261594010929	S4/Hsp/ tRNA synthetase RNA-binding domain; The domain surface is populated by conserved, charged residues that define a likely RNA-binding site;  Found in stress proteins, ribosomal proteins and tRNA synthetases; This may imply a hitherto unrecognized...; Region: S4; cd00165
261594010930	RNA binding surface [nucleotide binding]; other site
261594010931	FtsJ-like methyltransferase; Region: FtsJ; pfam01728
261594010932	1-deoxy-D-xylulose-5-phosphate synthase; Provisional; Region: PRK05444
261594010933	Thiamine pyrophosphate (TPP) family, DXS subfamily, TPP-binding module; 1-Deoxy-D-xylulose-5-phosphate synthase (DXS) is a regulatory enzyme of the mevalonate-independent pathway involved in terpenoid biosynthesis. Terpeniods are plant natural products...; Region: TPP_DXS; cd02007
261594010934	TPP-binding site; other site
261594010935	Pyrimidine (PYR) binding domain of 1-deoxy-D-xylulose-5-phosphate synthase (DXS), transketolase (TK), and related proteins; Region: TPP_PYR_DXS_TK_like; cd07033
261594010936	PYR/PP interface [polypeptide binding]; other site
261594010937	dimer interface [polypeptide binding]; other site
261594010938	TPP binding site [chemical binding]; other site
261594010939	Transketolase, C-terminal domain; Region: Transketolase_C; pfam02780
261594010940	Geranylgeranyl pyrophosphate synthase [Coenzyme metabolism]; Region: IspA; COG0142
261594010941	Trans-Isoprenyl Diphosphate Synthases, head-to-tail; Region: Trans_IPPS_HT; cd00685
261594010942	substrate binding pocket [chemical binding]; other site
261594010943	chain length determination region; other site
261594010944	substrate-Mg2+ binding site; other site
261594010945	catalytic residues [active]
261594010946	aspartate-rich region 1; other site
261594010947	active site lid residues [active]
261594010948	aspartate-rich region 2; other site
261594010949	exodeoxyribonuclease VII small subunit; Provisional; Region: PRK14063
261594010950	exodeoxyribonuclease VII large subunit; Reviewed; Region: xseA; PRK00286
261594010951	ExoVII_LU_OBF: A subfamily of OB folds corresponding to the N-terminal OB-fold domain of Escherichia coli exodeoxyribonuclease VII (ExoVII) large subunit. E. coli ExoVII is composed of two non-identical subunits. E. coli ExoVII is a...; Region: ExoVII_LU_OBF; cd04489
261594010952	generic binding surface II; other site
261594010953	generic binding surface I; other site
261594010954	bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase/ 5,10-methylene-tetrahydrofolate cyclohydrolase; Provisional; Region: PRK14190
261594010955	Tetrahydrofolate dehydrogenase/cyclohydrolase, catalytic domain; Region: THF_DHG_CYH; pfam00763
261594010956	NADP binding domain of methylene-tetrahydrofolate dehydrogenase/cyclohydrolase; Region: NAD_bind_m-THF_DH_Cyclohyd; cd01080
261594010957	homodimer interface [polypeptide binding]; other site
261594010958	NADP binding site [chemical binding]; other site
261594010959	substrate binding site [chemical binding]; other site
261594010960	Transcription termination factor NusB (N protein-Utilization Substance B). NusB plays a key role in the regulation of ribosomal RNA biosynthesis in eubacteria by modulating the efficiency of transcriptional antitermination. NusB along with other Nus...; Region: Terminator_NusB; cd00619
261594010961	putative RNA binding site [nucleotide binding]; other site
261594010962	Asp23 family; Region: Asp23; pfam03780
261594010963	acetyl-CoA carboxylase biotin carboxylase subunit; Validated; Region: PRK08591
261594010964	Carbamoyl-phosphate synthase L chain, N-terminal domain; Region: CPSase_L_chain; pfam00289
261594010965	Carbamoyl-phosphate synthase L chain, ATP binding domain; Region: CPSase_L_D2; pfam02786
261594010966	Biotin carboxylase C-terminal domain; Region: Biotin_carb_C; smart00878
261594010967	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit; Validated; Region: PRK06302
261594010968	The biotinyl-domain or biotin carboxyl carrier protein (BCCP) domain is present in all biotin-dependent enzymes, such as acetyl-CoA carboxylase, pyruvate carboxylase, propionyl-CoA carboxylase, methylcrotonyl-CoA carboxylase, geranyl-CoA carboxylase; Region: biotinyl_domain; cd06850
261594010969	carboxyltransferase (CT) interaction site; other site
261594010970	biotinylation site [posttranslational modification]; other site
261594010971	SpoIIIAH-like protein; Region: SpoIIIAH; pfam12685
261594010972	stage III sporulation protein AG; Region: spore_III_AG; TIGR02830
261594010973	Stage III sporulation protein AF (Spore_III_AF); Region: Spore_III_AF; pfam09581
261594010974	stage III sporulation protein AE; Region: spore_III_AE; TIGR02829
261594010975	stage III sporulation protein AD; Region: spore_III_AD; TIGR02849
261594010976	stage III sporulation protein AC; Region: spore_III_AC; TIGR02848
261594010977	stage III sporulation protein SpoAB; Provisional; Region: PRK08307
261594010978	stage III sporulation protein AA; Region: spore_III_AA; TIGR02858
261594010979	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
261594010980	Walker A motif; other site
261594010981	ATP binding site [chemical binding]; other site
261594010982	Walker B motif; other site
261594010983	Protein of unknown function (DUF2619); Region: DUF2619; pfam10942
261594010984	Acetyltransferase (GNAT) domain; Region: Acetyltransf_3; pfam13302
261594010985	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cl17182
261594010986	elongation factor P; Validated; Region: PRK00529
261594010987	Elongation factor P (EF-P) KOW-like domain; Region: EFP_N; pfam08207
261594010988	S1_EF-P_repeat_1: Translation elongation factor P (EF-P), S1-like RNA-binding domain, repeat 1. EF-P stimulates the peptidyltransferase activity in the prokaryotic 70S ribosome. EF-P enhances the synthesis of certain dipeptides with...; Region: S1_EF-P_repeat_1; cd04470
261594010989	RNA binding site [nucleotide binding]; other site
261594010990	S1_EF-P_repeat_2: Translation elongation factor P (EF-P), S1-like RNA-binding domain, repeat 1. EF-P stimulates the peptidyltransferase activity in the prokaryotic 70S ribosome. EF-P enhances the synthesis of certain dipeptides with...; Region: S1_EF-P_repeat_2; cd05794
261594010991	RNA binding site [nucleotide binding]; other site
261594010992	Xaa-Pro aminopeptidase [Amino acid transport and metabolism]; Region: PepP; COG0006
261594010993	Creatinase/Prolidase N-terminal domain; Region: Creatinase_N; pfam01321
261594010994	Similar to Prolidase and Aminopeptidase P. The members of this subfamily presumably catalyse hydrolysis of Xaa-Pro dipeptides and/or release of any N-terminal amino acid, including proline, that is linked with proline; Region: APP-like; cd01092
261594010995	active site
261594010996	Dehydroquinase class II; Region: DHquinase_II; pfam01220
261594010997	Dehydroquinase (DHQase), type II. Dehydroquinase (or 3-dehydroquinate dehydratase) catalyzes the reversible dehydration of 3-dehydroquinate to form 3-dehydroshikimate. This reaction is part of two metabolic pathways: the biosynthetic shikimate pathway...; Region: DHQase_II; cd00466
261594010998	trimer interface [polypeptide binding]; other site
261594010999	active site
261594011000	dimer interface [polypeptide binding]; other site
261594011001	Conserved membrane protein YqhR; Region: YqhR; pfam11085
261594011002	Predicted metal-dependent enzyme [General function prediction only]; Region: COG3872
261594011003	CCC1-related family of proteins; Region: CCC1_like; cl00278
261594011004	Predicted phosphatase/phosphohexomutase [General function prediction only]; Region: COG0637
261594011005	haloacid dehalogenase-like hydrolase; Region: HAD; cl17202
261594011006	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
261594011007	motif II; other site
261594011008	manganese transport transcriptional regulator; Provisional; Region: PRK03902
261594011009	Iron dependent repressor, N-terminal DNA binding domain; Region: Fe_dep_repress; pfam01325
261594011010	Iron dependent repressor, metal binding and dimerisation domain; Region: Fe_dep_repr_C; pfam02742
261594011011	DNA repair photolyase [DNA replication, recombination, and repair]; Region: SplB; COG1533
261594011012	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
261594011013	FeS/SAM binding site; other site
261594011014	Lipoate-protein ligase A [Coenzyme metabolism]; Region: LplA; COG0095
261594011015	Rhodanese Homology Domain (RHOD); an alpha beta fold domain found duplicated in the rhodanese protein. The cysteine containing enzymatically active version of the domain is also found in the Cdc25 class of protein phosphatases and a variety of proteins...; Region: RHOD; cd00158
261594011016	active site residue [active]
261594011017	Transcriptional regulators [Transcription]; Region: PurR; COG1609
261594011018	Helix-turn-helix (HTH) DNA binding domain of the LacI family of transcriptional regulators; Region: HTH_LacI; cd01392
261594011019	DNA binding site [nucleotide binding]
261594011020	domain linker motif; other site
261594011021	Ligand-binding domain of a novel transcription factor implicated in catabolite repression in Bacillus and Clostridium species; Region: PBP1_CcpB_like; cd06286
261594011022	putative dimerization interface [polypeptide binding]; other site
261594011023	putative ligand binding site [chemical binding]; other site
261594011024	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
261594011025	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
261594011026	Membrane transporters of cations and cationic drugs [Inorganic ion transport and metabolism]; Region: EmrE; COG2076
261594011027	Membrane transporters of cations and cationic drugs [Inorganic ion transport and metabolism]; Region: EmrE; COG2076
261594011028	Protein of unknown function (DUF3975); Region: DUF3975; pfam13126
261594011029	ABC-2 family transporter protein; Region: ABC2_membrane_5; pfam13346
261594011030	ABC-2 family transporter protein; Region: ABC2_membrane_5; pfam13346
261594011031	ABC-2 family transporter protein; Region: ABC2_membrane_5; pfam13346
261594011032	ABC-type multidrug transport system, ATPase component [Defense mechanisms]; Region: CcmA; COG1131
261594011033	ATP-binding cassette domain of the drug resistance transporter and related proteins, subfamily A; Region: ABC_DR_subfamily_A; cd03230
261594011034	Walker A/P-loop; other site
261594011035	ATP binding site [chemical binding]; other site
261594011036	Q-loop/lid; other site
261594011037	ABC transporter signature motif; other site
261594011038	Walker B; other site
261594011039	D-loop; other site
261594011040	H-loop/switch region; other site
261594011041	Predicted transcriptional regulators [Transcription]; Region: COG1725
261594011042	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
261594011043	DNA-binding site [nucleotide binding]; DNA binding site
261594011044	Protein of unknown function (DUF3929); Region: DUF3929; pfam13066
261594011045	Glycine cleavage system P-protein, alpha- and beta-subunits. This family consists of Glycine cleavage system P-proteins EC:1.4.4.2 from bacterial, mammalian and plant sources. The P protein is part of the glycine decarboxylase multienzyme complex EC:2.1; Region: GDC-P; cd00613
261594011046	tetramer interface [polypeptide binding]; other site
261594011047	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594011048	catalytic residue [active]
261594011049	Glycine cleavage system protein P (pyridoxal-binding), N-terminal domain [Amino acid transport and metabolism]; Region: GcvP; COG0403
261594011050	Glycine cleavage system P-protein, alpha- and beta-subunits. This family consists of Glycine cleavage system P-proteins EC:1.4.4.2 from bacterial, mammalian and plant sources. The P protein is part of the glycine decarboxylase multienzyme complex EC:2.1; Region: GDC-P; cd00613
261594011051	tetramer interface [polypeptide binding]; other site
261594011052	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594011053	catalytic residue [active]
261594011054	glycine cleavage system aminomethyltransferase T; Reviewed; Region: gcvT; PRK00389
261594011055	Sarcosine oxidase, gamma subunit family; Region: SoxG; cl01893
261594011056	Glycine cleavage T-protein C-terminal barrel domain; Region: GCV_T_C; pfam08669
261594011057	DEAD-like helicases superfamily; Region: DEXDc; smart00487
261594011058	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
261594011059	ATP binding site [chemical binding]; other site
261594011060	putative Mg++ binding site [ion binding]; other site
261594011061	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
261594011062	nucleotide binding region [chemical binding]; other site
261594011063	ATP-binding site [chemical binding]; other site
261594011064	Bacterial protein YqhG of unknown function; Region: YqhG; pfam11079
261594011065	YqzE-like protein; Region: YqzE; pfam14038
261594011066	shikimate kinase; Reviewed; Region: aroK; PRK00131
261594011067	Shikimate kinase (SK) is the fifth enzyme in the shikimate pathway, a seven-step biosynthetic pathway which converts erythrose-4-phosphate to chorismic acid, found in bacteria, fungi and plants. Chorismic acid is a important intermediate in the synthesis...; Region: SK; cd00464
261594011068	ADP binding site [chemical binding]; other site
261594011069	magnesium binding site [ion binding]; other site
261594011070	putative shikimate binding site; other site
261594011071	Prolyl 4-hydroxylase alpha subunit homologues; Region: P4Hc; smart00702
261594011072	dihydroorotase; Provisional; Region: PRK04250
261594011073	prepilin-type N-terminal cleavage/methylation domain; Region: IV_pilin_GFxxxE; TIGR02532
261594011074	Competence protein ComGC [Intracellular trafficking and secretion]; Region: ComGC; COG4537
261594011075	Type II secretion system (T2SS), protein F; Region: T2SF; pfam00482
261594011076	Type II secretion system (T2SS), protein F; Region: T2SF; pfam00482
261594011077	Type II/IV secretion system protein; Region: T2SE; pfam00437
261594011078	RecA-like NTPases. This family includes the NTP binding domain of F1 and V1 H+ATPases, DnaB and related helicases as well as bacterial RecA and related eukaryotic and archaeal recombinases. This group also includes bacterial conjugation proteins and...; Region: RecA-like_NTPases; cl17233
261594011079	Walker A motif; other site
261594011080	ATP binding site [chemical binding]; other site
261594011081	Walker B motif; other site
261594011082	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
261594011083	putative DNA binding site [nucleotide binding]; other site
261594011084	iron-sulfur cluster biosynthesis transcriptional regulator SufR; Region: SufR_cyano; TIGR02702
261594011085	putative Zn2+ binding site [ion binding]; other site
261594011086	Protein of unknown function (DUF2626); Region: DUF2626; pfam11117
261594011087	Predicted Na+/dicarboxylate symporter [General function prediction only]; Region: COG1823
261594011088	Na+/H+-dicarboxylate symporters [Energy production and conversion]; Region: GltP; COG1301
261594011089	Protein of unknown function (DUF3912); Region: DUF3912; pfam13051
261594011090	Nucleoside 2-deoxyribosyltransferase; Region: Nuc_deoxyrib_tr; cl17818
261594011091	Adenylate forming domain, Class I; Region: AFD_class_I; cl17068
261594011092	Protein of unknown function (DUF3966); Region: DUF3966; pfam13110
261594011093	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase; Reviewed; Region: PRK12446
261594011094	MurG is an N-acetylglucosaminyltransferase, the last enzyme involved in the intracellular phase of peptidoglycan biosynthesis. It transfers N-acetyl-D-glucosamine (GlcNAc) from UDP-GlcNAc to the C4 hydroxyl of a lipid-linked N-acetylmuramoyl pentapeptide...; Region: GT1_MurG; cd03785
261594011095	active site
261594011096	homodimer interface [polypeptide binding]; other site
261594011097	Methionine synthase I (cobalamin-dependent), methyltransferase domain [Amino acid transport and metabolism]; Region: MetH; COG0646
261594011098	5-methyltetrahydrofolate--homocysteine methyltransferase; Region: metH; TIGR02082
261594011099	Pterin binding enzymes. This family includes dihydropteroate synthase (DHPS) and cobalamin-dependent methyltransferases such as methyltetrahydrofolate, corrinoid iron-sulfur protein methyltransferase (MeTr) and methionine synthase (MetH).  DHPS, a...; Region: Pterin_binding; cl00219
261594011100	substrate binding pocket [chemical binding]; other site
261594011101	dimer interface [polypeptide binding]; other site
261594011102	inhibitor binding site; inhibition site
261594011103	B12 binding domain (B12-BD). Most of the members bind different cobalamid derivates, like B12 (adenosylcobamide) or methylcobalamin or methyl-Co(III) 5-hydroxybenzimidazolylcobamide. This domain is found in several enzymes, such as glutamate mutase; Region: B12-binding_like; cl00293
261594011104	B12 binding site [chemical binding]; other site
261594011105	Vitamin B12 dependent methionine synthase, activation domain; Region: Met_synt_B12; pfam02965
261594011106	bifunctional homocysteine S-methyltransferase/5,10-methylenetetrahydrofolate reductase protein; Reviewed; Region: PRK08645
261594011107	Methionine synthase I (cobalamin-dependent), methyltransferase domain [Amino acid transport and metabolism]; Region: MetH; cl14105
261594011108	Methylenetetrahydrofolate reductase (MTHFR). 5,10-Methylenetetrahydrofolate is reduced to 5-methyltetrahydrofolate by methylenetetrahydrofolate reductase, a cytoplasmic, NAD(P)-dependent enzyme. 5-methyltetrahydrofolate is utilized by methionine synthase...; Region: MTHFR; cd00537
261594011109	FAD binding site [chemical binding]; other site
261594011110	cystathionine gamma-synthase; Reviewed; Region: PRK08247
261594011111	CGS_like: Cystathionine gamma-synthase is a PLP dependent enzyme and catalyzes the committed step of methionine biosynthesis. This pathway is unique to microorganisms and plants, rendering the enzyme an attractive target for the development of...; Region: CGS_like; cd00614
261594011112	homodimer interface [polypeptide binding]; other site
261594011113	substrate-cofactor binding pocket; other site
261594011114	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594011115	catalytic residue [active]
261594011116	cystathionine beta-lyase; Provisional; Region: PRK08064
261594011117	CGS_like: Cystathionine gamma-synthase is a PLP dependent enzyme and catalyzes the committed step of methionine biosynthesis. This pathway is unique to microorganisms and plants, rendering the enzyme an attractive target for the development of...; Region: CGS_like; cd00614
261594011118	homodimer interface [polypeptide binding]; other site
261594011119	substrate-cofactor binding pocket; other site
261594011120	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594011121	catalytic residue [active]
261594011122	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
261594011123	dimerization interface [polypeptide binding]; other site
261594011124	putative DNA binding site [nucleotide binding]; other site
261594011125	putative Zn2+ binding site [ion binding]; other site
261594011126	Uncharacterized conserved protein [Function unknown]; Region: COG1565
261594011127	Zn-dependent hydrolases, including glyoxylases [General function prediction only]; Region: GloB; COG0491
261594011128	Protein of unknown function (DUF2759); Region: DUF2759; pfam10958
261594011129	ROK family protein (putative glucokinase); Region: ROK_glcA_fam; TIGR00744
261594011130	Nucleotide-Binding Domain of the sugar kinase/HSP70/actin superfamily; Region: NBD_sugar-kinase_HSP70_actin; cd00012
261594011131	nucleotide binding site [chemical binding]; other site
261594011132	Bacterial protein of unknown function (DUF910); Region: DUF910; pfam06014
261594011133	5,10-methenyltetrahydrofolate synthetase; Region: MTHFS_bact; TIGR02727
261594011134	5-formyltetrahydrofolate cyclo-ligase family; Region: 5-FTHF_cyc-lig; pfam01812
261594011135	50S ribosomal protein L33; Validated; Region: rpmG; PRK00595
261594011136	Nucleoside-diphosphate-sugar pyrophosphorylase involved in lipopolysaccharide biosynthesis/translation initiation factor 2B, gamma/epsilon subunits (eIF-2Bgamma/eIF-2Bepsilon) [Cell envelope biogenesis, outer membrane / Translation, ribosomal structure...; Region: GCD1; COG1208
261594011137	NTP_transferases catalyze the transfer of nucleotides onto phosphosugars; Region: NTP_transferase; cd04181
261594011138	active site
261594011139	Substrate binding site; other site
261594011140	Mg++ binding site; other site
261594011141	Left-handed parallel beta-Helix (LbetaH or LbH) domain: The alignment contains 5 turns, each containing three imperfect tandem repeats of a hexapeptide repeat motif (X-[STAV]-X-[LIV]-[GAED]-X). Proteins containing hexapeptide repeats are often enzymes...; Region: LbetaH; cl00160
261594011142	The alpha-D-phosphohexomutase superfamily includes several related enzymes that catalyze a reversible intramolecular phosphoryl transfer on their sugar substrates. Members of this family include the phosphoglucomutases (PGM1 and PGM2), phosphoglucosamine...; Region: phosphohexomutase; cl03757
261594011143	active site
261594011144	metal binding site [ion binding]; metal-binding site
261594011145	substrate binding site [chemical binding]; other site
261594011146	phosphate transport system regulatory protein PhoU; Region: phoU_full; TIGR02135
261594011147	PhoU domain; Region: PhoU; pfam01895
261594011148	PhoU domain; Region: PhoU; pfam01895
261594011149	phosphate transporter ATP-binding protein; Provisional; Region: PRK14238
261594011150	ATP-binding cassette domain of the phosphate transport system; Region: ABC_PstB_phosphate_transporter; cd03260
261594011151	Walker A/P-loop; other site
261594011152	ATP binding site [chemical binding]; other site
261594011153	Q-loop/lid; other site
261594011154	ABC transporter signature motif; other site
261594011155	Walker B; other site
261594011156	D-loop; other site
261594011157	H-loop/switch region; other site
261594011158	ABC-type phosphate transport system, permease component [Inorganic ion transport and metabolism]; Region: PstA; COG0581
261594011159	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
261594011160	dimer interface [polypeptide binding]; other site
261594011161	conserved gate region; other site
261594011162	putative PBP binding loops; other site
261594011163	ABC-ATPase subunit interface; other site
261594011164	ABC-type phosphate transport system, permease component [Inorganic ion transport and metabolism]; Region: PstC; COG0573
261594011165	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
261594011166	dimer interface [polypeptide binding]; other site
261594011167	conserved gate region; other site
261594011168	putative PBP binding loops; other site
261594011169	ABC-ATPase subunit interface; other site
261594011170	PBP superfamily domain; Region: PBP_like_2; cl17296
261594011171	Cell division protein FtsI/penicillin-binding protein 2 [Cell envelope biogenesis, outer membrane]; Region: FtsI; COG0768
261594011172	Penicillin-binding Protein dimerisation domain; Region: PBP_dimer; pfam03717
261594011173	Penicillin binding protein transpeptidase domain; Region: Transpeptidase; pfam00905
261594011174	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594011175	putative substrate translocation pore; other site
261594011176	Major Facilitator Superfamily; Region: MFS_1; pfam07690
261594011177	Superoxide dismutase [Inorganic ion transport and metabolism]; Region: SodA; COG0605
261594011178	Iron/manganese superoxide dismutases, alpha-hairpin domain; Region: Sod_Fe_N; pfam00081
261594011179	Iron/manganese superoxide dismutases, C-terminal domain; Region: Sod_Fe_C; pfam02777
261594011180	Protein of unknown function (DUF1189); Region: DUF1189; pfam06691
261594011181	4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase; Reviewed; Region: ispG; PRK00366
261594011182	4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase; Validated; Region: PRK00694
261594011183	4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase; Validated; Region: PRK00694
261594011184	Ferric uptake regulator(Fur) and related metalloregulatory proteins; typically iron-dependent, DNA-binding repressors and activators; Region: Fur_like; cd07153
261594011185	metal binding site 2 [ion binding]; metal-binding site
261594011186	putative DNA binding helix; other site
261594011187	metal binding site 1 [ion binding]; metal-binding site
261594011188	dimer interface [polypeptide binding]; other site
261594011189	structural Zn2+ binding site [ion binding]; other site
261594011190	ABC-type Mn2+/Zn2+ transport systems, permease components [Inorganic ion transport and metabolism]; Region: ZnuB; COG1108
261594011191	Transmembrane subunit (TM), of Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters involved in the uptake of siderophores, heme, vitamin B12, or the divalent cations Mg2+ and Zn2+. PBP-dependent ABC transporters consist of...; Region: TM_ABC_iron-siderophores_like; cd06550
261594011192	ABC-ATPase subunit  interface; other site
261594011193	dimer interface [polypeptide binding]; other site
261594011194	putative PBP binding regions; other site
261594011195	ABC-type Mn/Zn transport systems, ATPase component [Inorganic ion transport and metabolism]; Region: ZnuC; COG1121
261594011196	ATP-binding cassette domain of the metal-type transporters; Region: ABC_Metallic_Cations; cd03235
261594011197	Uncharacterized conserved protein [Function unknown]; Region: COG1284
261594011198	Uncharacterized BCR, YitT family COG1284; Region: DUF161; pfam02588
261594011199	Uncharacterized protein conserved in bacteria (DUF2179); Region: DUF2179; pfam10035
261594011200	Protein of unknown function (DUF2624); Region: DUF2624; pfam11116
261594011201	endonuclease IV; Provisional; Region: PRK01060
261594011202	AP endonuclease family 2; These endonucleases play a role in DNA repair. Cleave phosphodiester bonds at apurinic or apyrimidinic sites; the alignment also contains hexulose-6-phosphate isomerases, enzymes that catalyze the epimerization of...; Region: AP2Ec; cd00019
261594011203	AP (apurinic/apyrimidinic) site pocket; other site
261594011204	DNA interaction; other site
261594011205	Metal-binding active site; metal-binding site
261594011206	DEAD-box helicases. A diverse family of proteins involved in ATP-dependent RNA unwinding, needed in a variety of cellular processes including splicing, ribosome biogenesis and RNA degradation. The name derives from the sequence of the Walker  B motif; Region: DEADc; cd00268
261594011207	DEAD-like helicases superfamily; Region: DEXDc; smart00487
261594011208	ATP binding site [chemical binding]; other site
261594011209	Mg++ binding site [ion binding]; other site
261594011210	motif III; other site
261594011211	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
261594011212	nucleotide binding region [chemical binding]; other site
261594011213	ATP-binding site [chemical binding]; other site
261594011214	4-hydroxy-3-methylbut-2-enyl diphosphate reductase; Reviewed; Region: ispH; PRK01045
261594011215	4-Hydroxy-3-methylbut-2-enyl diphosphate reductase IspH [Lipid metabolism]; Region: lytB; COG0761
261594011216	Uncharacterized conserved protein [Function unknown]; Region: COG0327
261594011217	NIF3 (NGG1p interacting factor 3); Region: NIF3; pfam01784
261594011218	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3323
261594011219	NIF3 (NGG1p interacting factor 3); Region: NIF3; pfam01784
261594011220	Uncharacterized conserved protein [Function unknown]; Region: COG0327
261594011221	Predicted SAM-dependent methyltransferase [General function prediction only]; Region: COG2384
261594011222	Family of unknown function (DUF633); Region: DUF633; pfam04816
261594011223	Cytochrome c, mono- and diheme variants [Energy production and conversion]; Region: CccA; COG2010
261594011224	Cytochrome C oxidase, cbb3-type, subunit III; Region: Cytochrome_CBB3; pfam13442
261594011225	RNA polymerase sigma factor RpoD; Validated; Region: PRK09210
261594011226	Sigma-70 factor, region 1.1; Region: Sigma70_r1_1; pfam03979
261594011227	Sigma-70 factor, region 1.2; Region: Sigma70_r1_2; pfam00140
261594011228	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
261594011229	Sigma-70 region 3; Region: Sigma70_r3; pfam04539
261594011230	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
261594011231	DNA binding residues [nucleotide binding]
261594011232	DNA primase; Validated; Region: dnaG; PRK05667
261594011233	CHC2 zinc finger; Region: zf-CHC2; pfam01807
261594011234	DNA primase catalytic core, N-terminal domain; Region: Toprim_N; pfam08275
261594011235	TOPRIM_DnaG_primases: The topoisomerase-primase (TORPIM) nucleotidyl transferase/hydrolase domain found in the active site regions of proteins similar to Escherichia coli DnaG. Primases synthesize RNA primers for the initiation of DNA replication. DnaG...; Region: TOPRIM_DnaG_primases; cd03364
261594011236	active site
261594011237	metal binding site [ion binding]; metal-binding site
261594011238	interdomain interaction site; other site
261594011239	DnaB-helicase binding domain of primase; Region: DnaB_bind; pfam10410
261594011240	DNA primase DnaG DnaB-binding; Region: DnaG_DnaB_bind; smart00766
261594011241	PEP synthetase regulatory protein; Provisional; Region: PRK05339
261594011242	HTH domain; Region: HTH_11; pfam08279
261594011243	The CBS domain, named after human CBS, is a small domain originally identified in cystathionine beta-synthase and is subsequently found in a wide range of different proteins. CBS domains usually occur in tandem repeats. They associate to form a so-called...; Region: CBS_pair_4; cd04617
261594011244	FOG: CBS domain [General function prediction only]; Region: COG0517
261594011245	DNA repair protein RecO; Reviewed; Region: recO; PRK00085
261594011246	Recombination protein O N terminal; Region: RecO_N; pfam11967
261594011247	Recombination protein O C terminal; Region: RecO_C; pfam02565
261594011248	YqzL-like protein; Region: YqzL; pfam14006
261594011249	GTPase Era; Reviewed; Region: era; PRK00089
261594011250	E. coli Ras-like protein (Era) is a multifunctional GTPase; Region: Era; cd04163
261594011251	G1 box; other site
261594011252	GTP/Mg2+ binding site [chemical binding]; other site
261594011253	Switch I region; other site
261594011254	G2 box; other site
261594011255	Switch II region; other site
261594011256	G3 box; other site
261594011257	G4 box; other site
261594011258	G5 box; other site
261594011259	KH domain; Region: KH_2; pfam07650
261594011260	Cytidine deaminase zinc-binding domain. These enzymes are Zn dependent. The zinc ion in the active site plays a central role in the proposed catalytic mechanism, activating a water molecule to form a hydroxide ion that performs a nucleophilic attack on...; Region: cytidine_deaminase; cd01283
261594011261	active site
261594011262	catalytic motif [active]
261594011263	Zn binding site [ion binding]; other site
261594011264	Prokaryotic diacylglycerol kinase; Region: DAGK_prokar; pfam01219
261594011265	metal-binding heat shock protein; Provisional; Region: PRK00016
261594011266	Predicted membrane-associated HD superfamily hydrolase [General function prediction only]; Region: COG1480
261594011267	7TM receptor with intracellular HD hydrolase; Region: 7TM-7TMR_HD; pfam07698
261594011268	Metal dependent phosphohydrolases with conserved 'HD' motif; Region: HDc; cd00077
261594011269	Zn2+ binding site [ion binding]; other site
261594011270	Mg2+ binding site [ion binding]; other site
261594011271	Phosphate starvation-inducible protein PhoH, predicted ATPase [Signal transduction mechanisms]; Region: PhoH; COG1702
261594011272	PhoH-like protein; Region: PhoH; pfam02562
261594011273	Putative stage IV sporulation protein YqfD; Region: YqfD; pfam06898
261594011274	sporulation protein YqfD; Region: spore_yqfD; TIGR02876
261594011275	sporulation protein YqfC; Region: spore_yqfC; TIGR02856
261594011276	Yqey-like protein; Region: YqeY; pfam09424
261594011277	30S ribosomal protein S21; Reviewed; Region: rpsU; PRK00270
261594011278	2-methylthioadenine synthetase [Translation, ribosomal structure and biogenesis]; Region: MiaB; COG0621
261594011279	Uncharacterized protein family UPF0004; Region: UPF0004; pfam00919
261594011280	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
261594011281	FeS/SAM binding site; other site
261594011282	TRAM domain; Region: TRAM; cl01282
261594011283	16S ribosomal RNA methyltransferase RsmE; Provisional; Region: PRK11713
261594011284	RNA methyltransferase, RsmE family; Region: TIGR00046
261594011285	Ribosomal protein L11 methyltransferase (PrmA); Region: PrmA; pfam06325
261594011286	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594011287	S-adenosylmethionine binding site [chemical binding]; other site
261594011288	chaperone protein DnaJ; Provisional; Region: PRK14280
261594011289	DnaJ domain or J-domain.  DnaJ/Hsp40 (heat shock protein 40) proteins are highly conserved and play crucial roles in protein translation, folding, unfolding, translocation, and degradation. They act primarily by stimulating the ATPase activity of Hsp70s; Region: DnaJ; cd06257
261594011290	HSP70 interaction site [polypeptide binding]; other site
261594011291	C-terminal substrate binding domain of DnaJ and HSP40; Region: DnaJ_C; cl03262
261594011292	substrate binding site [polypeptide binding]; other site
261594011293	Zinc finger domain of DnaJ and HSP40; Region: DnaJ_zf; cd10719
261594011294	Zn binding sites [ion binding]; other site
261594011295	C-terminal substrate binding domain of DnaJ and HSP40; Region: DnaJ_C; cd10747
261594011296	dimer interface [polypeptide binding]; other site
261594011297	molecular chaperone DnaK; Provisional; Region: dnaK; PRK00290
261594011298	Nucleotide-binding domain of human HSPA9 and similar proteins; Region: HSPA9-Ssq1-like_NBD; cd10234
261594011299	nucleotide binding site [chemical binding]; other site
261594011300	NEF interaction site [polypeptide binding]; other site
261594011301	SBD interface [polypeptide binding]; other site
261594011302	GrpE; Region: GrpE; pfam01025
261594011303	GrpE is the adenine nucleotide exchange factor of DnaK (Hsp70)-type ATPases. The GrpE dimer binds to the ATPase domain of Hsp70 catalyzing the dissociation of ADP, which enables rebinding of ATP, one step in the Hsp70 reaction cycle in protein folding; Region: GrpE; cd00446
261594011304	dimer interface [polypeptide binding]; other site
261594011305	hsp70 (ATPase domain) interactions [polypeptide binding]; other site
261594011306	heat-inducible transcription repressor; Provisional; Region: hrcA; PRK00082
261594011307	Winged helix-turn-helix transcription repressor, HrcA DNA-binding; Region: HrcA_DNA-bdg; pfam03444
261594011308	coproporphyrinogen III oxidase; Provisional; Region: PRK08599
261594011309	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
261594011310	FeS/SAM binding site; other site
261594011311	HemN C-terminal domain; Region: HemN_C; pfam06969
261594011312	Predicted transcriptional regulators [Transcription]; Region: COG1733
261594011313	HxlR-like helix-turn-helix; Region: HxlR; pfam01638
261594011314	GTP-binding protein LepA; Provisional; Region: PRK05433
261594011315	LepA also known as Elongation Factor 4 (EF4); Region: LepA; cd01890
261594011316	G1 box; other site
261594011317	putative GEF interaction site [polypeptide binding]; other site
261594011318	GTP/Mg2+ binding site [chemical binding]; other site
261594011319	Switch I region; other site
261594011320	G2 box; other site
261594011321	G3 box; other site
261594011322	Switch II region; other site
261594011323	G4 box; other site
261594011324	G5 box; other site
261594011325	lepA_II: This subfamily represents the domain II of LepA, a GTP-binding protein localized in the cytoplasmic membrane. The N-terminal domain of LepA shares regions of homology to translation factors. In terms of interaction with the ribosome, EF-G, EF-Tu...; Region: lepA_II; cd03699
261594011326	lepA_C: This family represents the C-terminal region of LepA, a GTP-binding protein localized in the cytoplasmic membrane.   LepA is ubiquitous in Bacteria and Eukaryota (e.g. Saccharomyces cerevisiae GUF1p), but is missing from Archaea. LepA exhibits...; Region: lepA_C; cd03709
261594011327	GTP-binding protein LepA C-terminus; Region: LepA_C; pfam06421
261594011328	Protein of unknown function (DUF3679); Region: DUF3679; pfam12438
261594011329	germination protease; Provisional; Region: PRK02858
261594011330	30S ribosomal protein S20; Reviewed; Region: rpsT; PRK00239
261594011331	DNA polymerase III subunit delta; Reviewed; Region: holA; PRK05574
261594011332	DNA polymerase III, delta subunit; Region: DNA_pol3_delta; pfam06144
261594011333	YqzM-like protein; Region: YqzM; pfam14141
261594011334	Domain of unknown function (DUF4131); Region: DUF4131; pfam13567
261594011335	DNA internalization-related competence protein ComEC/Rec2; Region: ComEC_Rec2; TIGR00361
261594011336	Competence protein; Region: Competence; pfam03772
261594011337	Metallo-beta-lactamase superfamily; Region: Lactamase_B; smart00849
261594011338	Deoxycytidylate deaminase domain. Deoxycytidylate deaminase catalyzes the deamination of dCMP to dUMP, providing the nucleotide substrate for thymidylate synthase. The enzyme binds Zn++, which is required for catalytic activity. The activity of the...; Region: deoxycytidylate_deaminase; cd01286
261594011339	catalytic motif [active]
261594011340	Zn binding site [ion binding]; other site
261594011341	SLBB domain; Region: SLBB; pfam10531
261594011342	comEA protein; Region: comE; TIGR01259
261594011343	endonuclease III; includes endonuclease III (DNA-(apurinic or apyrimidinic site) lyase), alkylbase DNA glycosidases (Alka-family) and other DNA glycosidases; Region: ENDO3c; cl14786
261594011344	late competence protein ComER; Validated; Region: PRK07680
261594011345	NADP oxidoreductase coenzyme F420-dependent; Region: F420_oxidored; cl17232
261594011346	SAM-dependent methyltransferases [Secondary metabolites biosynthesis, transport, and catabolism / General function prediction only]; Region: SmtA; COG0500
261594011347	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594011348	S-adenosylmethionine binding site [chemical binding]; other site
261594011349	iojap-like ribosome-associated protein; Region: iojap_ybeB; TIGR00090
261594011350	Metal dependent phosphohydrolases with conserved 'HD' motif; Region: HDc; cd00077
261594011351	Zn2+ binding site [ion binding]; other site
261594011352	Mg2+ binding site [ion binding]; other site
261594011353	Nicotinamide/nicotinate mononucleotide adenylyltransferase; Region: NMNAT; cd02165
261594011354	nicotinate (nicotinamide) nucleotide adenylyltransferase; Region: TIGR00482
261594011355	active site
261594011356	Predicted RNA-binding protein containing KH domain, possibly ribosomal protein [Translation, ribosomal structure and biogenesis]; Region: COG1534
261594011357	shikimate 5-dehydrogenase; Reviewed; Region: aroE; PRK00258
261594011358	Shikimate dehydrogenase substrate binding domain; Region: Shikimate_dh_N; pfam08501
261594011359	NAD(P) binding domain of Shikimate dehydrogenase; Region: NAD_bind_Shikimate_DH; cd01065
261594011360	shikimate binding site; other site
261594011361	NAD(P) binding site [chemical binding]; other site
261594011362	GTPase YqeH; Provisional; Region: PRK13796
261594011363	Circularly permuted YqeH GTPase; Region: YqeH; cd01855
261594011364	GTP/Mg2+ binding site [chemical binding]; other site
261594011365	G4 box; other site
261594011366	G5 box; other site
261594011367	G1 box; other site
261594011368	Switch I region; other site
261594011369	G2 box; other site
261594011370	G3 box; other site
261594011371	Switch II region; other site
261594011372	Predicted hydrolase of the HAD superfamily [General function prediction only]; Region: COG2179
261594011373	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
261594011374	active site
261594011375	motif I; other site
261594011376	motif II; other site
261594011377	phosphatidylserine decarboxylase; Provisional; Region: PRK03140
261594011378	sporulation sigma factor SigK; Reviewed; Region: PRK05803
261594011379	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
261594011380	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
261594011381	DNA binding residues [nucleotide binding]
261594011382	Peptidase propeptide and YPEB domain; Region: PepSY; cl15480
261594011383	50S ribosomal protein L33; Validated; Region: rpmG; PRK00595
261594011384	Nitroreductase-like family 1. A subfamily of the nitroreductase family containing uncharacterized proteins that are similar to nitroreductase. Nitroreductase catalyzes the reduction of nitroaromatic compounds such as nitrotoluenes, nitrofurans and...; Region: Nitroreductase_1; cd02137
261594011385	dimer interface [polypeptide binding]; other site
261594011386	FMN binding site [chemical binding]; other site
261594011387	Nucleotidyltransferase (NT) domain of RelA- and SpoT-like ppGpp synthetases and hydrolases; Region: NT_Rel-Spo_like; cd05399
261594011388	Guanosine polyphosphate pyrophosphohydrolases/synthetases [Signal transduction mechanisms / Transcription]; Region: SpoT; COG0317
261594011389	synthetase active site [active]
261594011390	NTP binding site [chemical binding]; other site
261594011391	metal binding site [ion binding]; metal-binding site
261594011392	Alkaline phosphatase homologues; alkaline phosphatases are non-specific phosphomonoesterases that catalyze the hydrolysis reaction via a phosphoseryl intermediate to produce inorganic phosphate and the corresponding alcohol, optimally at high pH; Region: alkPPc; cd00016
261594011393	dimer interface [polypeptide binding]; other site
261594011394	Alkaline phosphatase homologues; Region: alkPPc; smart00098
261594011395	active site
261594011396	Acetyltransferases [General function prediction only]; Region: RimI; COG0456
261594011397	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594011398	Coenzyme A binding pocket [chemical binding]; other site
261594011399	GNAT acetyltransferase 2; Region: GNAT_acetyltr_2; pfam13718
261594011400	Alpha/beta hydrolase family; Region: Abhydrolase_6; pfam12697
261594011401	DoxX; Region: DoxX; cl17842
261594011402	CHAT domain; Region: CHAT; cl17868
261594011403	Histidine phosphatase domain found in a functionally diverse set of proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP; cd07040
261594011404	catalytic core [active]
261594011405	Dipeptidyl aminopeptidases/acylaminoacyl-peptidases [Amino acid transport and metabolism]; Region: DAP2; COG1506
261594011406	Peptidase inhibitor I9; Region: Inhibitor_I9; pfam05922
261594011407	Subtilisin-like serine proteases [Posttranslational modification, protein turnover, chaperones]; Region: AprE; COG1404
261594011408	Peptidase S8 family domain in Vpr-like proteins; Region: Peptidases_S8_subtilisin_Vpr-like; cd07474
261594011409	putative active site [active]
261594011410	catalytic triad [active]
261594011411	PA_C5a_like: Protease-associated domain containing proteins like Streptococcus pyogenes C5a peptidase. This group contains various PA domain-containing proteins similar to S. pyogenes C5a, including, i) Vpr, a minor extracellular serine protease from...; Region: PA_C5a_like; cd02133
261594011412	putative integrin binding motif; other site
261594011413	PA/protease domain interface [polypeptide binding]; other site
261594011414	Peptidase S8 family domain in Vpr-like proteins; Region: Peptidases_S8_subtilisin_Vpr-like; cd07474
261594011415	FlgD Tudor-like domain; Region: FLgD_tudor; pfam13861
261594011416	phenylalanine 4-monooxygenase; Provisional; Region: PRK14056
261594011417	Biopterin-dependent aromatic amino acid hydroxylase; a family of non-heme, iron(II)-dependent enzymes that includes prokaryotic and eukaryotic phenylalanine-4-hydroxylase (PheOH), eukaryotic tyrosine hydroxylase (TyrOH) and eukaryotic tryptophan...; Region: arom_aa_hydroxylase; cd00361
261594011418	cofactor binding site; other site
261594011419	metal binding site [ion binding]; metal-binding site
261594011420	PCD_DCoH: The bifunctional protein pterin-4alpha-carbinolamine dehydratase (PCD), also known as DCoH  (dimerization cofactor of hepatocyte nuclear factor-1), is both a transcription activator and a metabolic enzyme.  DCoH stimulates gene expression by...; Region: PCD_DCoH; cd00488
261594011421	aromatic arch; other site
261594011422	DCoH dimer interaction site [polypeptide binding]; other site
261594011423	DCoH /HNF-1 dimer interaction site [polypeptide binding]; other site
261594011424	DCoH tetramer interaction site [polypeptide binding]; other site
261594011425	substrate binding site [chemical binding]; other site
261594011426	Predicted membrane protein [Function unknown]; Region: COG2259
261594011427	DNA-binding transcriptional repressor PuuR; Provisional; Region: PRK09943
261594011428	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
261594011429	non-specific DNA binding site [nucleotide binding]; other site
261594011430	salt bridge; other site
261594011431	sequence-specific DNA binding site [nucleotide binding]; other site
261594011432	Cupin domain; Region: Cupin_2; pfam07883
261594011433	(R)-hydratase [(R)-specific enoyl-CoA hydratase] catalyzes the hydration of trans-2-enoyl CoA to (R)-3-hydroxyacyl-CoA as part of the PHA (polyhydroxyalkanoate) biosynthetic pathway. (R)-hydratase contains a hot-dog fold similar to those of thioesterase...; Region: R_hydratase; cd03449
261594011434	dimer interaction site [polypeptide binding]; other site
261594011435	substrate-binding tunnel; other site
261594011436	active site
261594011437	catalytic site [active]
261594011438	substrate binding site [chemical binding]; other site
261594011439	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594011440	Coenzyme A binding pocket [chemical binding]; other site
261594011441	Acetyltransferase (GNAT) domain; Region: Acetyltransf_3; pfam13302
261594011442	Acetyltransferase (GNAT) family; Region: Acetyltransf_1; pfam00583
261594011443	ankyrin repeats;  ankyrin repeats mediate protein-protein interactions in very diverse families of proteins. The number of ANK repeats in a protein can range from 2 to over 20 (ankyrins, for example). ANK repeats may occur in combinations with other...; Region: ANK; cd00204
261594011444	Ankyrin repeats (3 copies); Region: Ank_2; pfam12796
261594011445	ABC-type cobalamin/Fe3+-siderophores transport systems, ATPase components [Inorganic ion transport and metabolism / Coenzyme metabolism]; Region: FepC; COG1120
261594011446	ATP-binding component of iron-siderophores, vitamin B12 and hemin transporters and related proteins; Region: ABC_Iron-Siderophores_B12_Hemin; cd03214
261594011447	Walker A/P-loop; other site
261594011448	ATP binding site [chemical binding]; other site
261594011449	Q-loop/lid; other site
261594011450	ABC transporter signature motif; other site
261594011451	Walker B; other site
261594011452	D-loop; other site
261594011453	H-loop/switch region; other site
261594011454	ABC-type enterobactin transport system, permease component [Inorganic ion transport and metabolism]; Region: FepG; COG4779
261594011455	Transmembrane subunit (TM), of Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters involved in the uptake of siderophores, heme, vitamin B12, or the divalent cations Mg2+ and Zn2+. PBP-dependent ABC transporters consist of...; Region: TM_ABC_iron-siderophores_like; cd06550
261594011456	ABC-ATPase subunit  interface; other site
261594011457	dimer interface [polypeptide binding]; other site
261594011458	putative PBP binding regions; other site
261594011459	ABC-type Fe3+-hydroxamate transport system, periplasmic component [Inorganic ion transport and metabolism]; Region: FepB; COG0614
261594011460	Helical backbone metal receptor (TroA-like domain). These proteins have been shown to function in the ABC transport of ferric siderophores and metal ions such as Mn2+, Fe3+, Cu2+ and/or Zn2+.  Their ligand binding site is formed in the interface between...; Region: TroA-like; cl00262
261594011461	intersubunit interface [polypeptide binding]; other site
261594011462	YrhC-like protein; Region: YrhC; pfam14143
261594011463	bifunctional acetaldehyde-CoA/alcohol dehydrogenase; Provisional; Region: PRK13805
261594011464	Coenzyme A acylating aldehyde dehydrogenase (ACDH), ALDH family 20-like; Region: ALDH_F20_ACDH; cd07122
261594011465	putative catalytic cysteine [active]
261594011466	C-terminal alcohol dehydrogenase domain of the acetaldehyde dehydrogenase-alcohol dehydrogenase bifunctional two-domain protein (AAD); Region: AAD_C; cd08178
261594011467	putative active site [active]
261594011468	metal binding site [ion binding]; metal-binding site
261594011469	cystathionine beta-lyase; Provisional; Region: PRK07671
261594011470	CGS_like: Cystathionine gamma-synthase is a PLP dependent enzyme and catalyzes the committed step of methionine biosynthesis. This pathway is unique to microorganisms and plants, rendering the enzyme an attractive target for the development of...; Region: CGS_like; cd00614
261594011471	homodimer interface [polypeptide binding]; other site
261594011472	substrate-cofactor binding pocket; other site
261594011473	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594011474	catalytic residue [active]
261594011475	Cysteine synthase [Amino acid transport and metabolism]; Region: CysK; COG0031
261594011476	CBS_like: This subgroup includes Cystathionine beta-synthase (CBS) and Cysteine synthase. CBS is a unique heme-containing enzyme that catalyzes a pyridoxal 5'-phosphate (PLP)-dependent condensation of serine and homocysteine to give cystathionine; Region: CBS_like; cd01561
261594011477	dimer interface [polypeptide binding]; other site
261594011478	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594011479	catalytic residue [active]
261594011480	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase; Validated; Region: PRK05584
261594011481	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase; Region: MTA/SAH-Nsdase; TIGR01704
261594011482	Methyltransferase domain; Region: Methyltransf_23; pfam13489
261594011483	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594011484	S-adenosylmethionine binding site [chemical binding]; other site
261594011485	Protein of unknown function (DUF2536); Region: DUF2536; pfam10750
261594011486	Protein of unknown function (DUF1510); Region: DUF1510; pfam07423
261594011487	Cell division protein FtsI/penicillin-binding protein 2 [Cell envelope biogenesis, outer membrane]; Region: FtsI; COG0768
261594011488	Penicillin-binding Protein dimerisation domain; Region: PBP_dimer; pfam03717
261594011489	Penicillin binding protein transpeptidase domain; Region: Transpeptidase; pfam00905
261594011490	transcription elongation factor GreA; Reviewed; Region: greA; PRK00226
261594011491	Transcription elongation factor, N-terminal; Region: GreA_GreB_N; pfam03449
261594011492	Transcription elongation factor, GreA/GreB, C-term; Region: GreA_GreB; pfam01272
261594011493	Uridine kinase [Nucleotide transport and metabolism]; Region: Udk; COG0572
261594011494	Uridine monophosphate kinase (UMPK, EC 2.7.1.48), also known as uridine kinase or uridine-cytidine kinase (UCK), catalyzes the reversible phosphoryl transfer from ATP to uridine or cytidine to yield UMP or CMP. In the primidine nucleotide-salvage pathway; Region: UMPK; cd02023
261594011495	ATP-binding site [chemical binding]; other site
261594011496	Sugar specificity; other site
261594011497	Pyrimidine base specificity; other site
261594011498	Collagenase and related proteases [Posttranslational modification, protein turnover, chaperones]; Region: COG0826
261594011499	TIM barrel proteins share a structurally conserved phosphate binding motif and in general share an eight beta/alpha closed barrel structure. Specific for this family is the conserved phosphate binding site at the edges of strands 7 and 8. The phosphate...; Region: TIM_phosphate_binding; cl17186
261594011500	Peptidase family U32; Region: Peptidase_U32; pfam01136
261594011501	Collagenase and related proteases [Posttranslational modification, protein turnover, chaperones]; Region: COG0826
261594011502	DRE-TIM metallolyase superfamily; Region: DRE_TIM_metallolyase; cl07974
261594011503	Peptidase family U32; Region: Peptidase_U32; pfam01136
261594011504	Predicted O-methyltransferase [General function prediction only]; Region: COG4122
261594011505	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594011506	S-adenosylmethionine binding site [chemical binding]; other site
261594011507	YceG-like family; Region: YceG; pfam02618
261594011508	proteins similar to Escherichia coli yceG; Region: yceG_like; cd08010
261594011509	dimerization interface [polypeptide binding]; other site
261594011510	hypothetical protein; Provisional; Region: PRK13678
261594011511	Holliday junction resolvase-like protein; Reviewed; Region: PRK00109
261594011512	hypothetical protein; Provisional; Region: PRK05473
261594011513	alanyl-tRNA synthetase; Reviewed; Region: alaS; PRK00252
261594011514	Alanyl-tRNA synthetase (AlaRS) class II core catalytic domain. AlaRS is a homodimer. It is responsible for the attachment of alanine to the 3' OH group of ribose of the appropriate tRNA. This domain is primarily responsible for ATP-dependent...; Region: AlaRS_core; cd00673
261594011515	motif 1; other site
261594011516	active site
261594011517	motif 2; other site
261594011518	motif 3; other site
261594011519	Threonyl and Alanyl tRNA synthetase second additional domain; Region: tRNA_SAD; smart00863
261594011520	DHHA1 domain; Region: DHHA1; pfam02272
261594011521	Predicted permease, member of the PurR regulon [General function prediction only]; Region: yhhT; COG0628
261594011522	Domain of unknown function DUF20; Region: UPF0118; pfam01594
261594011523	Protein of unknown function (DUF3918); Region: DUF3918; pfam13056
261594011524	helicase, putative, RecD/TraA family; Region: recD_rel; TIGR01448
261594011525	AAA domain; Region: AAA_30; pfam13604
261594011526	Family description; Region: UvrD_C_2; pfam13538
261594011527	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cd00189
261594011528	TPR motif; other site
261594011529	TPR repeat; Region: TPR_11; pfam13414
261594011530	binding surface
261594011531	TPR repeat; Region: TPR_11; pfam13414
261594011532	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cd00189
261594011533	binding surface
261594011534	TPR motif; other site
261594011535	TPR repeat; Region: TPR_11; pfam13414
261594011536	Predicted tRNA(5-methylaminomethyl-2-thiouridylate) methyltransferase, contains the PP-loop ATPase domain [Translation, ribosomal structure and biogenesis]; Region: TrmU; COG0482
261594011537	tRNA methyl transferase. This family represents tRNA(5-methylaminomethyl-2-thiouridine)-methyltransferase which is involved in the biosynthesis of the modified nucleoside 5-methylaminomethyl-2-thiouridine present in the wobble position of some tRNAs; Region: tRNA_Me_trans; cd01998
261594011538	Ligand Binding Site [chemical binding]; other site
261594011539	Cysteine sulfinate desulfinase/cysteine desulfurase and related enzymes [Amino acid transport and metabolism]; Region: NifS; COG1104
261594011540	cysteine desulfurase NifS; Region: FeS_nifS; TIGR03402
261594011541	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
261594011542	catalytic residue [active]
261594011543	Predicted transcriptional regulator [Transcription]; Region: COG1959
261594011544	Transcriptional regulator; Region: Rrf2; pfam02082
261594011545	recombination factor protein RarA; Reviewed; Region: PRK13342
261594011546	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
261594011547	Walker A motif; other site
261594011548	ATP binding site [chemical binding]; other site
261594011549	Walker B motif; other site
261594011550	arginine finger; other site
261594011551	MgsA AAA+ ATPase C terminal; Region: MgsA_C; pfam12002
261594011552	putative spore coat protein regulator protein YlbO; Provisional; Region: PRK13923
261594011553	transcription factor, RsfA family; Region: DNA_bind_RsfA; TIGR02894
261594011554	Dinucleotide-utilizing enzymes involved in molybdopterin and thiamine biosynthesis family 1 [Coenzyme metabolism]; Region: COG1179
261594011555	Family of activating enzymes (E1) of ubiquitin-like proteins related to the E.coli hypothetical protein ygdL. The common reaction mechanism catalyzed by E1-like enzymes begins with a nucleophilic attack of the C-terminal carboxylate of the ubiquitin-like...; Region: YgdL_like; cd00755
261594011556	putative ATP binding site [chemical binding]; other site
261594011557	putative substrate interface [chemical binding]; other site
261594011558	aspartyl-tRNA synthetase; Validated; Region: aspS; PRK00476
261594011559	EcAspRS_like_N: N-terminal, anticodon recognition domain of the type found in Escherichia coli aspartyl-tRNA synthetase (AspRS), the human mitochondrial (mt) AspRS-2, the discriminating (D) Thermus thermophilus AspRS-1, and the nondiscriminating (ND)...; Region: EcAspRS_like_N; cd04317
261594011560	dimer interface [polypeptide binding]; other site
261594011561	anticodon binding site; other site
261594011562	Asp tRNA synthetase (aspRS) class II core domain. Class II assignment is based upon its structure and the presence of three characteristic sequence motifs. AspRS is a homodimer, which attaches a specific amino acid to the 3' OH group of ribose of...; Region: AspRS_core; cd00777
261594011563	homodimer interface [polypeptide binding]; other site
261594011564	motif 1; other site
261594011565	active site
261594011566	motif 2; other site
261594011567	GAD domain; Region: GAD; pfam02938
261594011568	Asp tRNA synthetase (aspRS) class II core domain. Class II assignment is based upon its structure and the presence of three characteristic sequence motifs. AspRS is a homodimer, which attaches a specific amino acid to the 3' OH group of ribose of...; Region: AspRS_core; cd00777
261594011569	motif 3; other site
261594011570	histidyl-tRNA synthetase; Reviewed; Region: hisS; PRK00037
261594011571	Class II Histidinyl-tRNA synthetase (HisRS)-like catalytic core domain. HisRS is a homodimer. It is responsible for the attachment of histidine to the 3' OH group of ribose of the appropriate tRNA. This domain is primarily responsible for...; Region: HisRS-like_core; cd00773
261594011572	dimer interface [polypeptide binding]; other site
261594011573	motif 1; other site
261594011574	active site
261594011575	motif 2; other site
261594011576	motif 3; other site
261594011577	HisRS Histidyl-anticodon binding domain. HisRS belongs to class II aminoacyl-tRNA synthetases (aaRS). This alignment contains the anticodon binding domain, which is responsible for specificity in tRNA-binding, so that the activated amino acid is...; Region: HisRS_anticodon; cd00859
261594011578	anticodon binding site; other site
261594011579	D-Tyrosyl-tRNAtyr deacylases; a class of tRNA-dependent hydrolases which are capable of hydrolyzing the ester bond of D-Tyrosyl-tRNA reducing the level of cellular D-Tyrosine while recycling the peptidyl-tRNA; found in bacteria and in eukaryotes but not...; Region: Dtyr_deacylase; cd00563
261594011580	putative active site [active]
261594011581	dimerization interface [polypeptide binding]; other site
261594011582	putative tRNAtyr binding site [nucleotide binding]; other site
261594011583	Guanosine polyphosphate pyrophosphohydrolases/synthetases [Signal transduction mechanisms / Transcription]; Region: SpoT; COG0317
261594011584	Metal dependent phosphohydrolases with conserved 'HD' motif; Region: HDc; cd00077
261594011585	Zn2+ binding site [ion binding]; other site
261594011586	Mg2+ binding site [ion binding]; other site
261594011587	Nucleotidyltransferase (NT) domain of RelA- and SpoT-like ppGpp synthetases and hydrolases; Region: NT_Rel-Spo_like; cd05399
261594011588	synthetase active site [active]
261594011589	NTP binding site [chemical binding]; other site
261594011590	metal binding site [ion binding]; metal-binding site
261594011591	TGS_RelA_SpoT: The RelA (SpoT) protein, also referred to as ppGpp hydrolase/synthetase, is a ribosome-associated protein that is activated during amino acid starvation and thought to mediate the stringent response. RelA contains a TGS domain, named after...; Region: TGS_RelA_SpoT; cd01668
261594011592	ACT  domain found C-terminal of the RelA/SpoT domains; Region: ACT_RelA-SpoT; cd04876
261594011593	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
261594011594	active site
261594011595	single-stranded-DNA-specific exonuclease RecJ; Region: recJ; TIGR00644
261594011596	DHH family; Region: DHH; pfam01368
261594011597	DHHA1 domain; Region: DHHA1; pfam02272
261594011598	Single-strand DNA-specific exonuclease, C terminal domain; Region: ssDNA-exonuc_C; pfam10141
261594011599	Predicted Co/Zn/Cd cation transporters [Inorganic ion transport and metabolism]; Region: MMT1; COG0053
261594011600	cation diffusion facilitator family transporter; Region: CDF; TIGR01297
261594011601	bifunctional preprotein translocase subunit SecD/SecF; Reviewed; Region: PRK13024
261594011602	SecD/SecF GG Motif; Region: Sec_GG; pfam07549
261594011603	protein-export membrane protein, SecD/SecF family; Region: 2A0604s01; TIGR00916
261594011604	SecD/SecF GG Motif; Region: Sec_GG; pfam07549
261594011605	Protein export membrane protein; Region: SecD_SecF; pfam02355
261594011606	Post-transcriptional regulator; Region: Post_transc_reg; pfam13797
261594011607	stage V sporulation protein B; Region: spore_V_B; TIGR02900
261594011608	Stage V sporulation protein B, also known as Stage III sporulation protein F, and related proteins; Region: MATE_SpoVB_like; cd13124
261594011609	Predicted membrane protein [Function unknown]; Region: COG2323
261594011610	putative membrane protein, TIGR04086 family; Region: TIGR04086_membr
261594011611	preprotein translocase subunit YajC; Validated; Region: yajC; PRK05585
261594011612	queuine tRNA-ribosyltransferase; Provisional; Region: tgt; PRK00112
261594011613	Queuine/archaeosine tRNA-ribosyltransferase [Translation, ribosomal structure and biogenesis]; Region: Tgt; COG0343
261594011614	S-adenosylmethionine:tRNA ribosyltransferase-isomerase; Provisional; Region: queA; PRK00147
261594011615	S-adenosylmethionine:tRNA ribosyltransferase-isomerase; Region: queA; TIGR00113
261594011616	Protein of unknown function (DUF2905); Region: DUF2905; pfam11146
261594011617	Holliday junction DNA helicase RuvB; Reviewed; Region: ruvB; PRK00080
261594011618	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
261594011619	Walker A motif; other site
261594011620	ATP binding site [chemical binding]; other site
261594011621	Walker B motif; other site
261594011622	arginine finger; other site
261594011623	Holliday junction DNA helicase ruvB C-terminus; Region: RuvB_C; pfam05491
261594011624	Holliday junction DNA helicase RuvA; Reviewed; Region: ruvA; PRK00116
261594011625	RuvA N terminal domain; Region: RuvA_N; pfam01330
261594011626	RuvA, C-terminal domain; Region: RuvA_C; pfam07499
261594011627	ABC-type Fe3+-hydroxamate transport system, periplasmic component [Inorganic ion transport and metabolism]; Region: FepB; COG0614
261594011628	Periplasmic binding protein FeuA.  These proteins have predicted to function as initial receptors in ABC transport of metal ions in some eubacterial species.  They belong to the TroA superfamily of periplasmic metal binding proteins that share a distinct...; Region: FeuA; cd01138
261594011629	putative ligand binding residues [chemical binding]; other site
261594011630	Bypass of Forespore C, N terminal; Region: BOFC_N; pfam08977
261594011631	BofC C-terminal domain; Region: BofC_C; pfam08955
261594011632	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
261594011633	dimerization interface [polypeptide binding]; other site
261594011634	putative DNA binding site [nucleotide binding]; other site
261594011635	putative Zn2+ binding site [ion binding]; other site
261594011636	Sporulation lipoprotein YhcN/YlaJ (Spore_YhcN_YlaJ); Region: Spore_YhcN_YlaJ; pfam09580
261594011637	Lysine Motif is a small domain involved in binding peptidoglycan; Region: LysM; cd00118
261594011638	quinolinate synthetase; Provisional; Region: PRK09375
261594011639	nicotinate-nucleotide pyrophosphorylase; Provisional; Region: PRK08072
261594011640	Quinolinate phosphoribosyl transferase (QAPRTase or QPRTase), also called nicotinate-nucleotide pyrophosphorylase, is involved in the de novo synthesis of NAD in both prokaryotes and eukaryotes. It catalyses the reaction of quinolinic acid (QA) with...; Region: QPRTase; cd01572
261594011641	dimerization interface [polypeptide binding]; other site
261594011642	active site
261594011643	L-aspartate oxidase; Provisional; Region: PRK08071
261594011644	L-aspartate oxidase; Provisional; Region: PRK06175
261594011645	Fumarate reductase flavoprotein C-term; Region: Succ_DH_flav_C; pfam02910
261594011646	cysteine desulfurase; Provisional; Region: PRK02948
261594011647	cysteine desulfurase NifS; Region: FeS_nifS; TIGR03402
261594011648	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
261594011649	catalytic residue [active]
261594011650	Predicted small molecule binding protein (contains 3H domain) [General function prediction only]; Region: COG1827
261594011651	HTH domain; Region: HTH_11; pfam08279
261594011652	3H domain; Region: 3H; pfam02829
261594011653	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG2258
261594011654	MOSC domain; Region: MOSC; pfam03473
261594011655	3-alpha domain; Region: 3-alpha; pfam03475
261594011656	prephenate dehydratase; Provisional; Region: PRK11898
261594011657	Prephenate dehydratase; Region: PDT; pfam00800
261594011658	C-terminal ACT domain of the bifunctional chorismate mutase-prephenate dehydratase (CM-PDT) enzyme and the prephenate dehydratase (PDT) enzyme; Region: ACT_CM-PDT; cd04905
261594011659	putative L-Phe binding site [chemical binding]; other site
261594011660	FtsX-like permease family; Region: FtsX; pfam02687
261594011661	ABC-type antimicrobial peptide transport system, permease component [Defense mechanisms]; Region: SalY; COG0577
261594011662	ABC-type antimicrobial peptide transport system, permease component [Defense mechanisms]; Region: SalY; COG0577
261594011663	FtsX-like permease family; Region: FtsX; pfam02687
261594011664	ABC-type antimicrobial peptide transport system, ATPase component [Defense mechanisms]; Region: SalX; COG1136
261594011665	ATP-binding cassette domain of the transporters involved in export of lipoprotein and macrolide, and cell division protein; Region: ABC_MJ0796_LolCDE_FtsE; cd03255
261594011666	Walker A/P-loop; other site
261594011667	ATP binding site [chemical binding]; other site
261594011668	Q-loop/lid; other site
261594011669	ABC transporter signature motif; other site
261594011670	Walker B; other site
261594011671	D-loop; other site
261594011672	H-loop/switch region; other site
261594011673	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
261594011674	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594011675	active site
261594011676	phosphorylation site [posttranslational modification]
261594011677	intermolecular recognition site; other site
261594011678	dimerization interface [polypeptide binding]; other site
261594011679	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
261594011680	DNA binding site [nucleotide binding]
261594011681	GTPase CgtA; Reviewed; Region: obgE; PRK12297
261594011682	GTP1/OBG; Region: GTP1_OBG; pfam01018
261594011683	Obg GTPase; Region: Obg; cd01898
261594011684	G1 box; other site
261594011685	GTP/Mg2+ binding site [chemical binding]; other site
261594011686	Switch I region; other site
261594011687	G2 box; other site
261594011688	G3 box; other site
261594011689	Switch II region; other site
261594011690	G4 box; other site
261594011691	G5 box; other site
261594011692	Domain of unknown function (DUF1967); Region: DUF1967; pfam09269
261594011693	50S ribosomal protein L27; Validated; Region: rpmA; PRK05435
261594011694	hypothetical protein; Provisional; Region: PRK14553
261594011695	50S ribosomal protein L21; Validated; Region: rplU; PRK05573
261594011696	ribonuclease, Rne/Rng family; Region: RNaseEG; TIGR00757
261594011697	S1_RNase_E: RNase E and RNase G, S1-like RNA-binding domain. RNase E is an essential endoribonuclease in the processing and degradation of RNA. In addition to its role in mRNA degradation, RNase E has also been implicated in the processing of rRNA, and...; Region: S1_RNase_E; cd04453
261594011698	homodimer interface [polypeptide binding]; other site
261594011699	oligonucleotide binding site [chemical binding]; other site
261594011700	SpoIVFB Site-2 protease (S2P), a zinc metalloprotease (MEROPS family M50B), regulates intramembrane proteolysis (RIP), and is involved in the pro-sigmaK pathway of bacterial spore formation. SpoIVFB (sporulation protein, stage IV cell wall formation, F...; Region: S2P-M50_SpoIVFB; cd06161
261594011701	Peptidase family M50; Region: Peptidase_M50; pfam02163
261594011702	active site
261594011703	putative substrate binding region [chemical binding]; other site
261594011704	Membrane proteins related to metalloendopeptidases [Cell envelope biogenesis, outer membrane]; Region: NlpD; COG0739
261594011705	Peptidase family M23; Region: Peptidase_M23; pfam01551
261594011706	Septum formation inhibitor-activating ATPase [Cell division and chromosome partitioning]; Region: MinD; COG2894
261594011707	Bacterial cell division requires the formation of a septum at mid-cell. The site is determined by the min operon products MinC, MinD and MinE. MinC is a nonspecific inhibitor of the septum protein FtsZ. MinE is the supressor of MinC. MinD plays a pivotal...; Region: MinD; cd02036
261594011708	Switch I; other site
261594011709	Switch II; other site
261594011710	septum formation inhibitor; Reviewed; Region: minC; PRK00513
261594011711	Septum formation inhibitor MinC, C-terminal domain; Region: MinC_C; pfam03775
261594011712	Cell shape-determining protein [Cell envelope biogenesis, outer membrane]; Region: MreD; COG2891
261594011713	rod shape-determining protein MreC; Provisional; Region: PRK13922
261594011714	rod shape-determining protein MreC; Region: MreC; pfam04085
261594011715	rod shape-determining protein MreB; Provisional; Region: PRK13927
261594011716	MreB and similar proteins; Region: MreB_like; cd10225
261594011717	nucleotide binding site [chemical binding]; other site
261594011718	Mg binding site [ion binding]; other site
261594011719	putative protofilament interaction site [polypeptide binding]; other site
261594011720	RodZ interaction site [polypeptide binding]; other site
261594011721	hypothetical protein; Reviewed; Region: PRK00024
261594011722	Mov34/MPN/PAD-1 family; Region: MPN_DUF2466; cd08071
261594011723	MPN+ (JAMM) motif; other site
261594011724	Zinc-binding site [ion binding]; other site
261594011725	Maf-like protein; Region: Maf; pfam02545
261594011726	Nucleotide binding protein Maf. Maf has been implicated in inhibition of septum formation in eukaryotes, bacteria and archaea, but homologs in B.subtilis and S.cerevisiae are nonessential for cell division. Maf has been predicted to be a nucleotide- or...; Region: Maf; cd00555
261594011727	active site
261594011728	dimer interface [polypeptide binding]; other site
261594011729	Folylpolyglutamate synthase [Coenzyme metabolism]; Region: FolC; COG0285
261594011730	Mur ligase middle domain; Region: Mur_ligase_M; pfam08245
261594011731	Mur ligase family, glutamate ligase domain; Region: Mur_ligase_C; pfam02875
261594011732	valyl-tRNA synthetase; Reviewed; Region: valS; PRK05729
261594011733	nucleotidyl transferase superfamily; Region: nt_trans; cl00015
261594011734	active site
261594011735	HIGH motif; other site
261594011736	nucleotide binding site [chemical binding]; other site
261594011737	Leucyl-tRNA synthetase, Domain 2; Region: tRNA-synt_1_2; pfam13603
261594011738	catalytic core domain of valyl-tRNA synthetases; Region: ValRS_core; cd00817
261594011739	active site
261594011740	KMSKS motif; other site
261594011741	Anticodon-binding domain of valyl tRNA synthetases; Region: Anticodon_Ia_Val; cd07962
261594011742	tRNA binding surface [nucleotide binding]; other site
261594011743	anticodon binding site; other site
261594011744	Valyl tRNA synthetase tRNA binding arm; Region: Val_tRNA-synt_C; pfam10458
261594011745	spore coat protein YsxE; Region: spore_ysxE; TIGR02904
261594011746	stage VI sporulation protein D; Region: spore_VI_D; TIGR02907
261594011747	Lysine Motif is a small domain involved in binding peptidoglycan; Region: LysM; cd00118
261594011748	glutamate-1-semialdehyde aminotransferase; Provisional; Region: PRK00062
261594011749	Acetyl ornithine aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to ornithine aminotransferase, acetylornithine aminotransferase; Region: OAT_like; cd00610
261594011750	inhibitor-cofactor binding pocket; inhibition site
261594011751	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594011752	catalytic residue [active]
261594011753	Porphobilinogen synthase (PBGS), which is also called delta-aminolevulinic acid dehydratase (ALAD), catalyzes the condensation of two 5-aminolevulinic acid (ALA) molecules to form the pyrrole porphobilinogen (PBG), which is the second step in the...; Region: ALAD_PBGS; cd00384
261594011754	dimer interface [polypeptide binding]; other site
261594011755	active site
261594011756	Schiff base residues; other site
261594011757	uroporphyrinogen-III synthase; Reviewed; Region: hemD; PRK05928
261594011758	Uroporphyrinogen-III synthase (HemD) catalyzes the asymmetrical cyclization of tetrapyrrole (linear) to uroporphyrinogen-III, the fourth step in the biosynthesis of heme. This ubiquitous enzyme is present in eukaryotes, bacteria and archaea. Mutations in...; Region: HemD; cd06578
261594011759	active site
261594011760	porphobilinogen deaminase; Reviewed; Region: hemC; PRK00072
261594011761	Hydroxymethylbilane synthase (HMBS), also known as porphobilinogen deaminase (PBGD), is an intermediate enzyme in the biosynthetic pathway of tetrapyrrolic ring systems, such as heme, chlorophylls, and vitamin B12. HMBS catalyzes the conversion of...; Region: HMBS; cd00494
261594011762	domain interfaces; other site
261594011763	active site
261594011764	Cytochrome C assembly protein; Region: Cytochrom_C_asm; cl00504
261594011765	glutamyl-tRNA reductase; Reviewed; Region: hemA; PRK00045
261594011766	NADP-binding domain of glutamyl-tRNA reductase; Region: NAD_bind_Glutamyl_tRNA_reduct; cd05213
261594011767	tRNA; other site
261594011768	putative tRNA binding site [nucleotide binding]; other site
261594011769	putative NADP binding site [chemical binding]; other site
261594011770	Glutamyl-tRNAGlu reductase, dimerisation domain; Region: GlutR_dimer; pfam00745
261594011771	Transcriptional regulators [Transcription]; Region: MarR; COG1846
261594011772	MarR family; Region: MarR; pfam01047
261594011773	peroxiredoxin, Ohr subfamily; Region: organ_hyd_perox; TIGR03561
261594011774	YihA (EngB) GTPase family; Region: YihA_EngB; cd01876
261594011775	G1 box; other site
261594011776	GTP/Mg2+ binding site [chemical binding]; other site
261594011777	Switch I region; other site
261594011778	G2 box; other site
261594011779	G3 box; other site
261594011780	Switch II region; other site
261594011781	G4 box; other site
261594011782	G5 box; other site
261594011783	ATP-dependent Lon protease, bacterial type [Posttranslational modification, protein turnover, chaperones]; Region: Lon; COG0466
261594011784	Found in ATP-dependent protease La (LON); Region: LON; smart00464
261594011785	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
261594011786	Walker A motif; other site
261594011787	ATP binding site [chemical binding]; other site
261594011788	Walker B motif; other site
261594011789	arginine finger; other site
261594011790	Lon protease (S16) C-terminal proteolytic domain; Region: Lon_C; pfam05362
261594011791	ATP-dependent protease LonB; Region: spore_lonB; TIGR02902
261594011792	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
261594011793	Walker A motif; other site
261594011794	ATP binding site [chemical binding]; other site
261594011795	Walker B motif; other site
261594011796	arginine finger; other site
261594011797	Lon protease (S16) C-terminal proteolytic domain; Region: Lon_C; pfam05362
261594011798	ATP-dependent protease ATP-binding subunit ClpX; Provisional; Region: clpX; PRK05342
261594011799	ClpX C4-type zinc finger; Region: zf-C4_ClpX; pfam06689
261594011800	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
261594011801	Walker A motif; other site
261594011802	ATP binding site [chemical binding]; other site
261594011803	Walker B motif; other site
261594011804	arginine finger; other site
261594011805	C-terminal, D2-small domain, of ClpB protein; Region: ClpB_D2-small; smart01086
261594011806	trigger factor; Provisional; Region: tig; PRK01490
261594011807	FKBP-type peptidyl-prolyl cis-trans isomerase; Region: FKBP_C; pfam00254
261594011808	Bacterial trigger factor protein (TF) C-terminus; Region: Trigger_C; pfam05698
261594011809	Pleckstrin homology (PH)-like domains in bacteria (PHb); Region: PH-like_bacteria; cd13225
261594011810	pentamer interface [polypeptide binding]; other site
261594011811	dodecaamer interface [polypeptide binding]; other site
261594011812	YvbH-like oligomerisation region; Region: YvbH_ext; pfam11724
261594011813	Escherichia coli YfcE and related proteins, metallophosphatase domain; Region: MPP_YfcE; cd00841
261594011814	active site
261594011815	metal binding site [ion binding]; metal-binding site
261594011816	homotetramer interface [polypeptide binding]; other site
261594011817	NTPase/HAM1.  This family consists of the HAM1 protein and pyrophosphate-releasing xanthosine/ inosine triphosphatase. HAM1 protects the cell against mutagenesis by the base analog 6-N-hydroxylaminopurine (HAP) in E. Coli and S. cerevisiae. A...; Region: HAM1; cd00515
261594011818	active site
261594011819	dimerization interface [polypeptide binding]; other site
261594011820	ribonuclease PH; Reviewed; Region: rph; PRK00173
261594011821	Ribonuclease PH; Region: RNase_PH_bact; cd11362
261594011822	hexamer interface [polypeptide binding]; other site
261594011823	active site
261594011824	Sporulation and spore germination; Region: Germane; pfam10646
261594011825	Spore germination protein [General function prediction only]; Region: COG5401
261594011826	Sporulation and spore germination; Region: Germane; pfam10646
261594011827	glutamate racemase; Provisional; Region: PRK00865
261594011828	Arabinose efflux permease [Carbohydrate transport and metabolism]; Region: AraJ; COG2814
261594011829	Putative intracellular protease/amidase [General function prediction only]; Region: ThiJ; COG0693
261594011830	Type 1 glutamine amidotransferase (GATase1)-like domain found in proteins similar to Escherichia coli Hsp31 protein; Region: GATase1_Hsp31_like; cd03141
261594011831	potential catalytic triad [active]
261594011832	conserved cys residue [active]
261594011833	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
261594011834	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
261594011835	Type 1 glutamine amidotransferase (GATase1)-like domain found in proteins similar to Escherichia coli Hsp31 protein; Region: GATase1_Hsp31_like; cd03141
261594011836	Putative intracellular protease/amidase [General function prediction only]; Region: ThiJ; COG0693
261594011837	potential catalytic triad [active]
261594011838	conserved cys residue [active]
261594011839	Response regulator containing a CheY-like receiver domain and an HTH DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: CitB; COG2197
261594011840	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
261594011841	DNA binding residues [nucleotide binding]
261594011842	dimerization interface [polypeptide binding]; other site
261594011843	putative uracil/xanthine transporter; Provisional; Region: PRK11412
261594011844	Permeases of the drug/metabolite transporter (DMT) superfamily [Carbohydrate transport and metabolism / Amino acid transport and metabolism / General function prediction only]; Region: RhaT; COG0697
261594011845	EamA-like transporter family; Region: EamA; pfam00892
261594011846	EamA-like transporter family; Region: EamA; pfam00892
261594011847	putative deaminase; Validated; Region: PRK06846
261594011848	Bacterial cytosine deaminase and related metal-dependent hydrolases. Cytosine deaminases (CDs) catalyze the deamination of cytosine, producing uracil and ammonia. They play an important role in pyrimidine salvage. CDs are present in prokaryotes and fungi; Region: Bact_CD; cd01293
261594011849	active site
261594011850	putative deaminase; Validated; Region: PRK06846
261594011851	Bacterial cytosine deaminase and related metal-dependent hydrolases. Cytosine deaminases (CDs) catalyze the deamination of cytosine, producing uracil and ammonia. They play an important role in pyrimidine salvage. CDs are present in prokaryotes and fungi; Region: Bact_CD; cd01293
261594011852	active site
261594011853	ABC-type dipeptide transport system, periplasmic component [Amino acid transport and metabolism]; Region: DdpA; COG0747
261594011854	The substrate-binding component of an uncharacterized ABC-type peptide import system Ylib contains the type 2 periplasmic binding fold; Region: PBP2_Ylib_like; cd08499
261594011855	ABC-type dipeptide/oligopeptide/nickel transport systems, permease components [Amino acid transport and metabolism / Inorganic ion transport and metabolism]; Region: DppC; COG1173
261594011856	N-terminal TM domain of oligopeptide transport permease C; Region: OppC_N; pfam12911
261594011857	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
261594011858	dimer interface [polypeptide binding]; other site
261594011859	conserved gate region; other site
261594011860	ABC-ATPase subunit interface; other site
261594011861	ABC-type dipeptide/oligopeptide/nickel transport systems, permease components [Amino acid transport and metabolism / Inorganic ion transport and metabolism]; Region: DppB; COG0601
261594011862	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
261594011863	dimer interface [polypeptide binding]; other site
261594011864	conserved gate region; other site
261594011865	putative PBP binding loops; other site
261594011866	ABC-ATPase subunit interface; other site
261594011867	ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component [Amino acid transport and metabolism / Inorganic ion transport and metabolism]; Region: DppD; COG0444
261594011868	ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257
261594011869	Walker A/P-loop; other site
261594011870	ATP binding site [chemical binding]; other site
261594011871	Q-loop/lid; other site
261594011872	ABC transporter signature motif; other site
261594011873	Walker B; other site
261594011874	D-loop; other site
261594011875	H-loop/switch region; other site
261594011876	oligopeptide/dipeptide ABC transporter, ATP-binding protein, C-terminal domain; Region: oligo_HPY; TIGR01727
261594011877	dipeptide transporter ATP-binding subunit; Provisional; Region: dppF; PRK11308
261594011878	ATP-binding cassette domain of nickel/oligopeptides specific transporters; Region: ABC_NikE_OppD_transporters; cd03257
261594011879	Walker A/P-loop; other site
261594011880	ATP binding site [chemical binding]; other site
261594011881	Q-loop/lid; other site
261594011882	ABC transporter signature motif; other site
261594011883	Walker B; other site
261594011884	D-loop; other site
261594011885	H-loop/switch region; other site
261594011886	oligopeptide/dipeptide ABC transporter, ATP-binding protein, C-terminal domain; Region: oligo_HPY; TIGR01727
261594011887	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594011888	Response regulator receiver domain; Region: Response_reg; pfam00072
261594011889	active site
261594011890	phosphorylation site [posttranslational modification]
261594011891	intermolecular recognition site; other site
261594011892	dimerization interface [polypeptide binding]; other site
261594011893	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
261594011894	helix_turn_helix, arabinose operon control protein; Region: HTH_ARAC; smart00342
261594011895	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
261594011896	Putative stress-responsive transcriptional regulator [Transcription / Signal transduction mechanisms]; Region: PspC; COG1983
261594011897	DNA-binding transcriptional repressor PuuR; Provisional; Region: PRK09943
261594011898	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
261594011899	non-specific DNA binding site [nucleotide binding]; other site
261594011900	salt bridge; other site
261594011901	sequence-specific DNA binding site [nucleotide binding]; other site
261594011902	Cupin domain; Region: Cupin_2; pfam07883
261594011903	Multidrug resistance efflux transporter; Region: EmrE; pfam13536
261594011904	Major intrinsic protein (MIP) superfamily. Members of the MIP superfamily function as membrane channels that selectively transport water, small neutral molecules, and ions out of and between cells. The channel proteins share a common fold: the N-terminal...; Region: MIP; cl00200
261594011905	amphipathic channel; other site
261594011906	Asn-Pro-Ala signature motifs; other site
261594011907	Predicted transcriptional regulator [Transcription]; Region: COG1959
261594011908	Transcriptional regulator; Region: Rrf2; pfam02082
261594011909	ABC-type Na+ efflux pump, permease component [Energy production and conversion / Inorganic ion transport and metabolism]; Region: NatB; COG1668
261594011910	ABC-type uncharacterized transport system, ATPase component [General function prediction only]; Region: COG4152
261594011911	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
261594011912	Walker A/P-loop; other site
261594011913	ATP binding site [chemical binding]; other site
261594011914	Q-loop/lid; other site
261594011915	ABC transporter signature motif; other site
261594011916	Walker B; other site
261594011917	D-loop; other site
261594011918	H-loop/switch region; other site
261594011919	Domain of unknown function (DUF4162); Region: DUF4162; pfam13732
261594011920	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
261594011921	active site
261594011922	motif I; other site
261594011923	motif II; other site
261594011924	flagellar motor protein MotA; Validated; Region: PRK08124
261594011925	MotA/TolQ/ExbB proton channel family; Region: MotA_ExbB; cl00568
261594011926	D-alanyl-D-alanine carboxypeptidase [Cell envelope biogenesis, outer membrane]; Region: VanY; COG1876
261594011927	D-alanyl-D-alanine carboxypeptidase; Region: VanY; pfam02557
261594011928	4-hydroxybenzoyl-CoA thioesterase (4HBT). Catalyzes the final step in the 4-chlorobenzoate degradation pathway in which 4-chlorobenzoate is converted to 4-hydroxybenzoate in certain soil-dwelling bacteria. 4HBT forms a homotetramer with four active sites; Region: 4HBT; cd00586
261594011929	active site
261594011930	succinate dehydrogenase iron-sulfur subunit; Reviewed; Region: sdhB; PRK08640
261594011931	2Fe-2S iron-sulfur cluster binding domain; Region: Fer2_3; pfam13085
261594011932	The HCP family of iron-sulfur proteins includes hybrid cluster protein (HCP), acetyl-CoA synthase (ACS), and carbon monoxide dehydrogenase (CODH), all of which contain [Fe4-S4] metal clusters at their active sites. These proteins have a conserved...; Region: HCP_like; cl14655
261594011933	succinate dehydrogenase flavoprotein subunit; Reviewed; Region: sdhA; PRK08641
261594011934	L-aspartate oxidase; Provisional; Region: PRK06175
261594011935	Fumarate reductase flavoprotein C-term; Region: Succ_DH_flav_C; pfam02910
261594011936	succinate dehydrogenase (or fumarate reductase) cytochrome b subunit, b558 family; Region: sdhC_b558_fam; TIGR02046
261594011937	Succinate:quinone oxidoreductase (SQR) Type B subfamily 1, transmembrane subunit; composed of proteins similar to Bacillus subtilis SQR. SQR catalyzes the oxidation of succinate to fumarate coupled to the reduction of quinone to quinol. Bacillus subtilis...; Region: SQR_TypeB_1_TM; cd03497
261594011938	putative Iron-sulfur protein interface [polypeptide binding]; other site
261594011939	proximal heme binding site [chemical binding]; other site
261594011940	distal heme binding site [chemical binding]; other site
261594011941	putative dimer interface [polypeptide binding]; other site
261594011942	Protein of unknown function (DUF2507); Region: DUF2507; pfam10702
261594011943	excinuclease ABC subunit C; Validated; Region: uvrC; PRK00558
261594011944	Catalytic GIY-YIG domain of nucleotide excision repair endonucleases UvrC, Cho, and similar proteins; Region: GIY-YIG_UvrC_Cho; cd10434
261594011945	GIY-YIG motif/motif A; other site
261594011946	active site
261594011947	catalytic site [active]
261594011948	putative DNA binding site [nucleotide binding]; other site
261594011949	metal binding site [ion binding]; metal-binding site
261594011950	UvrB/uvrC motif; Region: UVR; pfam02151
261594011951	UvrC Helix-hairpin-helix N-terminal; Region: UvrC_HhH_N; pfam08459
261594011952	TRX family; composed of two groups: Group I, which includes proteins that exclusively encode a TRX domain; and Group II, which are composed of fusion proteins of TRX and additional domains. Group I TRX is a small ancient protein that alter the redox...; Region: TRX_family; cd02947
261594011953	Thioredoxin-like; Region: Thioredoxin_8; pfam13905
261594011954	catalytic residues [active]
261594011955	Electron transfer flavoprotein, alpha subunit [Energy production and conversion]; Region: FixB; COG2025
261594011956	The electron transfer flavoprotein (ETF) serves as a specific electron acceptor for various mitochondrial dehydrogenases. ETF transfers electrons to the main respiratory chain via ETF-ubiquinone oxidoreductase. ETF is an heterodimer that consists of an...; Region: ETF_alpha; cd01715
261594011957	Electron transfer flavoprotein FAD-binding domain; Region: ETF_alpha; pfam00766
261594011958	The electron transfer flavoprotein (ETF) serves as a specific electron acceptor for various mitochondrial dehydrogenases. ETF transfers electrons to the main respiratory chain via ETF-ubiquinone oxidoreductase. ETF is an heterodimer that consists of an...; Region: ETF_beta; cd01714
261594011959	Ligand binding site [chemical binding]; other site
261594011960	Electron transfer flavoprotein domain; Region: ETF; pfam01012
261594011961	enoyl-CoA hydratase; Provisional; Region: PRK07658
261594011962	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
261594011963	substrate binding site [chemical binding]; other site
261594011964	oxyanion hole (OAH) forming residues; other site
261594011965	trimer interface [polypeptide binding]; other site
261594011966	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cl15762
261594011967	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
261594011968	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
261594011969	YsiA-like protein, C-terminal region; Region: TetR_C_4; pfam08359
261594011970	long-chain-fatty-acid--CoA ligase; Validated; Region: PRK06710
261594011971	Prokaryotic long-chain fatty acid CoA synthetases similar to Escherichia coli FadD; Region: FC-FACS_FadD_like; cd05936
261594011972	acyl-activating enzyme (AAE) consensus motif; other site
261594011973	putative AMP binding site [chemical binding]; other site
261594011974	putative active site [active]
261594011975	putative CoA binding site [chemical binding]; other site
261594011976	ABC-type Fe3+-citrate transport system, periplasmic component [Inorganic ion transport and metabolism]; Region: FecB; COG4594
261594011977	Fe3+-siderophore binding domain FhuD.  These proteins have been shown to function as initial receptors in ABC transport of Fe3+-siderophores in many eubacterial species. They belong to the TroA-like superfamily of helical backbone metal receptor proteins...; Region: FhuD; cd01146
261594011978	siderophore binding site; other site
261594011979	iron-hydroxamate transporter permease subunit; Provisional; Region: PRK10577
261594011980	Transmembrane subunit (TM), of Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters involved in the uptake of siderophores, heme, vitamin B12, or the divalent cations Mg2+ and Zn2+. PBP-dependent ABC transporters consist of...; Region: TM_ABC_iron-siderophores_like; cd06550
261594011981	ABC-ATPase subunit  interface; other site
261594011982	dimer interface [polypeptide binding]; other site
261594011983	putative PBP binding regions; other site
261594011984	Transmembrane subunit (TM), of Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters involved in the uptake of siderophores, heme, vitamin B12, or the divalent cations Mg2+ and Zn2+. PBP-dependent ABC transporters consist of...; Region: TM_ABC_iron-siderophores_like; cd06550
261594011985	ABC-ATPase subunit  interface; other site
261594011986	dimer interface [polypeptide binding]; other site
261594011987	putative PBP binding regions; other site
261594011988	DinB family; Region: DinB; cl17821
261594011989	DinB superfamily; Region: DinB_2; pfam12867
261594011990	Domain of unknown function (DUF4097); Region: DUF4097; pfam13349
261594011991	Domain of unknown function (DUF4098); Region: DUF4098; pfam13345
261594011992	Domain of unknown function (DUF4098); Region: DUF4098; pfam13345
261594011993	ABC-type multidrug transport system, ATPase component [Defense mechanisms]; Region: CcmA; COG1131
261594011994	ATP-binding cassette domain of the bacitracin-resistance transporter; Region: ABC_BcrA_bacitracin_resist; cd03268
261594011995	Walker A/P-loop; other site
261594011996	ATP binding site [chemical binding]; other site
261594011997	Q-loop/lid; other site
261594011998	ABC transporter signature motif; other site
261594011999	Walker B; other site
261594012000	D-loop; other site
261594012001	H-loop/switch region; other site
261594012002	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
261594012003	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
261594012004	dimer interface [polypeptide binding]; other site
261594012005	phosphorylation site [posttranslational modification]
261594012006	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594012007	ATP binding site [chemical binding]; other site
261594012008	Mg2+ binding site [ion binding]; other site
261594012009	G-X-G motif; other site
261594012010	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
261594012011	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594012012	active site
261594012013	phosphorylation site [posttranslational modification]
261594012014	intermolecular recognition site; other site
261594012015	dimerization interface [polypeptide binding]; other site
261594012016	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
261594012017	DNA binding site [nucleotide binding]
261594012018	Uncharacterized conserved protein (DUF2196); Region: DUF2196; pfam09962
261594012019	Predicted SAM-dependent methyltransferases [General function prediction only]; Region: COG1092
261594012020	Middle domain of the SAM-dependent methyltransferase RlmI and related proteins; Region: RlmI_M_like; cd11572
261594012021	putative RNA binding site [nucleotide binding]; other site
261594012022	NhaP-type Na+/H+ and K+/H+ antiporters [Inorganic ion transport and metabolism]; Region: NhaP; COG0025
261594012023	Kef-type K+ transport systems, membrane components [Inorganic ion transport and metabolism]; Region: KefB; cl10482
261594012024	TrkA-N domain; Region: TrkA_N; pfam02254
261594012025	heme-degrading monooxygenase IsdG; Provisional; Region: PRK13314
261594012026	Sortase B (SrtB) or subfamily-2 sortases are membrane cysteine transpeptidases found in gram-positive bacteria that anchor surface proteins to peptidoglycans of the bacterial cell wall envelope. This involves a transpeptidation reaction in which the...; Region: Sortase_B_2; cd05826
261594012027	active site
261594012028	catalytic site [active]
261594012029	ABC-type cobalamin/Fe3+-siderophores transport systems, ATPase components [Inorganic ion transport and metabolism / Coenzyme metabolism]; Region: FepC; COG1120
261594012030	ATP-binding component of iron-siderophores, vitamin B12 and hemin transporters and related proteins; Region: ABC_Iron-Siderophores_B12_Hemin; cd03214
261594012031	Walker A/P-loop; other site
261594012032	ATP binding site [chemical binding]; other site
261594012033	Q-loop/lid; other site
261594012034	ABC transporter signature motif; other site
261594012035	Walker B; other site
261594012036	D-loop; other site
261594012037	H-loop/switch region; other site
261594012038	ABC-type enterobactin transport system, permease component [Inorganic ion transport and metabolism]; Region: FepG; COG4779
261594012039	Transmembrane subunit (TM), of Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters involved in the uptake of siderophores, heme, vitamin B12, or the divalent cations Mg2+ and Zn2+. PBP-dependent ABC transporters consist of...; Region: TM_ABC_iron-siderophores_like; cd06550
261594012040	ABC-ATPase subunit  interface; other site
261594012041	dimer interface [polypeptide binding]; other site
261594012042	putative PBP binding regions; other site
261594012043	heme ABC transporter, heme-binding protein isdE; Region: IsdE; TIGR03659
261594012044	Helical backbone metal receptor (TroA-like domain). These proteins have been shown to function in the ABC transport of ferric siderophores and metal ions such as Mn2+, Fe3+, Cu2+ and/or Zn2+.  Their ligand binding site is formed in the interface between...; Region: TroA-like; cl00262
261594012045	intersubunit interface [polypeptide binding]; other site
261594012046	NEAr Transport domain, a component of cell surface proteins; Region: NEAT; cd06920
261594012047	heme-binding site [chemical binding]; other site
261594012048	NEAr Transport domain, a component of cell surface proteins; Region: NEAT; cd06920
261594012049	heme-binding site [chemical binding]; other site
261594012050	NEAr Transport domain, a component of cell surface proteins; Region: NEAT; cd06920
261594012051	heme-binding site [chemical binding]; other site
261594012052	NEAr Transport domain, a component of cell surface proteins; Region: NEAT; cd06920
261594012053	heme-binding site [chemical binding]; other site
261594012054	NEAr Transport domain, a component of cell surface proteins; Region: NEAT; cd06920
261594012055	heme-binding site [chemical binding]; other site
261594012056	NEAr Transport domain, a component of cell surface proteins; Region: NEAT; cd06920
261594012057	heme-binding site [chemical binding]; other site
261594012058	heme uptake protein IsdC; Region: IsdC; TIGR03656
261594012059	NEAr Transport domain, a component of cell surface proteins; Region: NEAT; cd06920
261594012060	heme-binding site [chemical binding]; other site
261594012061	sortase B cell surface sorting signal; Region: srtB_target; TIGR03063
261594012062	Branched-chain amino acid transport protein; Region: Branch_AA_trans; pfam05525
261594012063	16S rRNA uridine-516 pseudouridylate synthase and related pseudouridylate synthases [Translation, ribosomal structure and biogenesis]; Region: RsuA; COG1187
261594012064	S4/Hsp/ tRNA synthetase RNA-binding domain; The domain surface is populated by conserved, charged residues that define a likely RNA-binding site;  Found in stress proteins, ribosomal proteins and tRNA synthetases; This may imply a hitherto unrecognized...; Region: S4; cd00165
261594012065	RNA binding surface [nucleotide binding]; other site
261594012066	Pseudouridine synthase, Escherichia coli RluF like; Region: PseudoU_synth_RluF; cd02554
261594012067	probable active site [active]
261594012068	recombination and DNA strand exchange inhibitor protein; Reviewed; Region: PRK00409
261594012069	MutS domain III; Region: MutS_III; pfam05192
261594012070	ATP-binding cassette domain of MutS2; Region: ABC_MutS2; cd03280
261594012071	Walker A/P-loop; other site
261594012072	ATP binding site [chemical binding]; other site
261594012073	Q-loop/lid; other site
261594012074	ABC transporter signature motif; other site
261594012075	Walker B; other site
261594012076	D-loop; other site
261594012077	H-loop/switch region; other site
261594012078	Smr domain; Region: Smr; pfam01713
261594012079	hypothetical protein; Provisional; Region: PRK08609
261594012080	Nucleotidyltransferase (NT) domain of family X DNA Polymerases; Region: NT_POLXc; cd00141
261594012081	active site
261594012082	primer binding site [nucleotide binding]; other site
261594012083	NTP  binding site [chemical binding]; other site
261594012084	metal binding triad [ion binding]; metal-binding site
261594012085	Polymerase and Histidinol Phosphatase domain of bacterial polymerase X; Region: PHP_PolX; cd07436
261594012086	active site
261594012087	Uncharacterized membrane protein, required for colicin V production [General function prediction only]; Region: CvpA; COG1286
261594012088	Colicin V production protein; Region: Colicin_V; pfam02674
261594012089	cell division protein ZapA; Provisional; Region: PRK14126
261594012090	ribonuclease HIII; Provisional; Region: PRK00996
261594012091	Domain of unknown function (DUF3378); Region: DUF3378; pfam11858
261594012092	bacterial Ribonuclease HIII-like; Region: RNase_HII_bacteria_HIII_like; cd06590
261594012093	RNA/DNA hybrid binding site [nucleotide binding]; other site
261594012094	active site
261594012095	asparaginyl-tRNA synthetase; Validated; Region: asnC; PRK03932
261594012096	EcAsnRS_like_N: N-terminal, anticodon recognition domain of the type found in Escherichia coli asparaginyl-tRNA synthetase (AsnRS) and, in Arabidopsis thaliana and Saccharomyces cerevisiae mitochondrial (mt) AsnRS. This domain is a beta-barrel domain (OB...; Region: EcAsnRS_like_N; cd04318
261594012097	putative dimer interface [polypeptide binding]; other site
261594012098	putative anticodon binding site; other site
261594012099	Asx tRNA synthetase (AspRS/AsnRS) class II core domain.  Assignment to class II aminoacyl-tRNA synthetases (aaRS) based upon its structure and the presence of three characteristic sequence motifs in the core domain. This family includes AsnRS as well as...; Region: AsxRS_core; cd00776
261594012100	homodimer interface [polypeptide binding]; other site
261594012101	motif 1; other site
261594012102	motif 2; other site
261594012103	active site
261594012104	motif 3; other site
261594012105	phenylalanyl-tRNA synthetase subunit beta; Reviewed; Region: pheT; PRK00629
261594012106	tRNA-binding-domain-containing prokaryotic phenylalanly tRNA synthetase (PheRS) beta chain.  PheRS aminoacylate phenylalanine transfer RNAs (tRNAphe). PheRSs belong structurally to class II aminoacyl tRNA synthetases (aaRSs) but, as they aminoacylate...; Region: tRNA_bind_bactPheRS; cd02796
261594012107	putative tRNA-binding site [nucleotide binding]; other site
261594012108	B3/4 domain; Region: B3_4; pfam03483
261594012109	tRNA synthetase B5 domain; Region: B5; smart00874
261594012110	Phenylalanyl-tRNA synthetase (PheRS) beta chain core domain. PheRS belongs to class II aminoacyl-tRNA synthetases (aaRS) based upon its structure. While class II aaRSs generally aminoacylate the 3'-OH ribose of the appropriate tRNA,  PheRS is an...; Region: PheRS_beta_core; cd00769
261594012111	dimer interface [polypeptide binding]; other site
261594012112	motif 1; other site
261594012113	motif 3; other site
261594012114	motif 2; other site
261594012115	Ferredoxin-fold anticodon binding domain; Region: FDX-ACB; pfam03147
261594012116	phenylalanyl-tRNA synthetase subunit alpha; Validated; Region: pheS; PRK00488
261594012117	Aminoacyl tRNA synthetase class II, N-terminal domain; Region: Phe_tRNA-synt_N; pfam02912
261594012118	Phenylalanyl-tRNA synthetase (PheRS) alpha chain catalytic core domain. PheRS belongs to class II aminoacyl-tRNA synthetases (aaRS) based upon its structure and the presence of three characteristic sequence motifs. This domain is primarily responsible...; Region: PheRS_alpha_core; cd00496
261594012119	dimer interface [polypeptide binding]; other site
261594012120	motif 1; other site
261594012121	active site
261594012122	motif 2; other site
261594012123	motif 3; other site
261594012124	rRNA methylases [Translation, ribosomal structure and biogenesis]; Region: SpoU; COG0566
261594012125	RNA 2'-O ribose methyltransferase substrate binding; Region: SpoU_sub_bind; pfam08032
261594012126	SpoU rRNA Methylase family; Region: SpoU_methylase; pfam00588
261594012127	small acid-soluble spore protein SspI; Provisional; Region: PRK02955
261594012128	Metal dependent phosphohydrolases with conserved 'HD' motif; Region: HDc; cd00077
261594012129	Zn2+ binding site [ion binding]; other site
261594012130	Mg2+ binding site [ion binding]; other site
261594012131	CAAX protease self-immunity; Region: Abi; pfam02517
261594012132	CAAX protease self-immunity; Region: Abi; pfam02517
261594012133	drug resistance transporter, EmrB/QacA subfamily; Region: efflux_EmrB; TIGR00711
261594012134	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594012135	putative substrate translocation pore; other site
261594012136	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594012137	HlyD family secretion protein; Region: HlyD_3; pfam13437
261594012138	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
261594012139	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
261594012140	Transcriptional regulator C-terminal region; Region: TetR_C_8; pfam14278
261594012141	Cellulase M and related proteins [Carbohydrate transport and metabolism]; Region: FrvX; COG1363
261594012142	M42 Peptidase, Endoglucanases; Region: M42_Frv; cd05656
261594012143	oligomer interface [polypeptide binding]; other site
261594012144	active site
261594012145	metal binding site [ion binding]; metal-binding site
261594012146	dUTPase; Region: dUTPase_2; pfam08761
261594012147	Nucleoside Triphosphate Pyrophosphohydrolase (EC 3.6.1.8) MazG-like domain found in dimeric 2-Deoxyuridine 5'-triphosphate nucleotidohydrolase and similar proteins; Region: NTP-PPase_dUTPase; cd11527
261594012148	active site
261594012149	homodimer interface [polypeptide binding]; other site
261594012150	metal binding site [ion binding]; metal-binding site
261594012151	Ribosomal protein L20; Region: Ribosomal_L20; cd07026
261594012152	23S rRNA binding site [nucleotide binding]; other site
261594012153	L21 binding site [polypeptide binding]; other site
261594012154	L13 binding site [polypeptide binding]; other site
261594012155	50S ribosomal protein L35; Reviewed; Region: rpmI; PRK00172
261594012156	translation initiation factor IF-3; Reviewed; Region: infC; PRK00028
261594012157	Translation initiation factor IF-3, N-terminal domain; Region: IF3_N; pfam05198
261594012158	Translation initiation factor IF-3, C-terminal domain; Region: IF3_C; pfam00707
261594012159	threonyl-tRNA synthetase; Reviewed; Region: thrS; PRK00413
261594012160	TGS _ThrRS_N:  ThrRS (threonyl-tRNA Synthetase)  is a class II tRNA synthetase that couples threonine to its cognate tRNA.  In addition to its catalytic and anticodon-binding domains, ThrRS has an N-terminal TGS domain, named after the ThrRS, GTPase, and...; Region: TGS_ThrRS_N; cd01667
261594012161	Threonyl and Alanyl tRNA synthetase second additional domain; Region: tRNA_SAD; smart00863
261594012162	Threonyl-tRNA synthetase (ThrRS) class II core catalytic domain. ThrRS is a homodimer. It is responsible for the attachment of threonine to the 3' OH group of ribose of the appropriate tRNA. This domain is primarily responsible for ATP-dependent...; Region: ThrRS_core; cd00771
261594012163	active site
261594012164	dimer interface [polypeptide binding]; other site
261594012165	motif 1; other site
261594012166	motif 2; other site
261594012167	motif 3; other site
261594012168	ThrRS Threonyl-anticodon binding domain. ThrRS belongs to class II aminoacyl-tRNA synthetases (aaRS). This alignment contains the anticodon binding domain, which is responsible for specificity in tRNA-binding, so that the activated amino acid is...; Region: ThrRS_anticodon; cd00860
261594012169	anticodon binding site; other site
261594012170	putative sporulation protein YtxC; Region: spo_ytxC; TIGR02834
261594012171	primosomal protein DnaI; Reviewed; Region: PRK08939
261594012172	Primosomal protein DnaI N-terminus; Region: DnaI_N; pfam07319
261594012173	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
261594012174	Walker A motif; other site
261594012175	ATP binding site [chemical binding]; other site
261594012176	Walker B motif; other site
261594012177	Replication initiation/membrane attachment protein [DNA replication, recombination, and repair]; Region: DnaB; COG3611
261594012178	Replication initiation and membrane attachment; Region: DnaB_2; pfam07261
261594012179	transcriptional regulator NrdR; Validated; Region: nrdR; PRK00464
261594012180	ATP cone domain; Region: ATP-cone; pfam03477
261594012181	S-adenosylmethionine decarboxylase proenzyme; Provisional; Region: PRK03124
261594012182	glyceraldehyde-3-phosphate dehydrogenase; Validated; Region: PRK07729
261594012183	Glyceraldehyde 3-phosphate dehydrogenase, NAD binding domain; Region: Gp_dh_N; pfam00044
261594012184	Glyceraldehyde 3-phosphate dehydrogenase, C-terminal domain; Region: Gp_dh_C; pfam02800
261594012185	Dephospho-CoA kinase [Coenzyme metabolism]; Region: CoaE; COG0237
261594012186	Dephospho-coenzyme A kinase (DPCK, EC 2.7.1.24) catalyzes the phosphorylation of dephosphocoenzyme A (dCoA) to yield CoA, which is the final step in CoA biosynthesis; Region: DPCK; cd02022
261594012187	CoA-binding site [chemical binding]; other site
261594012188	ATP-binding [chemical binding]; other site
261594012189	putative sporulation protein YtaF; Region: spore_YtaF; TIGR02840
261594012190	formamidopyrimidine/5-formyluracil/ 5-hydroxymethyluracil DNA glycosylase; Validated; Region: PRK01103
261594012191	N-terminal domain of Escherichia coli Fpg1/MutM and related bacterial DNA glycosylases; Region: EcFpg-like_N; cd08966
261594012192	DNA binding site [nucleotide binding]
261594012193	catalytic residue [active]
261594012194	H2TH interface [polypeptide binding]; other site
261594012195	putative catalytic residues [active]
261594012196	turnover-facilitating residue; other site
261594012197	intercalation triad [nucleotide binding]; other site
261594012198	8OG recognition residue [nucleotide binding]; other site
261594012199	putative reading head residues; other site
261594012200	Formamidopyrimidine-DNA glycosylase H2TH domain; Region: H2TH; pfam06831
261594012201	Zinc finger found in FPG and IleRS; Region: zf-FPG_IleRS; pfam06827
261594012202	DNA polymerase I; Provisional; Region: PRK05755
261594012203	PIN domain of the 5'-3' exonuclease of Taq DNA polymerase I and homologs; Region: PIN_53EXO; cd09859
261594012204	active site
261594012205	metal binding site 1 [ion binding]; metal-binding site
261594012206	putative 5' ssDNA interaction site; other site
261594012207	metal binding site 3; metal-binding site
261594012208	metal binding site 2 [ion binding]; metal-binding site
261594012209	H3TH domain of the 5'-3' exonuclease of Taq DNA polymerase I and homologs; Region: H3TH_53EXO; cd09898
261594012210	putative DNA binding site [nucleotide binding]; other site
261594012211	putative metal binding site [ion binding]; other site
261594012212	inactive DEDDy 3'-5' exonuclease domain of Bacillus stearothermophilus DNA polymerase I and similar family-A DNA polymerases; Region: DNA_polA_I_Bacillus_like_exo; cd06140
261594012213	Polymerase I functions primarily to fill DNA gaps that arise during DNA repair, recombination and replication; Region: DNA_pol_A_pol_I_C; cd08637
261594012214	active site
261594012215	DNA binding site [nucleotide binding]
261594012216	catalytic site [active]
261594012217	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
261594012218	dimerization interface [polypeptide binding]; other site
261594012219	phosphate regulon sensor kinase PhoR; Region: phoR_proteo; TIGR02966
261594012220	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
261594012221	putative active site [active]
261594012222	heme pocket [chemical binding]; other site
261594012223	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
261594012224	dimer interface [polypeptide binding]; other site
261594012225	phosphorylation site [posttranslational modification]
261594012226	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594012227	ATP binding site [chemical binding]; other site
261594012228	Mg2+ binding site [ion binding]; other site
261594012229	G-X-G motif; other site
261594012230	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
261594012231	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594012232	active site
261594012233	phosphorylation site [posttranslational modification]
261594012234	intermolecular recognition site; other site
261594012235	dimerization interface [polypeptide binding]; other site
261594012236	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
261594012237	DNA binding site [nucleotide binding]
261594012238	The hotdog fold was initially identified in the E. coli FabA (beta-hydroxydecanoyl-acyl carrier protein (ACP)-dehydratase) structure and subsequently in 4HBT (4-hydroxybenzoyl-CoA thioesterase) from Pseudomonas. A number of other seemingly unrelated...; Region: hot_dog; cl00509
261594012239	active site 2 [active]
261594012240	active site 1 [active]
261594012241	malate dehydrogenase; Reviewed; Region: PRK06223
261594012242	L-lactate dehydrogenase-like malate dehydrogenase proteins; Region: LDH-like_MDH; cd01339
261594012243	NAD(P) binding site [chemical binding]; other site
261594012244	dimer interface [polypeptide binding]; other site
261594012245	tetramer (dimer of dimers) interface [polypeptide binding]; other site
261594012246	substrate binding site [chemical binding]; other site
261594012247	isocitrate dehydrogenase; Reviewed; Region: PRK07006
261594012248	isocitrate dehydrogenase; Validated; Region: PRK07362
261594012249	Bacillus subtilis (Bs) citrate synthase (CS)-II_like. CS catalyzes the condensation of acetyl coenzyme A (AcCoA) and oxalacetate (OAA) to form citrate and coenzyme A (CoA), the first step in the citric acid cycle (TCA or Krebs cycle). 2MCS catalyzes the...; Region: BSuCS-II_like; cd06110
261594012250	dimer interface [polypeptide binding]; other site
261594012251	Citrate synthase; Region: Citrate_synt; pfam00285
261594012252	active site
261594012253	citrylCoA binding site [chemical binding]; other site
261594012254	oxalacetate/citrate binding site [chemical binding]; other site
261594012255	coenzyme A binding site [chemical binding]; other site
261594012256	catalytic triad [active]
261594012257	Protein of unknown function (DUF441); Region: DUF441; pfam04284
261594012258	sporulation integral membrane protein YtvI; Region: spore_ytvI; TIGR02872
261594012259	Domain of unknown function DUF20; Region: UPF0118; pfam01594
261594012260	phage T7 F exclusion suppressor FxsA; Reviewed; Region: fxsA; PRK11463
261594012261	pyruvate kinase; Provisional; Region: PRK06354
261594012262	Pyruvate kinase (PK):  Large allosteric enzyme that regulates glycolysis through binding of the substrate, phosphoenolpyruvate, and one or more allosteric effectors. Like other allosteric enzymes, PK has a high substrate affinity R state and a low...; Region: Pyruvate_Kinase; cl17342
261594012263	domain interfaces; other site
261594012264	active site
261594012265	PEP-utilising enzyme, mobile domain; Region: PEP-utilizers; cl17700
261594012266	Phosphofructokinase, a key regulatory enzyme in glycolysis, catalyzes the phosphorylation of fructose-6-phosphate to fructose-1,6-biphosphate. The members belong to a subfamily of the PFKA family (cd00363) and include bacterial ATP-dependent...; Region: Bacterial_PFK; cd00763
261594012267	6-phosphofructokinase; Region: PFKA_ATP; TIGR02482
261594012268	active site
261594012269	ADP/pyrophosphate binding site [chemical binding]; other site
261594012270	dimerization interface [polypeptide binding]; other site
261594012271	allosteric effector site; other site
261594012272	fructose-1,6-bisphosphate binding site; other site
261594012273	acetyl-CoA carboxylase carboxyltransferase subunit alpha; Validated; Region: PRK05724
261594012274	acetyl-CoA carboxylase carboxyltransferase alpha subunit; Provisional; Region: accA; CHL00198
261594012275	acetyl-CoA carboxylase subunit beta; Validated; Region: PRK05654
261594012276	RNA polymerases M/15 Kd subunit; Region: RNA_POL_M_15KD; cl02717
261594012277	malonate decarboxylase subunit beta; Reviewed; Region: PRK07189; cl17682
261594012278	Transcriptional regulators [Transcription]; Region: FadR; COG2186
261594012279	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
261594012280	DNA-binding site [nucleotide binding]; DNA binding site
261594012281	Malic enzyme, N-terminal domain; Region: malic; pfam00390
261594012282	NAD(P) binding domain of malic enzyme (ME), subgroup 2; Region: NAD_bind_2_malic_enz; cd05311
261594012283	putative NAD(P) binding site [chemical binding]; other site
261594012284	DNA polymerase III DnaE; Reviewed; Region: dnaE; PRK06920
261594012285	Polymerase and Histidinol Phosphatase domain; Region: PHP; cl17102
261594012286	active site
261594012287	DnaE_OBF: A subfamily of OB folds corresponding to the C-terminal OB-fold nucleic acid binding domain of Thermus aquaticus and Escherichia coli type C replicative DNA polymerase III alpha subunit (DnaE). The DNA polymerase holoenzyme of E. coli contains...; Region: DnaE_OBF; cd04485
261594012288	generic binding surface II; other site
261594012289	generic binding surface I; other site
261594012290	Sporulation protein YtrH; Region: Spore_YtrH; pfam14034
261594012291	Exopolyphosphatase-related proteins [General function prediction only]; Region: COG0618
261594012292	DHH family; Region: DHH; pfam01368
261594012293	DHHA1 domain; Region: DHHA1; pfam02272
261594012294	YtpI-like protein; Region: YtpI; pfam14007
261594012295	Protein of unknown function (DUF3949); Region: DUF3949; pfam13133
261594012296	Predicted transcriptional regulator containing CBS domains [Transcription]; Region: COG4109
261594012297	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
261594012298	DNA-binding site [nucleotide binding]; DNA binding site
261594012299	DRTGG domain; Region: DRTGG; pfam07085
261594012300	This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domains associated with a DRTGG domain upstream. The function of the DRTGG domain, named after its conserved residues, is unknown. CBS is a small domain originally...; Region: CBS_pair_DRTGG_assoc; cd04596
261594012301	The hotdog fold was initially identified in the E. coli FabA (beta-hydroxydecanoyl-acyl carrier protein (ACP)-dehydratase) structure and subsequently in 4HBT (4-hydroxybenzoyl-CoA thioesterase) from Pseudomonas. A number of other seemingly unrelated...; Region: hot_dog; cd03440
261594012302	active site 2 [active]
261594012303	active site 1 [active]
261594012304	metal-dependent hydrolase; Provisional; Region: PRK00685
261594012305	Predicted Zn-dependent hydrolases of the beta-lactamase fold [General function prediction only]; Region: COG2220
261594012306	Xaa-Pro aminopeptidase [Amino acid transport and metabolism]; Region: PepP; COG0006
261594012307	Creatinase/Prolidase N-terminal domain; Region: Creatinase_N; pfam01321
261594012308	Similar to Prolidase and Aminopeptidase P. The members of this subfamily presumably catalyse hydrolysis of Xaa-Pro dipeptides and/or release of any N-terminal amino acid, including proline, that is linked with proline; Region: APP-like; cd01092
261594012309	active site
261594012310	Protein of unknown function (DUF3221); Region: DUF3221; pfam11518
261594012311	Protein of unknown function (DUF2785); Region: DUF2785; pfam10978
261594012312	Acetyltransferase (GNAT) domain; Region: Acetyltransf_10; pfam13673
261594012313	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594012314	Coenzyme A binding pocket [chemical binding]; other site
261594012315	Acetyltransferase (GNAT) domain; Region: Acetyltransf_3; pfam13302
261594012316	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594012317	Coenzyme A binding pocket [chemical binding]; other site
261594012318	Mannose-6-phosphate isomerase [Carbohydrate transport and metabolism]; Region: {ManC}; COG0662
261594012319	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
261594012320	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
261594012321	non-specific DNA binding site [nucleotide binding]; other site
261594012322	salt bridge; other site
261594012323	sequence-specific DNA binding site [nucleotide binding]; other site
261594012324	Alanine dehydrogenase [Amino acid transport and metabolism]; Region: Ald; COG0686
261594012325	Alanine dehydrogenase NAD-binding and catalytic domains; Region: L-AlaDH; cd05305
261594012326	hexamer interface [polypeptide binding]; other site
261594012327	ligand binding site [chemical binding]; other site
261594012328	putative active site [active]
261594012329	NAD(P) binding site [chemical binding]; other site
261594012330	3-ketoacyl-(acyl-carrier-protein) reductase; Provisional; Region: fabG; PRK12825
261594012331	classical (c) SDRs; Region: SDR_c; cd05233
261594012332	NAD(P) binding site [chemical binding]; other site
261594012333	active site
261594012334	Usp: Universal stress protein family. The universal stress protein Usp is a small cytoplasmic bacterial protein whose expression is enhanced when the cell is exposed to stress agents. Usp enhances the rate of cell survival during prolonged exposure to...; Region: USP_Like; cd00293
261594012335	Ligand Binding Site [chemical binding]; other site
261594012336	Protein of unknown function (DUF3139); Region: DUF3139; pfam11337
261594012337	argininosuccinate lyase; Provisional; Region: PRK00855
261594012338	Argininosuccinate lyase (argininosuccinase, ASAL); Region: Argininosuccinate_lyase; cd01359
261594012339	active sites [active]
261594012340	tetramer interface [polypeptide binding]; other site
261594012341	argininosuccinate synthase; Provisional; Region: PRK13820
261594012342	Argininosuccinate synthase. The Argininosuccinate synthase is a urea cycle enzyme that catalyzes the penultimate step in arginine biosynthesis: the ATP-dependent ligation of citrulline to aspartate to form argininosuccinate, AMP and pyrophosphate .  In...; Region: Argininosuccinate_Synthase; cd01999
261594012343	ANP binding site [chemical binding]; other site
261594012344	Substrate Binding Site II [chemical binding]; other site
261594012345	Substrate Binding Site I [chemical binding]; other site
261594012346	Uncharacterized conserved protein [Function unknown]; Region: COG1284
261594012347	Uncharacterized BCR, YitT family COG1284; Region: DUF161; pfam02588
261594012348	Uncharacterized BCR, YitT family COG1284; Region: DUF161; pfam02588
261594012349	EcsC protein family; Region: EcsC; pfam12787
261594012350	Putative papain-like cysteine peptidase (DUF1796); Region: DUF1796; pfam08795
261594012351	Members of the Nudix hydrolase superfamily catalyze the hydrolysis of NUcleoside DIphosphates linked to other moieties, X. Enzymes belonging to this superfamily require a divalent cation, such as Mg2+ or Mn2+, for their activity and contain a highly...; Region: Nudix_Hydrolase_29; cd04688
261594012352	nudix motif; other site
261594012353	acetate kinase A/propionate kinase 2; Reviewed; Region: PRK00180
261594012354	propionate/acetate kinase; Provisional; Region: PRK12379
261594012355	Adenine-specific DNA methylase [DNA replication, recombination, and repair]; Region: COG0827
261594012356	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594012357	S-adenosylmethionine binding site [chemical binding]; other site
261594012358	Peroxiredoxin (PRX) family, Atypical 2-cys PRX subfamily; composed of PRXs containing peroxidatic and resolving cysteines, similar to the homodimeric thiol specific antioxidant (TSA) protein also known as TRX-dependent thiol peroxidase (Tpx). Tpx is a...; Region: PRX_Atyp2cys; cd03014
261594012359	dimer interface [polypeptide binding]; other site
261594012360	catalytic triad [active]
261594012361	peroxidatic and resolving cysteines [active]
261594012362	Sporulation protein YtfJ (Spore_YtfJ); Region: Spore_YtfJ; cl01596
261594012363	Protein of unknown function (DUF2953); Region: DUF2953; pfam11167
261594012364	inorganic polyphosphate/ATP-NAD kinase; Provisional; Region: ppnK; PRK03501
261594012365	ATP-NAD kinase; Region: NAD_kinase; pfam01513
261594012366	Predicted metal-dependent hydrolase with the TIM-barrel fold [General function prediction only]; Region: COG1574
261594012367	YtcJ_like metal dependent amidohydrolases. YtcJ is a Bacillus subtilis ORF of unknown function. The Arabidopsis homolog LAF3 has been identified as a factor required for photochrome A signalling; Region: YtcJ_like; cd01300
261594012368	active site
261594012369	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
261594012370	Escherichia coli PhnB and similar proteins; the E. coli phnB gene is found next to an operon involved in the cleavage of carbon-phosphorus bonds in unactivated alkylphosphonates; Region: PhnB_like; cd06588
261594012371	dimer interface [polypeptide binding]; other site
261594012372	Acyl-coenzyme A synthetases/AMP-(fatty) acid ligases [Lipid metabolism]; Region: Acs; COG0365
261594012373	Medium-chain acyl-CoA synthetase (MACS or ACSM); Region: MACS_like; cd05972
261594012374	active site
261594012375	acyl-activating enzyme (AAE) consensus motif; other site
261594012376	putative CoA binding site [chemical binding]; other site
261594012377	AMP binding site [chemical binding]; other site
261594012378	Small, acid-soluble spore proteins, alpha/beta type; Region: SASP; pfam00269
261594012379	thiamine biosynthesis protein ThiI; Provisional; Region: PRK01565
261594012380	THUMP domain of thiamine biosynthesis protein ThiI; Region: THUMP_ThiI; cd11716
261594012381	ThiI is required for thiazole synthesis in the thiamine biosynthesis pathway. It belongs to the Adenosine Nucleotide Hydrolysis suoerfamily and predicted to bind to Adenosine nucleotide; Region: ThiI; cd01712
261594012382	Ligand Binding Site [chemical binding]; other site
261594012383	Cysteine sulfinate desulfinase/cysteine desulfurase and related enzymes [Amino acid transport and metabolism]; Region: NifS; COG1104
261594012384	cysteine desulfurase NifS; Region: FeS_nifS; TIGR03402
261594012385	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
261594012386	catalytic residue [active]
261594012387	septation ring formation regulator EzrA; Provisional; Region: PRK04778
261594012388	Transcriptional regulator [Transcription]; Region: LysR; COG0583
261594012389	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
261594012390	The substrate binding domain of LysR-type transcriptional regulators (LTTRs), a member of the type 2 periplasmic binding fold protein superfamily; Region: PBP2_LTTR_substrate; cd05466
261594012391	dimerization interface [polypeptide binding]; other site
261594012392	Permeases of the drug/metabolite transporter (DMT) superfamily [Carbohydrate transport and metabolism / Amino acid transport and metabolism / General function prediction only]; Region: RhaT; COG0697
261594012393	EamA-like transporter family; Region: EamA; pfam00892
261594012394	EamA-like transporter family; Region: EamA; pfam00892
261594012395	GAF domain-containing protein [Signal transduction mechanisms]; Region: COG1956
261594012396	GAF domain; Region: GAF_2; pfam13185
261594012397	methionine gamma-lyase; Provisional; Region: PRK06767
261594012398	CGS_like: Cystathionine gamma-synthase is a PLP dependent enzyme and catalyzes the committed step of methionine biosynthesis. This pathway is unique to microorganisms and plants, rendering the enzyme an attractive target for the development of...; Region: CGS_like; cd00614
261594012399	homodimer interface [polypeptide binding]; other site
261594012400	substrate-cofactor binding pocket; other site
261594012401	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594012402	catalytic residue [active]
261594012403	30S ribosomal protein S4; Validated; Region: rpsD; PRK05327
261594012404	Ribosomal protein S4/S9 N-terminal domain; Region: Ribosomal_S4; pfam00163
261594012405	S4/Hsp/ tRNA synthetase RNA-binding domain; The domain surface is populated by conserved, charged residues that define a likely RNA-binding site;  Found in stress proteins, ribosomal proteins and tRNA synthetases; This may imply a hitherto unrecognized...; Region: S4; cd00165
261594012406	RNA binding surface [nucleotide binding]; other site
261594012407	Domain of unknown function (DUF4306); Region: DUF4306; pfam14154
261594012408	tyrosyl-tRNA synthetase; Validated; Region: PRK05912
261594012409	catalytic core domain of tyrosinyl-tRNA and tryptophanyl-tRNA synthetase; Region: Tyr_Trp_RS_core; cd00395
261594012410	active site
261594012411	HIGH motif; other site
261594012412	dimer interface [polypeptide binding]; other site
261594012413	KMSKS motif; other site
261594012414	S4/Hsp/ tRNA synthetase RNA-binding domain; The domain surface is populated by conserved, charged residues that define a likely RNA-binding site;  Found in stress proteins, ribosomal proteins and tRNA synthetases; This may imply a hitherto unrecognized...; Region: S4; cd00165
261594012415	RNA binding surface [nucleotide binding]; other site
261594012416	DNA-directed RNA polymerase specialized sigma subunit, sigma24 homolog [Transcription]; Region: RpoE; COG1595
261594012417	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
261594012418	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
261594012419	DNA binding residues [nucleotide binding]
261594012420	acetyl-CoA synthetase; Provisional; Region: PRK04319
261594012421	Domain of unknown function (DUF3448); Region: DUF3448; pfam11930
261594012422	Uncharacterized subfamily of Acetyl-CoA synthetase like family (ACS); Region: MACS_like_4; cd05969
261594012423	active site
261594012424	acyl-activating enzyme (AAE) consensus motif; other site
261594012425	putative CoA binding site [chemical binding]; other site
261594012426	AMP binding site [chemical binding]; other site
261594012427	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cl17182
261594012428	Coenzyme A binding pocket [chemical binding]; other site
261594012429	FOG: CBS domain [General function prediction only]; Region: COG0517
261594012430	This cd contains two tandem repeats of the cystathionine beta-synthase (CBS pair) domains in  the acetoin utilization proteins in bacteria. Acetoin is a product of fermentative metabolism in many prokaryotic and eukaryotic microorganisms.  They produce...; Region: CBS_pair_ACT_assoc; cd04584
261594012431	C-terminal ACT domain of the Bacillus subtilis acetoin utilization protein, AcuB; Region: ACT_AcuB; cd04883
261594012432	Deacetylases, including yeast histone deacetylase and acetoin utilization protein [Chromatin structure and dynamics / Secondary metabolites biosynthesis, transport, and catabolism]; Region: AcuC; COG0123
261594012433	Class I histone deacetylase AcuC (Acetoin utilization protein)-like enzymes; Region: HDAC_AcuC_like; cd09994
261594012434	active site
261594012435	Zn binding site [ion binding]; other site
261594012436	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
261594012437	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594012438	active site
261594012439	phosphorylation site [posttranslational modification]
261594012440	intermolecular recognition site; other site
261594012441	dimerization interface [polypeptide binding]; other site
261594012442	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
261594012443	DNA binding site [nucleotide binding]
261594012444	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
261594012445	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
261594012446	dimerization interface [polypeptide binding]; other site
261594012447	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
261594012448	dimer interface [polypeptide binding]; other site
261594012449	phosphorylation site [posttranslational modification]
261594012450	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594012451	ATP binding site [chemical binding]; other site
261594012452	Mg2+ binding site [ion binding]; other site
261594012453	G-X-G motif; other site
261594012454	Ankyrin repeats (3 copies); Region: Ank_2; pfam12796
261594012455	Ankyrin repeat; Region: Ank; pfam00023
261594012456	Ankyrin repeats (3 copies); Region: Ank_2; pfam12796
261594012457	ankyrin repeats;  ankyrin repeats mediate protein-protein interactions in very diverse families of proteins. The number of ANK repeats in a protein can range from 2 to over 20 (ankyrins, for example). ANK repeats may occur in combinations with other...; Region: ANK; cd00204
261594012458	Ankyrin repeats (many copies); Region: Ank_5; pfam13857
261594012459	Predicted dehydrogenases and related proteins [General function prediction only]; Region: MviM; COG0673
261594012460	Oxidoreductase family, NAD-binding Rossmann fold; Region: GFO_IDH_MocA; pfam01408
261594012461	large-conductance mechanosensitive channel; Provisional; Region: mscL; PRK13955
261594012462	large-conductance mechanosensitive channel; Reviewed; Region: mscL; PRK00567
261594012463	Protein of unknown function (DUF3917); Region: DUF3917; pfam13055
261594012464	Protein of unknown function (DUF3949); Region: DUF3949; pfam13133
261594012465	Domain of unknown function (DUF4288); Region: DUF4288; pfam14119
261594012466	catabolite control protein A; Region: ccpA; TIGR01481
261594012467	Helix-turn-helix (HTH) DNA binding domain of the LacI family of transcriptional regulators; Region: HTH_LacI; cd01392
261594012468	DNA binding site [nucleotide binding]
261594012469	domain linker motif; other site
261594012470	Ligand-binding domain of the catabolite control protein A (CcpA), which functions as the major transcriptional regulator of carbon catabolite repression/regulation; Region: PBP1_CcpA_like; cd06298
261594012471	dimerization interface [polypeptide binding]; other site
261594012472	effector binding site; other site
261594012473	N-terminal repeat domain of CamS sex pheromone cAM373 precursor; Region: CamS_repeat_1; cd13441
261594012474	putative dimer interface [polypeptide binding]; other site
261594012475	CamS sex pheromone cAM373 precursor; Region: CamS; pfam07537
261594012476	C-terminal repeat domain of CamS sex pheromone cAM373 precursor; Region: CamS_repeat_2; cd13440
261594012477	putative dimer interface [polypeptide binding]; other site
261594012478	Protein of unknown function (DUF2847); Region: DUF2847; pfam11009
261594012479	Uncharacterized protein containing a divergent version of the methyl-accepting chemotaxis-like domain [General function prediction only]; Region: COG4768
261594012480	Thermophilic metalloprotease (M29); Region: Peptidase_M29; pfam02073
261594012481	Leucyl aminopeptidase (aminopeptidase T) [Amino acid transport and metabolism]; Region: AmpS; COG2309
261594012482	Domain of unknown function (DUF1200); Region: DUF1200; pfam06713
261594012483	Acetyltransferases, including N-acetylases of ribosomal proteins [Translation, ribosomal structure and biogenesis]; Region: RimL; COG1670
261594012484	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cl17182
261594012485	Coenzyme A binding pocket [chemical binding]; other site
261594012486	UDP-N-acetylmuramate--L-alanine ligase; Provisional; Region: murC; PRK00421
261594012487	Mur ligase family, catalytic domain; Region: Mur_ligase; pfam01225
261594012488	Mur ligase middle domain; Region: Mur_ligase_M; pfam08245
261594012489	Mur ligase family, glutamate ligase domain; Region: Mur_ligase_C; pfam02875
261594012490	nicotinate phosphoribosyltransferase; Provisional; Region: PRK07188
261594012491	Nicotinate phosphoribosyltransferase (NAPRTase), subgroup B. Nicotinate phosphoribosyltransferase catalyses the formation of NAMN and PPi from 5-phosphoribosy -1-pyrophosphate (PRPP) and nicotinic acid, this is the first, and also rate limiting, reaction...; Region: NAPRTase_B; cd01571
261594012492	active site
261594012493	DNA segregation ATPase FtsK/SpoIIIE and related proteins [Cell division and chromosome partitioning]; Region: FtsK; COG1674
261594012494	FtsK/SpoIIIE family; Region: FtsK_SpoIIIE; pfam01580
261594012495	Ftsk gamma domain; Region: Ftsk_gamma; pfam09397
261594012496	tRNA-binding-domain-containing prokaryotic phenylalanly tRNA synthetase (PheRS) beta chain.  PheRS aminoacylate phenylalanine transfer RNAs (tRNAphe). PheRSs belong structurally to class II aminoacyl tRNA synthetases (aaRSs) but, as they aminoacylate...; Region: tRNA_bind_bactPheRS; cd02796
261594012497	putative tRNA-binding site [nucleotide binding]; other site
261594012498	hypothetical protein; Provisional; Region: PRK13668
261594012499	TRX family; composed of two groups: Group I, which includes proteins that exclusively encode a TRX domain; and Group II, which are composed of fusion proteins of TRX and additional domains. Group I TRX is a small ancient protein that alter the redox...; Region: TRX_family; cd02947
261594012500	catalytic residues [active]
261594012501	NTPase; Reviewed; Region: PRK03114
261594012502	Cellulase M and related proteins [Carbohydrate transport and metabolism]; Region: FrvX; COG1363
261594012503	M42 Peptidase, Endoglucanases; Region: M42_Frv; cd05656
261594012504	oligomer interface [polypeptide binding]; other site
261594012505	active site
261594012506	metal binding site [ion binding]; metal-binding site
261594012507	Predicted small secreted protein [Function unknown]; Region: COG5584
261594012508	Metallo-beta-lactamase superfamily; Region: Lactamase_B; smart00849
261594012509	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594012510	S-adenosylmethionine binding site [chemical binding]; other site
261594012511	YtzH-like protein; Region: YtzH; pfam14165
261594012512	Phosphotransferase enzyme family; Region: APH; pfam01636
261594012513	Aminoglycoside 3'-phosphotransferase (APH) and Choline Kinase (ChoK) family. The APH/ChoK family is part of a larger superfamily that includes the catalytic domains of other kinases, such as the typical serine/threonine/tyrosine protein kinases (PKs)...; Region: APH_ChoK_like; cd05120
261594012514	active site
261594012515	substrate binding site [chemical binding]; other site
261594012516	ATP binding site [chemical binding]; other site
261594012517	pullulanase, type I; Region: pulA_typeI; TIGR02104
261594012518	Early set domain associated with the catalytic domain of pullulanase (also called dextrinase and alpha-dextrin endo-1,6-alpha glucosidase); Region: E_set_Pullulanase; cd02860
261594012519	Alpha amylase catalytic domain found in Pullulanase (also called dextrinase; alpha-dextrin endo-1,6-alpha glucosidase), limit dextrinase, and related proteins; Region: AmyAc_Pullulanase_LD-like; cd11341
261594012520	Ca binding site [ion binding]; other site
261594012521	active site
261594012522	catalytic site [active]
261594012523	Domain of unknown function (DUF3372); Region: DUF3372; pfam11852
261594012524	2'-5' RNA ligase; Region: 2_5_ligase; TIGR02258
261594012525	LigT like Phosphoesterase; Region: LigT_PEase; pfam02834
261594012526	LigT like Phosphoesterase; Region: LigT_PEase; pfam02834
261594012527	DeoR-like helix-turn-helix domain; Region: HTH_DeoR; cl17531
261594012528	16S rRNA uridine-516 pseudouridylate synthase and related pseudouridylate synthases [Translation, ribosomal structure and biogenesis]; Region: RsuA; COG1187
261594012529	S4/Hsp/ tRNA synthetase RNA-binding domain; The domain surface is populated by conserved, charged residues that define a likely RNA-binding site;  Found in stress proteins, ribosomal proteins and tRNA synthetases; This may imply a hitherto unrecognized...; Region: S4; cd00165
261594012530	RNA binding surface [nucleotide binding]; other site
261594012531	Pseudouridine synthase, Escherichia coli RsuA like; Region: PseudoU_synth_RsuA; cd02553
261594012532	active site
261594012533	uracil binding [chemical binding]; other site
261594012534	stage V sporulation protein B; Region: spore_V_B; TIGR02900
261594012535	Stage V sporulation protein B, also known as Stage III sporulation protein F, and related proteins; Region: MATE_SpoVB_like; cd13124
261594012536	HI0933-like protein; Region: HI0933_like; pfam03486
261594012537	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
261594012538	drug resistance transporter, EmrB/QacA subfamily; Region: efflux_EmrB; TIGR00711
261594012539	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594012540	putative substrate translocation pore; other site
261594012541	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
261594012542	dimerization interface [polypeptide binding]; other site
261594012543	putative DNA binding site [nucleotide binding]; other site
261594012544	putative Zn2+ binding site [ion binding]; other site
261594012545	Putative hydrophobic ligand-binding SRPBCC domain of Micromonospora echinospora CalC, human Aha1, and related proteins; Region: SRPBCC_CalC_Aha1-like; cd07814
261594012546	putative hydrophobic ligand binding site [chemical binding]; other site
261594012547	Domain of unknown function (DUF3973); Region: DUF3973; pfam13119
261594012548	Protein of unknown function (DUF2758); Region: DUF2758; pfam10957
261594012549	Protein of unknown function (DUF2553); Region: DUF2553; pfam10830
261594012550	CarD-like/TRCF domain; Region: CarD_CdnL_TRCF; cl00588
261594012551	glucose-1-dehydrogenase; Provisional; Region: PRK08936
261594012552	glucose 1 dehydrogenase (GlcDH), classical (c) SDRs; Region: GlcDH_SDR_c; cd05358
261594012553	NAD binding site [chemical binding]; other site
261594012554	homodimer interface [polypeptide binding]; other site
261594012555	active site
261594012556	Putative glucose uptake permease [Carbohydrate transport and metabolism]; Region: GlcU; COG4975
261594012557	L-rhamnose-proton symport protein (RhaT); Region: RhaT; cl05728
261594012558	Protein of unknown function (DUF3888); Region: DUF3888; pfam13027
261594012559	Ubiquitin domain of MoaD-like proteins; Region: MoaD; cd00754
261594012560	MoaE interaction surface [polypeptide binding]; other site
261594012561	MoeB interaction surface [polypeptide binding]; other site
261594012562	thiocarboxylated glycine; other site
261594012563	MoaE family. Members of this family are involved in biosynthesis of the molybdenum cofactor (Moco), an essential cofactor for a diverse group of redox enzymes. Moco biosynthesis is an evolutionarily conserved pathway present in eubacteria, archaea and...; Region: MoaE; cd00756
261594012564	MoaE homodimer interface [polypeptide binding]; other site
261594012565	MoaD interaction [polypeptide binding]; other site
261594012566	active site residues [active]
261594012567	Molybdenum is an essential trace element in the form of molybdenum cofactor (Moco) which is associated with the metabolism of nitrogen, carbon and sulfur by redox active enzymes. In E. coli, the synthesis of Moco involves genes from several loci: moa; Region: MobB; cd03116
261594012568	Walker A motif; other site
261594012569	Molybdopterin biosynthesis enzyme [Coenzyme metabolism]; Region: MoeA; COG0303
261594012570	MoeA family. Members of this family are involved in biosynthesis of the molybdenum cofactor (MoCF), an essential cofactor of a diverse group of redox enzymes. MoCF biosynthesis is an evolutionarily conserved pathway present in eubacteria, archaea and...; Region: MoeA; cd00887
261594012571	dimer interface [polypeptide binding]; other site
261594012572	putative functional site; other site
261594012573	putative MPT binding site; other site
261594012574	MoaC family, prokaryotic and eukaryotic. Members of this family are involved in molybdenum cofactor (Moco) biosynthesis, an essential cofactor of a diverse group of redox enzymes. MoaC, a small hexameric protein, converts, together with MoaA, a guanosine...; Region: MoaC_PE; cd01420
261594012575	trimer interface [polypeptide binding]; other site
261594012576	dimer interface [polypeptide binding]; other site
261594012577	putative active site [active]
261594012578	thiamine/molybdopterin biosynthesis MoeB-like protein; Provisional; Region: PRK12475
261594012579	ThiF_MoeB_HesA. Family of E1-like enzymes involved in molybdopterin and thiamine biosynthesis family. The common reaction mechanism catalyzed by MoeB and ThiF, like other E1 enzymes, begins with a nucleophilic attack of the C-terminal carboxylate of MoaD...; Region: ThiF_MoeB_HesA_family; cd00757
261594012580	ATP binding site [chemical binding]; other site
261594012581	substrate interface [chemical binding]; other site
261594012582	Spore germination protein gerPA/gerPF; Region: gerPA; pfam10676
261594012583	Rhodanese Homology Domain (RHOD); an alpha beta fold domain found duplicated in the rhodanese protein. The cysteine containing enzymatically active version of the domain is also found in the Cdc25 class of protein phosphatases and a variety of proteins...; Region: RHOD; cd00158
261594012584	active site residue [active]
261594012585	homoserine O-acetyltransferase; Provisional; Region: PRK06765
261594012586	homoserine O-acetyltransferase; Provisional; Region: metX; cl17114
261594012587	Bacillus/Clostridium GerA spore germination protein; Region: GerA; pfam03323
261594012588	Spore germination protein; Region: Spore_permease; pfam03845
261594012589	germination protein, Ger(x)C family; Region: spore_ger_x_C; TIGR02887
261594012590	Spore germination B3/ GerAC like, C-terminal; Region: Spore_GerAC; pfam05504
261594012591	Nucleoside Triphosphate Pyrophosphohydrolase (EC 3.6.1.8) MazG-like domain found in Exiguobacterium sibiricum YP_001813558.1 protein and its bacterial homologs; Region: NTP-PPase_YP_001813558; cd11545
261594012592	putative nucleotide binding site [chemical binding]; other site
261594012593	putative metal binding site [ion binding]; other site
261594012594	leucyl-tRNA synthetase; Validated; Region: leuS; PRK00390
261594012595	catalytic core domain of leucyl-tRNA synthetases; Region: LeuRS_core; cd00812
261594012596	HIGH motif; other site
261594012597	Leucyl-tRNA synthetase, Domain 2; Region: tRNA-synt_1_2; pfam13603
261594012598	catalytic core domain of leucyl-tRNA synthetases; Region: LeuRS_core; cd00812
261594012599	active site
261594012600	KMSKS motif; other site
261594012601	Anticodon-binding domain of bacterial and eukaryotic mitochondrial leucyl tRNA synthetases; Region: Anticodon_Ia_Leu_BEm; cd07958
261594012602	tRNA binding surface [nucleotide binding]; other site
261594012603	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594012604	Major Facilitator Superfamily; Region: MFS_1; pfam07690
261594012605	putative substrate translocation pore; other site
261594012606	Kef-type K+ transport systems, membrane components [Inorganic ion transport and metabolism]; Region: KefB; COG0475
261594012607	Sodium/hydrogen exchanger family; Region: Na_H_Exchanger; pfam00999
261594012608	Putative regulatory, ligand-binding protein related to C-terminal domains of K+ channels [Inorganic ion transport and metabolism]; Region: COG0490
261594012609	TrkA-C domain; Region: TrkA_C; pfam02080
261594012610	INT_SG3, DNA breaking-rejoining enzymes, integrase/recombinases subgroup 3, catalytic domain. The CD contains various predicted bacterial and phage integrase/recombinase sequences for which not much experimental characterization is available; Region: INT_SG3_C; cd01186
261594012611	Int/Topo IB signature motif; other site
261594012612	ABC-type antimicrobial peptide transport system, permease component [Defense mechanisms]; Region: SalY; COG0577
261594012613	FtsX-like permease family; Region: FtsX; pfam02687
261594012614	ABC-type antimicrobial peptide transport system, ATPase component [Defense mechanisms]; Region: SalX; COG1136
261594012615	ATP-binding cassette domain of the transporters involved in export of lipoprotein and macrolide, and cell division protein; Region: ABC_MJ0796_LolCDE_FtsE; cd03255
261594012616	Walker A/P-loop; other site
261594012617	ATP binding site [chemical binding]; other site
261594012618	Q-loop/lid; other site
261594012619	ABC transporter signature motif; other site
261594012620	Walker B; other site
261594012621	D-loop; other site
261594012622	H-loop/switch region; other site
261594012623	Protein of unknown function (DUF418); Region: DUF418; cl12135
261594012624	Protein of unknown function (DUF418); Region: DUF418; pfam04235
261594012625	Protein of unknown function (DUF2524); Region: DUF2524; pfam10732
261594012626	Predicted Fe-S oxidoreductase [General function prediction only]; Region: COG1242
261594012627	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
261594012628	FeS/SAM binding site; other site
261594012629	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594012630	S-adenosylmethionine binding site [chemical binding]; other site
261594012631	ABC-type multidrug transport system, ATPase component [Defense mechanisms]; Region: CcmA; COG1131
261594012632	ATP-binding cassette domain of the drug resistance transporter and related proteins, subfamily A; Region: ABC_DR_subfamily_A; cd03230
261594012633	Walker A/P-loop; other site
261594012634	ATP binding site [chemical binding]; other site
261594012635	Q-loop/lid; other site
261594012636	ABC transporter signature motif; other site
261594012637	Walker B; other site
261594012638	D-loop; other site
261594012639	H-loop/switch region; other site
261594012640	Asp/Glu/Hydantoin racemase; Region: Asp_Glu_race; cl00518
261594012641	aspartate racemase; Region: asp_race; TIGR00035
261594012642	Uncharacterized iron-regulated membrane protein [Function unknown]; Region: PiuB; COG3182
261594012643	PepSY-associated TM helix; Region: PepSY_TM_1; pfam13172
261594012644	PepSY-associated TM helix; Region: PepSY_TM_2; pfam13703
261594012645	Protein of unknown function (DUF2600); Region: DUF2600; pfam10776
261594012646	Putative lysophospholipase; Region: Hydrolase_4; pfam12146
261594012647	Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596
261594012648	Predicted hydrolase of the alpha/beta superfamily [General function prediction only]; Region: COG2819
261594012649	Carbonic anhydrases/acetyltransferases, isoleucine patch superfamily [General function prediction only]; Region: PaaY; COG0663
261594012650	Gamma carbonic anhydrase-like: This family is composed of gamma carbonic anhydrase (CA), Ferripyochelin Binding Protein (FBP), E. coli paaY protein, and similar proteins. CAs are zinc-containing enzymes that catalyze the reversible hydration of carbon...; Region: LbH_gamma_CA_like; cd04645
261594012651	trimer interface [polypeptide binding]; other site
261594012652	putative metal binding site [ion binding]; other site
261594012653	Membrane-associated phospholipid phosphatase [Lipid metabolism]; Region: PgpB; COG0671
261594012654	PAP2_like proteins, a super-family of histidine phosphatases and vanadium haloperoxidases, includes type 2 phosphatidic acid phosphatase or lipid phosphate phosphatase (LPP), Glucose-6-phosphatase, Phosphatidylglycerophosphatase B and bacterial acid...; Region: PAP2_like; cd01610
261594012655	active site
261594012656	Glycosyltransferase [Cell envelope biogenesis, outer membrane]; Region: RfaG; COG0438
261594012657	This family is most closely related to the GT1 family of glycosyltransferases. Glycosyltransferases catalyze the transfer of sugar moieties from activated donor molecules to specific acceptor molecules, forming glycosidic bonds. The acceptor molecule can...; Region: GT1_like_2; cd03814
261594012658	molybdopterin-guanine dinucleotide biosynthesis protein MobA; Reviewed; Region: mobA; PRK00317
261594012659	MobA catalyzes the formation of molybdopterin guanine dinucleotide; Region: MobA; cd02503
261594012660	GTP binding site; other site
261594012661	MogA_MoaB family. Members of this family are involved in biosynthesis of the molybdenum cofactor (MoCF) an essential cofactor of a diverse group of redox enzymes. MoCF biosynthesis is an evolutionarily conserved pathway present in eubacteria, archaea; Region: MogA_MoaB; cd00886
261594012662	MPT binding site; other site
261594012663	trimer interface [polypeptide binding]; other site
261594012664	S-adenosylmethionine synthetase; Validated; Region: PRK05250
261594012665	S-adenosylmethionine synthetase, N-terminal domain; Region: S-AdoMet_synt_N; pfam00438
261594012666	S-adenosylmethionine synthetase, central domain; Region: S-AdoMet_synt_M; pfam02772
261594012667	S-adenosylmethionine synthetase, C-terminal domain; Region: S-AdoMet_synt_C; pfam02773
261594012668	Phosphoenolpyruvate carboxykinase; Region: PEPCK_ATP; pfam01293
261594012669	Phosphoenolpyruvate carboxykinase (PEPCK), a critical gluconeogenic enzyme, catalyzes the first committed step in the diversion of tricarboxylic acid cycle intermediates toward gluconeogenesis. It catalyzes the reversible decarboxylation and...; Region: PEPCK_ATP; cd00484
261594012670	active site
261594012671	substrate-binding site [chemical binding]; other site
261594012672	metal-binding site [ion binding]
261594012673	ATP binding site [chemical binding]; other site
261594012674	ATP synthase I chain; Region: ATP_synt_I; pfam03899
261594012675	EamA-like transporter family; Region: EamA; pfam00892
261594012676	EamA-like transporter family; Region: EamA; pfam00892
261594012677	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4918
261594012678	Uncharacterized conserved protein [Function unknown]; Region: COG0327
261594012679	NIF3 (NGG1p interacting factor 3); Region: NIF3; pfam01784
261594012680	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594012681	ATP binding site [chemical binding]; other site
261594012682	Mg2+ binding site [ion binding]; other site
261594012683	G-X-G motif; other site
261594012684	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
261594012685	dimer interface [polypeptide binding]; other site
261594012686	phosphorylation site [posttranslational modification]
261594012687	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594012688	ATP binding site [chemical binding]; other site
261594012689	Mg2+ binding site [ion binding]; other site
261594012690	G-X-G motif; other site
261594012691	Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) [General function prediction only]; Region: MhpC; COG0596
261594012692	Putative lysophospholipase; Region: Hydrolase_4; pfam12146
261594012693	Protein of unknown function (DUF3986); Region: DUF3986; pfam13143
261594012694	ABC-type nitrate/sulfonate/bicarbonate transport systems, periplasmic components [Inorganic ion transport and metabolism]; Region: TauA; COG0715
261594012695	NMT1-like family; Region: NMT1_2; pfam13379
261594012696	ABC-type nitrate/sulfonate/bicarbonate transport system, ATPase component [Inorganic ion transport and metabolism]; Region: TauB; COG1116
261594012697	ATP-binding cassette domain of the nitrate and sulfonate transporters; Region: ABC_NrtD_SsuB_transporters; cd03293
261594012698	Walker A/P-loop; other site
261594012699	ATP binding site [chemical binding]; other site
261594012700	Q-loop/lid; other site
261594012701	ABC transporter signature motif; other site
261594012702	Walker B; other site
261594012703	D-loop; other site
261594012704	H-loop/switch region; other site
261594012705	ABC-type nitrate/sulfonate/bicarbonate transport system, permease component [Inorganic ion transport and metabolism]; Region: TauC; COG0600
261594012706	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
261594012707	dimer interface [polypeptide binding]; other site
261594012708	conserved gate region; other site
261594012709	putative PBP binding loops; other site
261594012710	ABC-ATPase subunit interface; other site
261594012711	Protein of unknown function (DUF3267); Region: DUF3267; pfam11667
261594012712	nucleoside triphosphatase YtkD; Region: nudix_YtkD; TIGR02705
261594012713	Members of the Nudix hydrolase superfamily catalyze the hydrolysis of NUcleoside DIphosphates linked to other moieties, X. Enzymes belonging to this superfamily require a divalent cation, such as Mg2+ or Mn2+, for their activity and contain a highly...; Region: Nudix_Hydrolase_8; cd04665
261594012714	nudix motif; other site
261594012715	Tumour necrosis factor receptor superfamily member 19; Region: RELT; pfam12606
261594012716	S-ribosylhomocysteinase; Provisional; Region: PRK02260
261594012717	Haemolytic domain; Region: Haemolytic; pfam01809
261594012718	Carbonic anhydrases (CA) are zinc-containing enzymes that catalyze the reversible hydration of carbon dioxide in a two-step mechanism in which the nucleophilic attack of a zinc-bound hydroxide ion on carbon dioxide is followed by the regeneration of an...; Region: beta_CA_cladeD; cd03379
261594012719	active site clefts [active]
261594012720	zinc binding site [ion binding]; other site
261594012721	dimer interface [polypeptide binding]; other site
261594012722	Bacterial Cytochrome Ubiquinol Oxidase; Region: Bac_Ubq_Cox; pfam01654
261594012723	Cytochrome oxidase subunit II; Region: Cyto_ox_2; pfam02322
261594012724	cytochrome d ubiquinol oxidase subunit 2; Provisional; Region: PRK15003; cl12219
261594012725	Spore germination protein gerPA/gerPF; Region: gerPA; pfam10676
261594012726	S-layer homology domain; Region: SLH; pfam00395
261594012727	S-layer homology domain; Region: SLH; pfam00395
261594012728	S-layer homology domain; Region: SLH; pfam00395
261594012729	Excalibur calcium-binding domain; Region: Excalibur; smart00894
261594012730	Uncharacterized conserved protein [Function unknown]; Region: COG1434
261594012731	YdcF-like. YdcF-like is a large family of mainly bacterial proteins, with a few members found in fungi, plants, and archaea. Escherichia coli YdcF has been shown to bind S-adenosyl-L-methionine (AdoMet), but a biochemical function has not been...; Region: YdcF-like; cd06259
261594012732	putative active site [active]
261594012733	Uncharacterized BCR, YitT family COG1284; Region: DUF161; pfam02588
261594012734	Uncharacterized conserved protein [Function unknown]; Region: COG1284
261594012735	Uncharacterized BCR, YitT family COG1284; Region: DUF161; pfam02588
261594012736	Uncharacterized protein conserved in bacteria (DUF2179); Region: DUF2179; pfam10035
261594012737	Domain of unknown function (DUF4247); Region: DUF4247; pfam14042
261594012738	Domain of unknown function (DUF4178); Region: DUF4178; pfam13785
261594012739	Predicted membrane protein [Function unknown]; Region: COG3766
261594012740	Phage shock protein A (IM30), suppresses sigma54-dependent transcription [Transcription / Signal transduction mechanisms]; Region: PspA; COG1842
261594012741	hypothetical protein; Provisional; Region: PRK12473
261594012742	Fe2+ transport system protein B [Inorganic ion transport and metabolism]; Region: FeoB; COG0370
261594012743	Ferrous iron transport protein B (FeoB) family; Region: FeoB; cd01879
261594012744	G1 box; other site
261594012745	GTP/Mg2+ binding site [chemical binding]; other site
261594012746	Switch I region; other site
261594012747	G2 box; other site
261594012748	G3 box; other site
261594012749	Switch II region; other site
261594012750	G4 box; other site
261594012751	G5 box; other site
261594012752	Nucleoside recognition; Region: Gate; pfam07670
261594012753	Ferrous iron transport protein B C terminus; Region: FeoB_C; pfam07664
261594012754	Nucleoside recognition; Region: Gate; pfam07670
261594012755	FeoA domain; Region: FeoA; pfam04023
261594012756	Thiamine transporter protein (Thia_YuaJ); Region: Thia_YuaJ; pfam09515
261594012757	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
261594012758	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
261594012759	dimerization interface [polypeptide binding]; other site
261594012760	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
261594012761	dimer interface [polypeptide binding]; other site
261594012762	phosphorylation site [posttranslational modification]
261594012763	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594012764	ATP binding site [chemical binding]; other site
261594012765	Mg2+ binding site [ion binding]; other site
261594012766	G-X-G motif; other site
261594012767	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
261594012768	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594012769	active site
261594012770	phosphorylation site [posttranslational modification]
261594012771	intermolecular recognition site; other site
261594012772	dimerization interface [polypeptide binding]; other site
261594012773	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
261594012774	DNA binding site [nucleotide binding]
261594012775	Sortase D (SrtD) is a membrane transpeptidase found in gram-positive bacteria that anchors surface proteins to peptidoglycans of the bacterial cell wall envelope. This involves a transpeptidation reaction in which the surface protein substrate is cleaved...; Region: Sortase_D_4; cd05828
261594012776	active site
261594012777	catalytic site [active]
261594012778	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
261594012779	active site
261594012780	Sphingosine kinase and enzymes related to eukaryotic diacylglycerol kinase [Lipid metabolism / General function prediction only]; Region: LCB5; COG1597
261594012781	Diacylglycerol kinase catalytic domain; Region: DAGK_cat; pfam00781
261594012782	PD-(D/E)XK nuclease family transposase; Region: PDDEXK_2; pfam12784
261594012783	conserved hypothetical protein (putative transposase or invertase); Region: T_den_put_tspse; TIGR01784
261594012784	Pyrabactin resistance 1 (PYR1), PYR1-like (PYL), regulatory component of abscisic acid receptors (RCARs), and related proteins; Region: PYR_PYL_RCAR_like; cd07821
261594012785	putative hydrophobic ligand binding site [chemical binding]; other site
261594012786	protein interface [polypeptide binding]; other site
261594012787	gate; other site
261594012788	Aldo/keto reductase family; Region: Aldo_ket_red; pfam00248
261594012789	Aldo-keto reductases (AKRs) are a superfamily of soluble NAD(P)(H) oxidoreductases whose chief purpose is to reduce aldehydes and ketones to primary and secondary alcohols. AKRs are present in all phyla and are of importance to both health and industrial...; Region: Aldo_ket_red; cd06660
261594012790	active site
261594012791	catalytic tetrad [active]
261594012792	Protein of unknown function (DUF1093); Region: DUF1093; pfam06486
261594012793	SNARE associated Golgi protein; Region: SNARE_assoc; cl00429
261594012794	Uncharacterized membrane-associated protein [Function unknown]; Region: DedA; COG0586
261594012795	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594012796	S-adenosylmethionine binding site [chemical binding]; other site
261594012797	ABC-type antimicrobial peptide transport system, permease component [Defense mechanisms]; Region: SalY; COG0577
261594012798	FtsX-like permease family; Region: FtsX; pfam02687
261594012799	ABC-type antimicrobial peptide transport system, ATPase component [Defense mechanisms]; Region: SalX; COG1136
261594012800	ATP-binding cassette domain of the transporters involved in export of lipoprotein and macrolide, and cell division protein; Region: ABC_MJ0796_LolCDE_FtsE; cd03255
261594012801	Walker A/P-loop; other site
261594012802	ATP binding site [chemical binding]; other site
261594012803	Q-loop/lid; other site
261594012804	ABC transporter signature motif; other site
261594012805	Walker B; other site
261594012806	D-loop; other site
261594012807	H-loop/switch region; other site
261594012808	helix_turn_helix, arabinose operon control protein; Region: HTH_ARAC; smart00342
261594012809	Bacterial regulatory helix-turn-helix proteins, AraC family; Region: HTH_AraC; pfam00165
261594012810	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3708
261594012811	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
261594012812	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594012813	active site
261594012814	phosphorylation site [posttranslational modification]
261594012815	intermolecular recognition site; other site
261594012816	dimerization interface [polypeptide binding]; other site
261594012817	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
261594012818	DNA binding site [nucleotide binding]
261594012819	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
261594012820	His Kinase A (phospho-acceptor) domain; Region: HisKA; pfam00512
261594012821	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594012822	ATP binding site [chemical binding]; other site
261594012823	Mg2+ binding site [ion binding]; other site
261594012824	G-X-G motif; other site
261594012825	FtsX-like permease family; Region: FtsX; pfam02687
261594012826	ABC-type antimicrobial peptide transport system, ATPase component [Defense mechanisms]; Region: SalX; COG1136
261594012827	ATP-binding cassette domain of the transporters involved in export of lipoprotein and macrolide, and cell division protein; Region: ABC_MJ0796_LolCDE_FtsE; cd03255
261594012828	Walker A/P-loop; other site
261594012829	ATP binding site [chemical binding]; other site
261594012830	Q-loop/lid; other site
261594012831	ABC transporter signature motif; other site
261594012832	Walker B; other site
261594012833	D-loop; other site
261594012834	H-loop/switch region; other site
261594012835	GntP family permease; Region: GntP_permease; pfam02447
261594012836	fructuronate transporter; Provisional; Region: PRK10034; cl15264
261594012837	Transcriptional regulators [Transcription]; Region: PhnF; COG2188
261594012838	Winged helix-turn-helix (WHTH) DNA-binding domain of the GntR family of transcriptional regulators; Region: WHTH_GntR; cd07377
261594012839	DNA-binding site [nucleotide binding]; DNA binding site
261594012840	UTRA domain; Region: UTRA; pfam07702
261594012841	Sugar kinases, ribokinase family [Carbohydrate transport and metabolism]; Region: RbsK; COG0524
261594012842	2-keto-3-deoxygluconate kinase (KdgK) phosphorylates 2-keto-3-deoxygluconate (KDG) to form 2-keto-3-deoxy-6-phosphogluconate (KDGP). KDG is the common intermediate product, that allows organisms to channel D-glucuronate and/or D-galacturinate into the...; Region: KdgK; cd01166
261594012843	substrate binding site [chemical binding]; other site
261594012844	ATP binding site [chemical binding]; other site
261594012845	conserved hypothetical protein EF_0839/AHA_3917; Region: EF_0839; TIGR03581
261594012846	uncharacterized pyridoxal phosphate-dependent enzyme; Region: selA_rel; TIGR01437
261594012847	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
261594012848	catalytic residue [active]
261594012849	probable amidohydrolase EF_0837/AHA_3915; Region: EF_0837; TIGR03583
261594012850	Metallo-dependent hydrolases, subgroup B is part of the superfamily of metallo-dependent hydrolases, a large group of proteins that show conservation in their 3-dimensional fold (TIM barrel) and in details of their active site. The vast majority of the...; Region: Met_dep_hydrolase_B; cd01307
261594012851	active site
261594012852	Protein of unknown function (DUF3986); Region: DUF3986; pfam13143
261594012853	D-alanyl-D-alanine carboxypeptidase [Cell envelope biogenesis, outer membrane]; Region: VanY; COG1876
261594012854	D-alanyl-D-alanine carboxypeptidase; Region: VanY; pfam02557
261594012855	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
261594012856	dimerization interface [polypeptide binding]; other site
261594012857	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
261594012858	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
261594012859	dimer interface [polypeptide binding]; other site
261594012860	phosphorylation site [posttranslational modification]
261594012861	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594012862	ATP binding site [chemical binding]; other site
261594012863	Mg2+ binding site [ion binding]; other site
261594012864	G-X-G motif; other site
261594012865	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
261594012866	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594012867	active site
261594012868	phosphorylation site [posttranslational modification]
261594012869	intermolecular recognition site; other site
261594012870	dimerization interface [polypeptide binding]; other site
261594012871	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
261594012872	DNA binding site [nucleotide binding]
261594012873	N-acylamino acid racemase (NAAAR), an octameric enzyme that catalyzes the racemization of N-acylamino acids. NAAARs act on a broad range of N-acylamino acids rather than amino acids. Enantiopure amino acids are of industrial interest as chiral building...; Region: NAAAR; cd03317
261594012874	o-succinylbenzoate synthase; Region: menC_lowGC/arch; TIGR01928
261594012875	active site
261594012876	octamer interface [polypeptide binding]; other site
261594012877	O-succinylbenzoic acid--CoA ligase; Provisional; Region: PRK03640
261594012878	O-succinylbenzoate-CoA ligase (also known as O-succinylbenzoate-CoA synthase, OSB-CoA synthetase, or MenE); Region: OSB_CoA_lg; cd05912
261594012879	acyl-activating enzyme (AAE) consensus motif; other site
261594012880	putative AMP binding site [chemical binding]; other site
261594012881	putative active site [active]
261594012882	putative CoA binding site [chemical binding]; other site
261594012883	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
261594012884	Enoyl-CoA hydratase/isomerase family; Region: ECH; pfam00378
261594012885	substrate binding site [chemical binding]; other site
261594012886	oxyanion hole (OAH) forming residues; other site
261594012887	trimer interface [polypeptide binding]; other site
261594012888	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase; Region: menH_SHCHC; TIGR03695
261594012889	Lipase.  Lipases are esterases that can hydrolyze long-chain acyl-triglycerides into di- and monoglycerides, glycerol, and free fatty acids at a water/lipid interface. A typical feature of lipases is "interfacial activation", the process of...; Region: Lipase; cl14883
261594012890	nucleophilic elbow; other site
261594012891	catalytic triad; other site
261594012892	2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1- carboxylate synthase; Validated; Region: PRK07449
261594012893	Pyrimidine (PYR) binding domain of 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexadiene-1- carboxylate synthase (MenD) and related proteins; Region: TPP_PYR_MenD; cd07037
261594012894	dimer interface [polypeptide binding]; other site
261594012895	tetramer interface [polypeptide binding]; other site
261594012896	PYR/PP interface [polypeptide binding]; other site
261594012897	TPP binding site [chemical binding]; other site
261594012898	Thiamine pyrophosphate (TPP) family, SHCHC synthase subfamily, TPP-binding module; composed of proteins similar to Escherichia coli 2-succinyl-6-hydroxyl-2,4-cyclohexadiene-1-carboxylic acid (SHCHC) synthase (also called MenD). SHCHC synthase plays a key...; Region: TPP_SHCHC_synthase; cd02009
261594012899	TPP-binding site; other site
261594012900	Isochorismate synthase [Coenzyme metabolism / Secondary metabolites biosynthesis, transport, and catabolism]; Region: MenF; COG1169
261594012901	chorismate binding enzyme; Region: Chorismate_bind; cl10555
261594012902	1,4-dihydroxy-2-naphthoate octaprenyltransferase; Validated; Region: PRK06080
261594012903	UbiA prenyltransferase family; Region: UbiA; pfam01040
261594012904	regulatory protein, yteA family; Region: bacill_yteA; TIGR02890
261594012905	Cold-Shock Protein (CSP) contains an S1-like cold-shock domain (CSD) that is found in eukaryotes, prokaryotes, and archaea.  CSP's include the major cold-shock proteins CspA and CspB in bacteria and the eukaryotic gene regulatory factor Y-box...; Region: CSP_CDS; cd04458
261594012906	DNA-binding site [nucleotide binding]; DNA binding site
261594012907	RNA-binding motif; other site
261594012908	Mitochondrial biogenesis AIM24; Region: AIM24; pfam01987
261594012909	Lipase (class 3).  Lipases are esterases that can hydrolyze long-chain acyl-triglycerides into di- and monoglycerides, glycerol, and free fatty acids at a water/lipid interface.  A typical feature of lipases is "interfacial activation," the...; Region: Lipase_3; cd00519
261594012910	active site flap/lid [active]
261594012911	nucleophilic elbow; other site
261594012912	catalytic triad [active]
261594012913	This is a family of oligosaccharide phosphorylases. It includes yeast and mammalian glycogen phosphorylases, plant starch/glucan phosphorylase, as well as the maltodextrin phosphorylases of bacteria. The members of this family catalyze the breakdown of...; Region: GT1_Glycogen_Phosphorylase; cd04300
261594012914	homodimer interface [polypeptide binding]; other site
261594012915	glycogen/starch/alpha-glucan phosphorylases; Region: P_ylase; TIGR02093
261594012916	active site pocket [active]
261594012917	glycogen synthase; Provisional; Region: glgA; PRK00654
261594012918	This family is most closely related to the GT1 family of glycosyltransferases. Glycogen synthase catalyzes the formation and elongation of the alpha-1,4-glucose backbone using ADP-glucose, the second and key step of glycogen biosynthesis. This family...; Region: GT1_Glycogen_synthase_DULL1_like; cd03791
261594012919	ADP-binding pocket [chemical binding]; other site
261594012920	homodimer interface [polypeptide binding]; other site
261594012921	glucose-1-phosphate adenylyltransferase, GlgD subunit; Region: glgD; TIGR02092
261594012922	ADP-glucose pyrophosphorylase is involved in the biosynthesis of glycogen or starch; Region: ADP_Glucose_PP; cd02508
261594012923	ligand binding site; other site
261594012924	oligomer interface; other site
261594012925	Glucose-1-phosphate adenylyltransferase, C-terminal Left-handed parallel beta helix (LbH) domain: Glucose-1-phosphate adenylyltransferase is also known as ADP-glucose synthase or ADP-glucose pyrophosphorylase. It catalyzes the first committed and...; Region: LbH_G1P_AT_C; cd04651
261594012926	dimer interface [polypeptide binding]; other site
261594012927	N-terminal domain interface [polypeptide binding]; other site
261594012928	glucose-1-phosphate adenylyltransferase; Provisional; Region: glgC; PRK05293
261594012929	ADP-glucose pyrophosphorylase is involved in the biosynthesis of glycogen or starch; Region: ADP_Glucose_PP; cd02508
261594012930	ligand binding site; other site
261594012931	oligomer interface; other site
261594012932	Glucose-1-phosphate adenylyltransferase, C-terminal Left-handed parallel beta helix (LbH) domain: Glucose-1-phosphate adenylyltransferase is also known as ADP-glucose synthase or ADP-glucose pyrophosphorylase. It catalyzes the first committed and...; Region: LbH_G1P_AT_C; cd04651
261594012933	dimer interface [polypeptide binding]; other site
261594012934	N-terminal domain interface [polypeptide binding]; other site
261594012935	sulfate 1 binding site; other site
261594012936	glycogen branching enzyme; Provisional; Region: PRK12313
261594012937	N-terminal Early set domain associated with the catalytic domain of prokaryotic glycogen branching enzyme; Region: E_set_GBE_prok_N; cd02855
261594012938	Alpha amylase catalytic domain found in the Glycogen branching enzyme (also called 1,4-alpha-glucan branching enzyme); Region: AmyAc_Glg_BE; cd11322
261594012939	active site
261594012940	catalytic site [active]
261594012941	Alpha amylase, C-terminal all-beta domain; Region: Alpha-amylase_C; pfam02806
261594012942	L-lactate dehydrogenase; Reviewed; Region: ldh; PRK00066
261594012943	L-2-hydroxyisocapronate dehydrogenases and some bacterial L-lactate dehydrogenases; Region: HicDH_like; cd05291
261594012944	tetramer (dimer of dimers) interface [polypeptide binding]; other site
261594012945	NAD binding site [chemical binding]; other site
261594012946	dimer interface [polypeptide binding]; other site
261594012947	substrate binding site [chemical binding]; other site
261594012948	Uncharacterized membrane protein [Function unknown]; Region: SapB; COG1285
261594012949	MgtC family; Region: MgtC; pfam02308
261594012950	Ion channel; Region: Ion_trans_2; pfam07885
261594012951	Kef-type K+ transport systems, predicted NAD-binding component [Inorganic ion transport and metabolism]; Region: Kch; COG1226
261594012952	TrkA-N domain; Region: TrkA_N; pfam02254
261594012953	YugN-like family; Region: YugN; pfam08868
261594012954	glucose-6-phosphate isomerase; Provisional; Region: pgi; PRK14097
261594012955	Phosphoglucose isomerase (PGI) contains two SIS (Sugar ISomerase) domains. This classification is based on the alignment of the first SIS domain. PGI is a multifunctional enzyme which as an intracellular dimer catalyzes the reversible isomerization of...; Region: SIS_PGI_1; cd05015
261594012956	active site
261594012957	dimer interface [polypeptide binding]; other site
261594012958	Phosphoglucose isomerase (PGI) contains two SIS (Sugar ISomerase) domains. This classification is based on the alignment of the second SIS domain. PGI is a multifunctional enzyme which as an intracellular dimer catalyzes the reversible isomerization of...; Region: SIS_PGI_2; cd05016
261594012959	dimer interface [polypeptide binding]; other site
261594012960	active site
261594012961	Domain of unknown function (DUF378); Region: DUF378; pfam04070
261594012962	general stress protein 13; Validated; Region: PRK08059
261594012963	S1_like: Ribosomal protein S1-like RNA-binding domain. Found in a wide variety of RNA-associated proteins. Originally identified in S1 ribosomal protein. This superfamily also contains the Cold Shock Domain (CSD), which is a homolog of the S1 domain; Region: S1_like; cl09927
261594012964	RNA binding site [nucleotide binding]; other site
261594012965	hypothetical protein; Validated; Region: PRK07682
261594012966	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
261594012967	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594012968	homodimer interface [polypeptide binding]; other site
261594012969	catalytic residue [active]
261594012970	Transcriptional regulators [Transcription]; Region: Lrp; COG1522
261594012971	AsnC family; Region: AsnC_trans_reg; pfam01037
261594012972	bifunctional glyoxylate/hydroxypyruvate reductase B; Provisional; Region: PRK15409
261594012973	D-glycerate dehydrogenase/hydroxypyruvate reductase (GDH); Region: GDH; cd05301
261594012974	dimerization interface [polypeptide binding]; other site
261594012975	ligand binding site [chemical binding]; other site
261594012976	NADP binding site [chemical binding]; other site
261594012977	catalytic site [active]
261594012978	Lipase.  Lipases are esterases that can hydrolyze long-chain acyl-triglycerides into di- and monoglycerides, glycerol, and free fatty acids at a water/lipid interface. A typical feature of lipases is "interfacial activation", the process of...; Region: Lipase; cl14883
261594012979	Alpha/beta hydrolase family; Region: Abhydrolase_6; pfam12697
261594012980	nucleophilic elbow; other site
261594012981	catalytic triad; other site
261594012982	Domain of unknown function (DUF1871); Region: DUF1871; pfam08958
261594012983	Bifunctional PLP-dependent enzyme with beta-cystathionase and maltose regulon repressor activities [Amino acid transport and metabolism]; Region: MalY; COG1168
261594012984	Aspartate aminotransferase family. This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). Pyridoxal phosphate combines with an alpha-amino acid to form a compound called a Schiff base or aldimine...; Region: AAT_like; cd00609
261594012985	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594012986	homodimer interface [polypeptide binding]; other site
261594012987	catalytic residue [active]
261594012988	Cu/Zn superoxide dismutase [Inorganic ion transport and metabolism]; Region: SodC; COG2032
261594012989	Copper/zinc superoxide dismutase (SOD). superoxide dismutases catalyse the conversion of superoxide radicals to molecular oxygen. Three evolutionarily distinct families of SODs are known, of which the copper/zinc-binding family is one. Defects in the...; Region: Cu-Zn_Superoxide_Dismutase; cd00305
261594012990	E-class dimer interface [polypeptide binding]; other site
261594012991	P-class dimer interface [polypeptide binding]; other site
261594012992	active site
261594012993	Cu2+ binding site [ion binding]; other site
261594012994	Zn2+ binding site [ion binding]; other site
261594012995	Protein of unknown function (DUF2681); Region: DUF2681; pfam10883
261594012996	Kinase associated protein B; Region: KapB; pfam08810
261594012997	DEDDh 3'-5' exonuclease domain of Caenorhabditis elegans ERI-1, human 3' exonuclease, and similar proteins; Region: ERI-1_3'hExo_like; cd06133
261594012998	active site
261594012999	catalytic site [active]
261594013000	substrate binding site [chemical binding]; other site
261594013001	Na+/H+ antiporter NhaD and related arsenite permeases [Inorganic ion transport and metabolism]; Region: ArsB; COG1055
261594013002	Permease P (pink-eyed dilution). Mutations in the human melanosomal P gene were responsible for classic phenotype of oculocutaneous albinism type 2 (OCA2). Although the precise function of the P protein is unknown, it was predicted to regulate the...; Region: P_permease; cd01116
261594013003	transmembrane helices; other site
261594013004	DNA alkylation repair enzyme; Region: DNA_alkylation; pfam08713
261594013005	A new structural DNA glycosylase containing HEAT-like repeats; Region: AlkD_like_1; cd07064
261594013006	active site
261594013007	glycyl-tRNA synthetase; Provisional; Region: PRK04173
261594013008	Class II tRNA amino-acyl synthetase-like catalytic core domain. Class II amino acyl-tRNA synthetases (aaRS) share a common fold and generally attach an amino acid to the 3' OH of ribose of the appropriate tRNA.   PheRS is an exception in that it...; Region: class_II_aaRS-like_core; cl00268
261594013009	motif 1; other site
261594013010	Glycyl-tRNA synthetase (GlyRS)-like class II core catalytic domain. GlyRS functions as a homodimer in eukaryotes, archaea and some bacteria and as a heterotetramer in the remainder of prokaryotes. It is responsible for the attachment of glycine to the 3...; Region: GlyRS-like_core; cd00774
261594013011	active site
261594013012	motif 2; other site
261594013013	motif 3; other site
261594013014	GlyRS Glycyl-anticodon binding domain. GlyRS belongs to class II aminoacyl-tRNA synthetases (aaRS). This alignment contains the anticodon binding domain, which is responsible for specificity in tRNA-binding, so that the activated amino acid is...; Region: GlyRS_anticodon; cd00858
261594013015	anticodon binding site; other site
261594013016	PaaI_thioesterase is a tetrameric acyl-CoA thioesterase with a hot dog fold and one of several proteins responsible for phenylacetic acid (PA) degradation in bacteria.  Although orthologs of PaaI exist in archaea and eukaryotes, their function has not...; Region: PaaI_thioesterase; cd03443
261594013017	CoenzymeA binding site [chemical binding]; other site
261594013018	subunit interaction site [polypeptide binding]; other site
261594013019	PHB binding site; other site
261594013020	Domain of unknown function (DUF4163); Region: DUF4163; pfam13739
261594013021	Protein of unknown function (DUF3298); Region: DUF3298; pfam11738
261594013022	Uncharacterized conserved protein [General function prediction only]; Region: BioY; COG1268
261594013023	Prokaryotic UGPase catalyses the synthesis of UDP-glucose; Region: UGPase_prokaryotic; cd02541
261594013024	dTDP-glucose pyrophosphorylase [Cell envelope biogenesis, outer membrane]; Region: RfbA; COG1209
261594013025	active site
261594013026	tetramer interface; other site
261594013027	phosphoglucomutase-2-like protein; Provisional; Region: PTZ00150
261594013028	This CD includes PGM2 (phosphoglucomutase 2) and PGM2L1 (phosphoglucomutase 2-like 1). The mammalian PGM2 is thought to be a phosphopentomutase that catalyzes the conversion of the nucleoside breakdown products, ribose-1-phosphate and...; Region: PGM2; cd05799
261594013029	active site
261594013030	substrate binding site [chemical binding]; other site
261594013031	metal binding site [ion binding]; metal-binding site
261594013032	Bacterial membrane-spanning protein N-terminus; Region: YojJ; pfam10372
261594013033	Uncharacterized conserved protein [Function unknown]; Region: COG1624
261594013034	DisA bacterial checkpoint controller nucleotide-binding; Region: DisA_N; pfam02457
261594013035	multifunctional aminopeptidase A; Provisional; Region: PRK00913
261594013036	Cytosol aminopeptidase family, N-terminal and catalytic domains.  Family M17 contains zinc- and manganese-dependent exopeptidases ( EC  3.4.11.1), including leucine aminopeptidase. They catalyze removal of amino acids from the N-terminus of a protein and...; Region: Peptidase_M17; cd00433
261594013037	interface (dimer of trimers) [polypeptide binding]; other site
261594013038	Substrate-binding/catalytic site; other site
261594013039	Zn-binding sites [ion binding]; other site
261594013040	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3584
261594013041	Putative membrane protein; Region: YuiB; pfam14068
261594013042	Nudix hydrolase is a superfamily of enzymes found in all three kingdoms of life, and it catalyzes the hydrolysis of NUcleoside DIphosphates linked to other moieties, X. Enzymes belonging to this superfamily require a divalent cation, such as Mg2+ or Mn2+...; Region: Nudix_Hydrolase; cd02883
261594013043	nudix motif; other site
261594013044	NADH dehydrogenase, FAD-containing subunit [Energy production and conversion]; Region: Ndh; COG1252
261594013045	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
261594013046	Thioredoxin reductase [Posttranslational modification, protein turnover, chaperones]; Region: TrxB; COG0492
261594013047	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
261594013048	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
261594013049	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3708
261594013050	H+ Antiporter protein; Region: 2A0121; TIGR00900
261594013051	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594013052	putative substrate translocation pore; other site
261594013053	Helix-turn-helix domain; Region: HTH_36; pfam13730
261594013054	Transcriptional regulators [Transcription]; Region: Lrp; COG1522
261594013055	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cl17220
261594013056	putative DNA binding site [nucleotide binding]; other site
261594013057	dimerization interface [polypeptide binding]; other site
261594013058	Protein of unknown function (DUF523); Region: DUF523; pfam04463
261594013059	Protein of unknown function (DUF1093); Region: DUF1093; pfam06486
261594013060	Acetyltransferases, including N-acetylases of ribosomal proteins [Translation, ribosomal structure and biogenesis]; Region: RimL; COG1670
261594013061	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cl17182
261594013062	Fe-S cluster assembly scaffold protein [Posttranslational modification, protein turnover, chaperones]; Region: sufA; COG0316
261594013063	diaminopimelate epimerase; Provisional; Region: dapF; PRK00450
261594013064	Diaminopimelate epimerase; Region: DAP_epimerase; pfam01678
261594013065	Diaminopimelate epimerase; Region: DAP_epimerase; pfam01678
261594013066	hypothetical protein; Provisional; Region: PRK13669
261594013067	NADH dehydrogenase, FAD-containing subunit [Energy production and conversion]; Region: Ndh; COG1252
261594013068	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
261594013069	Spo0E like sporulation regulatory protein; Region: SpoOE-like; pfam09388
261594013070	ABC-type antimicrobial peptide transport system, ATPase component [Defense mechanisms]; Region: SalX; COG1136
261594013071	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
261594013072	Walker A/P-loop; other site
261594013073	ATP binding site [chemical binding]; other site
261594013074	Q-loop/lid; other site
261594013075	ABC transporter signature motif; other site
261594013076	Walker B; other site
261594013077	D-loop; other site
261594013078	H-loop/switch region; other site
261594013079	ABC-type uncharacterized transport system, permease component [General function prediction only]; Region: COG0390
261594013080	Uncharacterized Zn-ribbon-containing protein involved in phosphonate metabolism [Inorganic ion transport and metabolism]; Region: PhnA; COG2824
261594013081	PhnA Zinc-Ribbon; Region: PhnA_Zn_Ribbon; pfam08274
261594013082	PhnA protein; Region: PhnA; pfam03831
261594013083	Protein of unknown function (DUF2628); Region: DUF2628; pfam10947
261594013084	PQQ-dependent dehydrogenases and related proteins; Region: PQQ_DH_like; cl11493
261594013085	PQQ-like domain; Region: PQQ_2; pfam13360
261594013086	PQQ-dependent dehydrogenases and related proteins; Region: PQQ_DH_like; cl11493
261594013087	SMI1 / KNR4 family (SUKH-1); Region: SMI1_KNR4; pfam09346
261594013088	Domain of unknown function (DUF4304); Region: DUF4304; pfam14137
261594013089	CAAX protease self-immunity; Region: Abi; pfam02517
261594013090	Nucleotidyltransferase (NT) domain of Staphylococcus aureus kanamycin nucleotidyltransferase, and similar proteins; Region: NT_KNTase_like; cd05403
261594013091	active site
261594013092	NTP binding site [chemical binding]; other site
261594013093	metal binding triad [ion binding]; metal-binding site
261594013094	Domain of unknown function (DUF4111); Region: DUF4111; pfam13427
261594013095	Protein of unknown function (DUF1462); Region: DUF1462; pfam07315
261594013096	NifU-like domain; Region: NifU; pfam01106
261594013097	spore coat protein YutH; Region: spore_yutH; TIGR02905
261594013098	Phosphatidylglycerophosphatase A; a bacterial membrane-associated enzyme involved in lipid metabolism; Region: PgpA; cd06971
261594013099	tetramer interfaces [polypeptide binding]; other site
261594013100	binuclear metal-binding site [ion binding]; other site
261594013101	Acetyltransferase (GNAT) domain; Region: Acetyltransf_4; pfam13420
261594013102	Putative NADPH-quinone reductase (modulator of drug activity B) [General function prediction only]; Region: MdaB; COG2249
261594013103	NADPH-dependent FMN reductase; Region: FMN_red; pfam03358
261594013104	HAD-superfamily subfamily IIA hydrolase, TIGR01457; Region: HAD-SF-IIA-hyp2
261594013105	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
261594013106	active site
261594013107	motif I; other site
261594013108	motif II; other site
261594013109	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
261594013110	Predicted transcriptional regulator [Transcription]; Region: COG2345
261594013111	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
261594013112	putative Zn2+ binding site [ion binding]; other site
261594013113	putative DNA binding site [nucleotide binding]; other site
261594013114	Phosphofructokinase, a key regulatory enzyme in glycolysis, catalyzes the phosphorylation of fructose-6-phosphate to fructose-1,6-biphosphate. The members belong to PFK family that includes ATP- and pyrophosphate (PPi)- dependent phosphofructokinases; Region: PFK; cl00204
261594013115	Uncharacterized conserved protein [Function unknown]; Region: COG2445
261594013116	Bacterial fructose-1,6-bisphosphatase, glpX-encoded. A dimeric enzyme dependent on Mg(2+). glpX-encoded FPBase (FBPase class II) differs from other members of the inositol-phosphatase superfamily by permutation of secondary structure elements. The core...; Region: FBPase_glpX; cd01516
261594013117	Bacterial fructose-1,6-bisphosphatase, glpX-encoded; Region: FBPase_glpX; pfam03320
261594013118	putative active site [active]
261594013119	Protein of unknown function (DUF3055); Region: DUF3055; pfam11256
261594013120	Protein of unknown function (DUF1027); Region: DUF1027; pfam06265
261594013121	Sporulation lipoprotein YhcN/YlaJ (Spore_YhcN_YlaJ); Region: Spore_YhcN_YlaJ; pfam09580
261594013122	Helix-Turn-Helix DNA binding domain of the transcription regulators TipAL, Mta, and SkgA; Region: HTH_TipAL-Mta; cd01106
261594013123	MerR HTH family regulatory protein; Region: MerR_1; pfam13411
261594013124	DNA binding residues [nucleotide binding]
261594013125	dimer interface [polypeptide binding]; other site
261594013126	TipAS antibiotic-recognition domain; Region: TipAS; pfam07739
261594013127	Putative membrane peptidase family (DUF2324); Region: DUF2324; pfam10086
261594013128	Histidine phosphatase domain found in phosphoglycerate mutases and related proteins, mostly phosphatases; contains a His residue which is phosphorylated during the reaction; Region: HP_PGM_like; cd07067
261594013129	catalytic core [active]
261594013130	YbaK-like.  The YbaK family of deacylase domains includes the INS amino acid-editing domain of  the bacterial class II prolyl tRNA synthetase (ProRS), and it's trans-acting homologs, YbaK, ProX, and PrdX. The primary function of INS is to hydrolyze...; Region: YbaK_like; cd04332
261594013131	putative deacylase active site [active]
261594013132	lipoyl synthase; Provisional; Region: PRK05481
261594013133	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
261594013134	FeS/SAM binding site; other site
261594013135	Membrane proteins related to metalloendopeptidases [Cell envelope biogenesis, outer membrane]; Region: NlpD; COG0739
261594013136	Peptidase family M23; Region: Peptidase_M23; pfam01551
261594013137	sporulation protein YunB; Region: spo_yunB; TIGR02832
261594013138	Uncharacterized conserved protein [Function unknown]; Region: COG3377
261594013139	Escherichia coli UshA-like family, N-terminal metallophosphatase domain; Region: MPP_UshA_N_like; cd00845
261594013140	5'-nucleotidase/2',3'-cyclic phosphodiesterase and related esterases [Nucleotide transport and metabolism]; Region: UshA; COG0737
261594013141	active site
261594013142	metal binding site [ion binding]; metal-binding site
261594013143	5'-nucleotidase, C-terminal domain; Region: 5_nucleotid_C; pfam02872
261594013144	Predicted membrane protein (DUF2207); Region: DUF2207; pfam09972
261594013145	Predicted transcriptional regulators [Transcription]; Region: COG1695
261594013146	Transcriptional regulator PadR-like family; Region: PadR; cl17335
261594013147	VanZ like family; Region: VanZ; pfam04892
261594013148	cysteine desulfurase activator complex subunit SufB; Provisional; Region: PRK11814; cl03223
261594013149	FeS assembly protein SufB; Region: sufB; TIGR01980
261594013150	NifU homolog involved in Fe-S cluster formation [Energy production and conversion]; Region: IscU; COG0822
261594013151	Iron-sulfur cluster scaffold-like proteins; Region: IscU_like; cd06664
261594013152	trimerization site [polypeptide binding]; other site
261594013153	active site
261594013154	Selenocysteine lyase/Cysteine desulfurase [Posttranslational modification, protein turnover, chaperones]; Region: csdA; COG0520
261594013155	Cysteine desulfurase (SufS)-like. This family belongs to the pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). The major groups in this CD correspond to cysteine desulfurase (SufS) and selenocysteine lyase. SufS...; Region: SufS_like; cd06453
261594013156	pyridoxal 5'-phosphate binding pocket [chemical binding]; other site
261594013157	catalytic residue [active]
261594013158	cysteine desulfurase activator complex subunit SufB; Provisional; Region: PRK11814; cl03223
261594013159	Cysteine desulfurase activator SufB [Posttranslational modification, protein turnover, chaperones]; Region: SufB; COG0719
261594013160	FeS assembly protein SufD; Region: sufD; TIGR01981
261594013161	Cysteine desulfurase activator ATPase [Posttranslational modification, protein turnover, chaperones]; Region: sufC; COG0396
261594013162	ABC-type transport system involved in Fe-S cluster assembly, ATPase component; Region: ABC_FeS_Assembly; cd03217
261594013163	Walker A/P-loop; other site
261594013164	ATP binding site [chemical binding]; other site
261594013165	Q-loop/lid; other site
261594013166	ABC transporter signature motif; other site
261594013167	Walker B; other site
261594013168	D-loop; other site
261594013169	H-loop/switch region; other site
261594013170	ABC-type metal ion transport system, periplasmic component/surface antigen [Inorganic ion transport and metabolism]; Region: NlpA; COG1464
261594013171	NLPA lipoprotein; Region: Lipoprotein_9; pfam03180
261594013172	ABC-type metal ion transport system, periplasmic component/surface antigen [Inorganic ion transport and metabolism]; Region: NlpA; COG1464
261594013173	NLPA lipoprotein; Region: Lipoprotein_9; pfam03180
261594013174	Transmembrane subunit (TM) found in Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters which generally bind type 2 PBPs. These types of transporters consist of a PBP, two TMs, and two cytoplasmic ABC ATPase subunits, and...; Region: TM_PBP2; cd06261
261594013175	ABC-ATPase subunit interface; other site
261594013176	ABC-type metal ion transport system, ATPase component [Inorganic ion transport and metabolism]; Region: AbcC; COG1135
261594013177	ATP-binding cassette domain of methionine transporter; Region: ABC_MetN_methionine_transporter; cd03258
261594013178	Walker A/P-loop; other site
261594013179	ATP binding site [chemical binding]; other site
261594013180	Q-loop/lid; other site
261594013181	ABC transporter signature motif; other site
261594013182	Walker B; other site
261594013183	D-loop; other site
261594013184	H-loop/switch region; other site
261594013185	This domain is found at the C-terminus of ABC transporter proteins involved in D-methionine transport as well as a number of ferredoxin-like proteins; Region: NIL; smart00930
261594013186	TRX family; composed of two groups: Group I, which includes proteins that exclusively encode a TRX domain; and Group II, which are composed of fusion proteins of TRX and additional domains. Group I TRX is a small ancient protein that alter the redox...; Region: TRX_family; cd02947
261594013187	catalytic residues [active]
261594013188	TOPRIM_ RNase M5_like: The topoisomerase-primase (TOPRIM) nucleotidyl transferase/hydrolase domain found in Ribonuclease M5: (RNase M5) and other small primase-like proteins from bacteria and archaea.  RNase M5 catalyzes the maturation of 5S rRNA in low...; Region: TOPRIM_RNase_M5_like; cd01027
261594013189	putative active site [active]
261594013190	putative metal binding site [ion binding]; other site
261594013191	Glycine cleavage H-protein. Glycine cleavage H-proteins are part of the glycine cleavage system (GCS) found in bacteria, archea and the mitochondria of eukaryotes. GCS is a multienzyme complex consisting of 4 different components (P-, H-, T- and...; Region: GCS_H; cd06848
261594013192	lipoyl attachment site [posttranslational modification]; other site
261594013193	Arsenate Reductase (ArsC) family, unknown subfamily; uncharacterized proteins containing a CXXC motif with similarity to thioredoxin (TRX)-fold arsenic reductases, ArsC. Proteins containing a redox active CXXC motif like TRX and glutaredoxin (GRX)...; Region: ArsC_like; cd03036
261594013194	ArsC family; Region: ArsC; pfam03960
261594013195	putative ArsC-like catalytic residues; other site
261594013196	putative TRX-like catalytic residues [active]
261594013197	Protein of unknown function (DUF3937); Region: DUF3937; pfam13073
261594013198	PAP2_like proteins, Aur1_like subfamily. Yeast Aur1p or Ipc1p is necessary for the addition of inositol phosphate to ceramide, an essential step in yeast sphingolipid synthesis, and is the target of several antifungal compounds such as aureobasidin; Region: PAP2_Aur1_like; cd03386
261594013199	active site
261594013200	Predicted membrane protein, putative toxin regulator [General function prediction only]; Region: PfoR; COG3641
261594013201	Phosphotransferase system, EIIC; Region: PTS_EIIC_2; pfam13303
261594013202	L-lactate dehydrogenase; Reviewed; Region: ldh; PRK00066
261594013203	L-2-hydroxyisocapronate dehydrogenases and some bacterial L-lactate dehydrogenases; Region: HicDH_like; cd05291
261594013204	tetramer (dimer of dimers) interface [polypeptide binding]; other site
261594013205	NAD binding site [chemical binding]; other site
261594013206	dimer interface [polypeptide binding]; other site
261594013207	substrate binding site [chemical binding]; other site
261594013208	Coat F domain; Region: Coat_F; pfam07875
261594013209	CAAX protease self-immunity; Region: Abi; pfam02517
261594013210	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
261594013211	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
261594013212	WHG domain; Region: WHG; pfam13305
261594013213	Metallo-beta-lactamase superfamily; Region: Lactamase_B; smart00849
261594013214	Acyl-CoA dehydrogenase; Region: ACAD; cl09933
261594013215	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
261594013216	active site
261594013217	acetyl-CoA acetyltransferase; Provisional; Region: PRK07661
261594013218	Thiolase are ubiquitous enzymes that catalyze the reversible thiolytic cleavage of 3-ketoacyl-CoA into acyl-CoA and acetyl-CoA, a 2-step reaction involving a covalent intermediate formed with a catalytic cysteine. They are found in prokaryotes and...; Region: thiolase; cd00751
261594013219	dimer interface [polypeptide binding]; other site
261594013220	active site
261594013221	3-hydroxyacyl-CoA dehydrogenase [Lipid metabolism]; Region: FadB; COG1250
261594013222	3-hydroxyacyl-CoA dehydrogenase, NAD binding domain; Region: 3HCDH_N; pfam02737
261594013223	3-hydroxyacyl-CoA dehydrogenase, C-terminal domain; Region: 3HCDH; pfam00725
261594013224	3-hydroxyacyl-CoA dehydrogenase, C-terminal domain; Region: 3HCDH; pfam00725
261594013225	Crotonase/Enoyl-Coenzyme A (CoA) hydratase superfamily. This superfamily contains a diverse set of enzymes including enoyl-CoA hydratase, napthoate synthase, methylmalonyl-CoA decarboxylase, 3-hydoxybutyryl-CoA dehydratase, and dienoyl-CoA isomerase; Region: crotonase-like; cd06558
261594013226	Enoyl-CoA hydratase/carnithine racemase [Lipid metabolism]; Region: CaiD; COG1024
261594013227	substrate binding site [chemical binding]; other site
261594013228	oxyanion hole (OAH) forming residues; other site
261594013229	YuzL-like protein; Region: YuzL; pfam14115
261594013230	Beta-lactamase enzyme family; Region: Beta-lactamase2; cl17872
261594013231	D-alanyl-D-alanine carboxypeptidase; Region: Peptidase_S11; pfam00768
261594013232	Proline dehydrogenase; Region: Pro_dh; cl03282
261594013233	Protein of unknown function (DUF2573); Region: DUF2573; pfam10835
261594013234	Domain of unknown function DUF77; Region: DUF77; pfam01910
261594013235	Cache domain; Region: Cache_1; pfam02743
261594013236	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
261594013237	dimerization interface [polypeptide binding]; other site
261594013238	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
261594013239	Methyl-accepting chemotaxis-like domains (chemotaxis sensory transducer); Region: MA; smart00283
261594013240	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
261594013241	dimer interface [polypeptide binding]; other site
261594013242	putative CheW interface [polypeptide binding]; other site
261594013243	Predicted transcriptional regulators [Transcription]; Region: COG1378
261594013244	Sugar-specific transcriptional regulator TrmB; Region: TrmB; pfam01978
261594013245	Middle phospholipase D-like domain of the transcriptional regulator TrmB and similar proteins; Region: PLDc_like_TrmB_middle; cd09124
261594013246	C-terminal domain interface [polypeptide binding]; other site
261594013247	sugar binding site [chemical binding]; other site
261594013248	TQXA domain; Region: TQXA_dom; TIGR03934
261594013249	Cna protein B-type domain; Region: Cna_B; pfam05738
261594013250	Cna protein B-type domain; Region: Cna_B; pfam05738
261594013251	Cna protein B-type domain; Region: Cna_B; pfam05738
261594013252	Arabinose efflux permease [Carbohydrate transport and metabolism]; Region: AraJ; COG2814
261594013253	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594013254	putative substrate translocation pore; other site
261594013255	putative fructoselysine transporter; Provisional; Region: frlA; PRK11357
261594013256	Spore germination protein; Region: Spore_permease; cl17796
261594013257	MAEBL; Provisional; Region: PTZ00121
261594013258	OxaA-like protein precursor; Validated; Region: PRK01622
261594013259	Uncharacterized conserved protein [Function unknown]; Region: COG1284
261594013260	Uncharacterized BCR, YitT family COG1284; Region: DUF161; pfam02588
261594013261	Uncharacterized protein conserved in bacteria (DUF2179); Region: DUF2179; pfam10035
261594013262	hypothetical protein; Provisional; Region: PRK06758
261594013263	Site-2 protease (S2P) class of zinc metalloproteases (MEROPS family M50) cleaves transmembrane domains of substrate proteins, regulating intramembrane proteolysis (RIP) of diverse signal transduction mechanisms. Members of this family use proteolytic...; Region: S2P-M50; cd05709
261594013264	active site
261594013265	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
261594013266	non-specific DNA binding site [nucleotide binding]; other site
261594013267	salt bridge; other site
261594013268	sequence-specific DNA binding site [nucleotide binding]; other site
261594013269	Uncharacterized membrane-associated protein [Function unknown]; Region: DedA; COG0586
261594013270	SNARE associated Golgi protein; Region: SNARE_assoc; pfam09335
261594013271	Protein of unknown function (DUF3978); Region: DUF3978; pfam13123
261594013272	Uncharacterized protein conserved in bacteria [Function unknown]; Region: ErfK; COG1376
261594013273	L,D-transpeptidase catalytic domain; Region: YkuD; pfam03734
261594013274	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
261594013275	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594013276	active site
261594013277	phosphorylation site [posttranslational modification]
261594013278	intermolecular recognition site; other site
261594013279	dimerization interface [polypeptide binding]; other site
261594013280	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
261594013281	DNA binding site [nucleotide binding]
261594013282	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
261594013283	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
261594013284	dimer interface [polypeptide binding]; other site
261594013285	phosphorylation site [posttranslational modification]
261594013286	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594013287	ATP binding site [chemical binding]; other site
261594013288	Mg2+ binding site [ion binding]; other site
261594013289	G-X-G motif; other site
261594013290	Permeases of the drug/metabolite transporter (DMT) superfamily [Carbohydrate transport and metabolism / Amino acid transport and metabolism / General function prediction only]; Region: RhaT; COG0697
261594013291	methionyl-tRNA synthetase; Reviewed; Region: PRK12268
261594013292	catalytic core domain of methioninyl-tRNA synthetases; Region: MetRS_core; cd00814
261594013293	active site
261594013294	HIGH motif; other site
261594013295	KMSKS motif; other site
261594013296	Anticodon-binding domain of methionyl tRNA synthetases; Region: Anticodon_Ia_Met; cd07957
261594013297	tRNA binding surface [nucleotide binding]; other site
261594013298	anticodon binding site; other site
261594013299	Methyltransferase domain; Region: Methyltransf_23; pfam13489
261594013300	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594013301	S-adenosylmethionine binding site [chemical binding]; other site
261594013302	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
261594013303	dimerization interface [polypeptide binding]; other site
261594013304	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
261594013305	dimer interface [polypeptide binding]; other site
261594013306	Methyl-accepting chemotaxis-like domains (chemotaxis sensory transducer); Region: MA; smart00283
261594013307	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
261594013308	dimer interface [polypeptide binding]; other site
261594013309	putative CheW interface [polypeptide binding]; other site
261594013310	Predicted metal-sulfur cluster biosynthetic enzyme [General function prediction only]; Region: PaaD; COG2151
261594013311	Zinc metalloprotease (elastase) [Amino acid transport and metabolism]; Region: LasB; COG3227
261594013312	Fungalysin/Thermolysin Propeptide Motif; Region: FTP; pfam07504
261594013313	Peptidase propeptide and YPEB domain; Region: PepSY; pfam03413
261594013314	Peptidase M4 family includes thermolysin, protealysin, aureolysin and neutral protease; Region: M4_neutral_protease; cd09597
261594013315	active site
261594013316	Zn binding site [ion binding]; other site
261594013317	Pirin-related protein [General function prediction only]; Region: COG1741
261594013318	Pirin; Region: Pirin; pfam02678
261594013319	helix_turn_helix multiple antibiotic resistance protein; Region: HTH_MARR; smart00347
261594013320	MarR family; Region: MarR_2; pfam12802
261594013321	Protein of unknown function (DUF3920); Region: DUF3920; pfam13058
261594013322	Kef-type K+ transport systems, membrane components [Inorganic ion transport and metabolism]; Region: KefB; COG0475
261594013323	Sodium/hydrogen exchanger family; Region: Na_H_Exchanger; pfam00999
261594013324	Putative regulatory, ligand-binding protein related to C-terminal domains of K+ channels [Inorganic ion transport and metabolism]; Region: COG0490
261594013325	TrkA-C domain; Region: TrkA_C; pfam02080
261594013326	Na+/alanine symporter [Amino acid transport and metabolism]; Region: AlsT; COG1115
261594013327	amino acid carrier protein; Region: agcS; TIGR00835
261594013328	DNA-binding ferritin-like protein (oxidative damage protectant) [Inorganic ion transport and metabolism]; Region: Dps; COG0783
261594013329	DPS protein, ferritin-like diiron-binding domain; Region: DPS; cd01043
261594013330	dimerization interface [polypeptide binding]; other site
261594013331	DPS ferroxidase diiron center [ion binding]; other site
261594013332	ion pore; other site
261594013333	Possible lysine decarboxylase; Region: Lysine_decarbox; cl00695
261594013334	Nucleoside Triphosphate Pyrophosphohydrolase (EC 3.6.1.8) MazG-like domain superfamily; Region: NTP-PPase; cd11523
261594013335	metal binding site [ion binding]; metal-binding site
261594013336	nonheme-containing ferritins; Region: Nonheme_Ferritin; cd01055
261594013337	Ferritin-like domain; Region: Ferritin; pfam00210
261594013338	ferroxidase diiron center [ion binding]; other site
261594013339	Nucleoside permease [Nucleotide transport and metabolism]; Region: NupC; COG1972
261594013340	Na+ dependent nucleoside transporter N-terminus; Region: Nucleos_tra2_N; pfam01773
261594013341	Na+ dependent nucleoside transporter C-terminus; Region: Nucleos_tra2_C; pfam07662
261594013342	Nucleoside permease [Nucleotide transport and metabolism]; Region: NupC; COG1972
261594013343	Na+ dependent nucleoside transporter N-terminus; Region: Nucleos_tra2_N; pfam01773
261594013344	Nucleoside recognition; Region: Gate; pfam07670
261594013345	Na+ dependent nucleoside transporter C-terminus; Region: Nucleos_tra2_C; pfam07662
261594013346	Na+/alanine symporter [Amino acid transport and metabolism]; Region: AlsT; COG1115
261594013347	amino acid carrier protein; Region: agcS; TIGR00835
261594013348	Na+/alanine symporter [Amino acid transport and metabolism]; Region: AlsT; COG1115
261594013349	amino acid carrier protein; Region: agcS; TIGR00835
261594013350	biliverdin IX beta reductase (BVR-B, aka flavin reductase)-like proteins; atypical (a) SDRs; Region: BVR-B_like_SDR_a; cd05244
261594013351	NADH(P)-binding; Region: NAD_binding_10; pfam13460
261594013352	NAD binding site [chemical binding]; other site
261594013353	substrate binding site [chemical binding]; other site
261594013354	putative active site [active]
261594013355	TQXA domain; Region: TQXA_dom; TIGR03934
261594013356	Aldo-keto reductases (AKRs) are a superfamily of soluble NAD(P)(H) oxidoreductases whose chief purpose is to reduce aldehydes and ketones to primary and secondary alcohols. AKRs are present in all phyla and are of importance to both health and industrial...; Region: Aldo_ket_red; cd06660
261594013357	Aldo/keto reductase family; Region: Aldo_ket_red; pfam00248
261594013358	active site
261594013359	catalytic tetrad [active]
261594013360	Arabinose efflux permease [Carbohydrate transport and metabolism]; Region: AraJ; COG2814
261594013361	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594013362	putative substrate translocation pore; other site
261594013363	Predicted transcriptional regulators [Transcription]; Region: COG1733
261594013364	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
261594013365	dimerization interface [polypeptide binding]; other site
261594013366	putative DNA binding site [nucleotide binding]; other site
261594013367	putative Zn2+ binding site [ion binding]; other site
261594013368	Uncharacterized conserved protein [Function unknown]; Region: COG2427
261594013369	NADH dehydrogenase, FAD-containing subunit [Energy production and conversion]; Region: Ndh; COG1252
261594013370	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
261594013371	tyrosyl-tRNA synthetase; Provisional; Region: PRK13354
261594013372	catalytic core domain of tyrosinyl-tRNA synthetase; Region: TyrRS_core; cd00805
261594013373	active site
261594013374	HIGH motif; other site
261594013375	dimer interface [polypeptide binding]; other site
261594013376	KMSKS motif; other site
261594013377	S4/Hsp/ tRNA synthetase RNA-binding domain; The domain surface is populated by conserved, charged residues that define a likely RNA-binding site;  Found in stress proteins, ribosomal proteins and tRNA synthetases; This may imply a hitherto unrecognized...; Region: S4; cd00165
261594013378	RNA binding surface [nucleotide binding]; other site
261594013379	UDP-N-acetylenolpyruvoylglucosamine reductase; Provisional; Region: PRK12436
261594013380	FAD binding domain; Region: FAD_binding_4; pfam01565
261594013381	UDP-N-acetylenolpyruvoylglucosamine reductase, C-terminal domain; Region: MurB_C; pfam02873
261594013382	SET domain; Region: SET; pfam00856
261594013383	Domain of unknown function (DUF4077); Region: DUF4077; pfam13295
261594013384	Methyl-accepting chemotaxis-like domains (chemotaxis sensory transducer); Region: MA; smart00283
261594013385	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
261594013386	dimer interface [polypeptide binding]; other site
261594013387	putative CheW interface [polypeptide binding]; other site
261594013388	Exonuclease-Endonuclease-Phosphatase (EEP) domain superfamily; Region: EEP; cl00490
261594013389	putative phosphate binding site [ion binding]; other site
261594013390	camphor resistance protein CrcB; Provisional; Region: PRK14219
261594013391	camphor resistance protein CrcB; Provisional; Region: PRK14205
261594013392	Protein of unknown function (DUF3947); Region: DUF3947; pfam13135
261594013393	Protein of unknown function (DUF3955); Region: DUF3955; pfam13127
261594013394	Acetyltransferases, including N-acetylases of ribosomal proteins [Translation, ribosomal structure and biogenesis]; Region: RimL; COG1670
261594013395	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cd04301
261594013396	Coenzyme A binding pocket [chemical binding]; other site
261594013397	phosphate-starvation-inducible protein PsiE; Provisional; Region: PRK02833
261594013398	Nuclease-related domain; Region: NERD; pfam08378
261594013399	ABC-type enterochelin transport system, ATPase component [Inorganic ion transport and metabolism]; Region: CeuD; COG4604
261594013400	ATP-binding component of iron-siderophores, vitamin B12 and hemin transporters and related proteins; Region: ABC_Iron-Siderophores_B12_Hemin; cd03214
261594013401	Walker A/P-loop; other site
261594013402	ATP binding site [chemical binding]; other site
261594013403	Q-loop/lid; other site
261594013404	ABC transporter signature motif; other site
261594013405	Walker B; other site
261594013406	D-loop; other site
261594013407	H-loop/switch region; other site
261594013408	Transmembrane subunit (TM), of Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters involved in the uptake of siderophores, heme, vitamin B12, or the divalent cations Mg2+ and Zn2+. PBP-dependent ABC transporters consist of...; Region: TM_ABC_iron-siderophores_like; cd06550
261594013409	ABC-ATPase subunit  interface; other site
261594013410	dimer interface [polypeptide binding]; other site
261594013411	putative PBP binding regions; other site
261594013412	iron-hydroxamate transporter permease subunit; Provisional; Region: PRK10577
261594013413	Transmembrane subunit (TM), of Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters involved in the uptake of siderophores, heme, vitamin B12, or the divalent cations Mg2+ and Zn2+. PBP-dependent ABC transporters consist of...; Region: TM_ABC_iron-siderophores_like; cd06550
261594013414	ABC-ATPase subunit  interface; other site
261594013415	dimer interface [polypeptide binding]; other site
261594013416	putative PBP binding regions; other site
261594013417	ABC-type enterochelin transport system, periplasmic component [Inorganic ion transport and metabolism]; Region: CeuA; COG4607
261594013418	Siderophore binding protein FatB.  These proteins have been shown to function as ABC-type initial receptors in the siderophore-mediated iron uptake in some eubacterial species.  They belong to the TroA superfamily of periplasmic metal binding proteins...; Region: FatB; cd01140
261594013419	putative ligand binding residues [chemical binding]; other site
261594013420	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
261594013421	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594013422	active site
261594013423	phosphorylation site [posttranslational modification]
261594013424	intermolecular recognition site; other site
261594013425	dimerization interface [polypeptide binding]; other site
261594013426	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
261594013427	DNA binding site [nucleotide binding]
261594013428	Small protein B (SmpB) is a component of the trans-translation system in prokaryotes for releasing stalled ribosome from damaged messenger RNAs; Region: SmpB; cd09294
261594013429	SmpB-tmRNA interface; other site
261594013430	ribonuclease R; Region: RNase_R; TIGR02063
261594013431	Ribonuclease B OB domain; Region: OB_RNB; pfam08206
261594013432	S1_like: Ribosomal protein S1-like RNA-binding domain. Found in a wide variety of RNA-associated proteins. Originally identified in S1 ribosomal protein. This superfamily also contains the Cold Shock Domain (CSD), which is a homolog of the S1 domain; Region: S1_like; cl09927
261594013433	RNB domain; Region: RNB; pfam00773
261594013434	S1_RNase_R: RNase R C-terminal S1 domain. RNase R is a processive 3' to 5' exoribonuclease, which is a homolog of RNase II. RNase R degrades RNA with secondary structure having a 3' overhang of at least 7 nucleotides. RNase R and PNPase...; Region: S1_RNase_R; cd04471
261594013435	RNA binding site [nucleotide binding]; other site
261594013436	Esterase/lipase [General function prediction only]; Region: COG1647
261594013437	preprotein translocase subunit SecG; Reviewed; Region: secG; PRK06870
261594013438	Putative effector of murein hydrolase [Cell envelope biogenesis, outer membrane]; Region: LrgB; COG1346
261594013439	holin-like protein; Validated; Region: PRK01658
261594013440	nuc_hydro: Nucleoside hydrolases. Nucleoside hydrolases cleave the N-glycosidic bond in nucleosides generating ribose and the respective base. These enzymes vary in their substrate specificity.  This group contains eukaryotic, bacterial and archeal...; Region: nuc_hydro; cd00455
261594013441	active site
261594013442	NUMOD4 motif; Region: NUMOD4; pfam07463
261594013443	HNH endonuclease; Region: HNH_3; pfam13392
261594013444	Hypothetical protein (DUF2513); Region: DUF2513; pfam10711
261594013445	Helix-turn-helix domain; Region: HTH_17; pfam12728
261594013446	Phage terminase-like protein, large subunit [General function prediction only]; Region: COG4626
261594013447	HNH nucleases; HNH endonuclease signature which is found in viral, prokaryotic, and eukaryotic proteins. The alignment includes members of the large group of homing endonucleases, yeast intron 1 protein, MutS, as well as bacterial colicins, pyocins, and...; Region: HNHc; cd00085
261594013448	active site
261594013449	Phage-related protein [Function unknown]; Region: COG4695; cl01923
261594013450	Phage portal protein; Region: Phage_portal; pfam04860
261594013451	Phage capsid family; Region: Phage_capsid; pfam05065
261594013452	DNA breaking-rejoining enzymes, C-terminal catalytic domain. The DNA breaking-rejoining enzyme superfamily includes type IB topoisomerases and tyrosine recombinases that share the same fold in their catalytic domain containing six conserved active site...; Region: DNA_BRE_C; cl00213
261594013453	tyrosine recombinase XerC; Region: recomb_XerC; TIGR02224
261594013454	active site
261594013455	DNA binding site [nucleotide binding]
261594013456	Int/Topo IB signature motif; other site
261594013457	enolase; Provisional; Region: eno; PRK00077
261594013458	Enolase: Enolases are homodimeric enzymes that catalyse the reversible dehydration of 2-phospho-D-glycerate to phosphoenolpyruvate as part of the glycolytic and gluconeogenesis pathways. The reaction is facilitated by the presence of metal ions; Region: enolase; cd03313
261594013459	dimer interface [polypeptide binding]; other site
261594013460	metal binding site [ion binding]; metal-binding site
261594013461	substrate binding pocket [chemical binding]; other site
261594013462	Phosphoglyceromutase [Carbohydrate transport and metabolism]; Region: GpmI; COG0696
261594013463	phosphoglyceromutase; Provisional; Region: PRK05434
261594013464	Triosephosphate isomerase (TIM) is a glycolytic enzyme that catalyzes the interconversion of dihydroxyacetone phosphate and D-glyceraldehyde-3-phosphate. The reaction is very efficient and requires neither cofactors nor metal ions. TIM, usually...; Region: TIM; cd00311
261594013465	triosephosphate isomerase; Provisional; Region: PRK14565
261594013466	substrate binding site [chemical binding]; other site
261594013467	dimer interface [polypeptide binding]; other site
261594013468	catalytic triad [active]
261594013469	Phosphoglycerate kinase; Region: PGK; pfam00162
261594013470	Phosphoglycerate kinase (PGK) is a monomeric enzyme which catalyzes the transfer of the high-energy phosphate group of 1,3-bisphosphoglycerate to ADP, forming ATP and 3-phosphoglycerate. This reaction represents the first of the two substrate-level...; Region: Phosphoglycerate_kinase; cd00318
261594013471	substrate binding site [chemical binding]; other site
261594013472	hinge regions; other site
261594013473	ADP binding site [chemical binding]; other site
261594013474	catalytic site [active]
261594013475	Glyceraldehyde-3-phosphate dehydrogenase/erythrose-4-phosphate dehydrogenase [Carbohydrate transport and metabolism]; Region: GapA; COG0057
261594013476	Glyceraldehyde 3-phosphate dehydrogenase, NAD binding domain; Region: Gp_dh_N; smart00846
261594013477	Glyceraldehyde 3-phosphate dehydrogenase, C-terminal domain; Region: Gp_dh_C; pfam02800
261594013478	Transcriptional regulator, contains sigma factor-related N-terminal domain [Transcription]; Region: DeoR; COG2390
261594013479	Putative sugar-binding domain; Region: Sugar-bind; pfam04198
261594013480	Glutaredoxin-like domain (DUF836); Region: DUF836; pfam05768
261594013481	RNA polymerase factor sigma-54; Reviewed; Region: PRK05932
261594013482	Sigma-54 factor, Activator interacting domain (AID); Region: Sigma54_AID; pfam00309
261594013483	Sigma-54 factor, core binding domain; Region: Sigma54_CBD; pfam04963
261594013484	Sigma-54, DNA binding domain; Region: Sigma54_DBD; pfam04552
261594013485	Protein of unknown function (DUF1657); Region: DUF1657; pfam07870
261594013486	stage V sporulation protein AC; Region: spore_V_AC; TIGR02838
261594013487	stage V sporulation protein AD; Provisional; Region: PRK12404
261594013488	Stage V sporulation protein AD (SpoVAD); Region: SpoVAD; pfam07451
261594013489	stage V sporulation protein AE; Region: spore_V_AE; TIGR02839
261594013490	Protein of unknown function (DUF1657); Region: DUF1657; pfam07870
261594013491	Predicted membrane protein [Function unknown]; Region: COG2323
261594013492	Protein of unknown function (DUF1657); Region: DUF1657; pfam07870
261594013493	Clp protease; Region: CLP_protease; pfam00574
261594013494	Caseinolytic protease (ClpP) is an ATP-dependent, highly conserved serine protease; Region: S14_ClpP_2; cd07017
261594013495	oligomer interface [polypeptide binding]; other site
261594013496	active site residues [active]
261594013497	Histidine-containing phosphocarrier protein (HPr)-like proteins. HPr is a central component of the bacterial phosphoenolpyruvate sugar phosphotransferase system (PTS). The PTS catalyses the phosphorylation of sugar substrates during their translocation...; Region: PTS-HPr_like; cd00367
261594013498	dimerization domain swap beta strand [polypeptide binding]; other site
261594013499	regulatory protein interface [polypeptide binding]; other site
261594013500	active site
261594013501	regulatory phosphorylation site [posttranslational modification]; other site
261594013502	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG1481
261594013503	Sporulation Regulator WhiA N terminal; Region: WhiA_N; pfam10298
261594013504	conserved hypothetical protein, cofD-related; Region: CofD_related; TIGR01826
261594013505	family of mostly uncharacterized proteins similar to B.subtilis YvcK; Region: YvcK_like; cd07187
261594013506	phosphate binding site [ion binding]; other site
261594013507	putative substrate binding pocket [chemical binding]; other site
261594013508	dimer interface [polypeptide binding]; other site
261594013509	glmZ(sRNA)-inactivating NTPase; Provisional; Region: PRK05416
261594013510	MutT homolog-1 (MTH1) is a member of the Nudix hydrolase superfamily. MTH1, the mammalian counterpart of MutT, hydrolyzes oxidized purine nucleoside triphosphates, such as 8-oxo-dGTP and 2-hydroxy-ATP, to monophosphates, thereby preventing the...; Region: MTH1; cd03427
261594013511	putative active site [active]
261594013512	nucleotide binding site [chemical binding]; other site
261594013513	nudix motif; other site
261594013514	putative metal binding site [ion binding]; other site
261594013515	Domain of unknown function (DUF368); Region: DUF368; pfam04018
261594013516	thioredoxin-disulfide reductase; Region: TRX_reduct; TIGR01292
261594013517	NAD(P)-binding Rossmann-like domain; Region: NAD_binding_8; cl17500
261594013518	Pyridine nucleotide-disulphide oxidoreductase; Region: Pyr_redox; pfam00070
261594013519	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cd00189
261594013520	binding surface
261594013521	TPR motif; other site
261594013522	Tetratricopeptide repeat; Region: TPR_12; pfam13424
261594013523	Tetratricopeptide repeat domain; typically contains 34 amino acids [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]- X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in a variety of organisms including bacteria, cyanobacteria, yeast, fungi; Region: TPR; cd00189
261594013524	binding surface
261594013525	Tetratricopeptide repeat; Region: TPR_16; pfam13432
261594013526	TPR motif; other site
261594013527	Acetyltransferase (isoleucine patch superfamily) [General function prediction only]; Region: WbbJ; COG0110
261594013528	Maltose O-acyltransferase (MAT)-like: This family is composed of maltose O-acetyltransferase, galactoside O-acetyltransferase (GAT), xenobiotic acyltransferase (XAT) and similar proteins. MAT and GAT catalyze the CoA-dependent acetylation of the...; Region: LbH_MAT_like; cd04647
261594013529	trimer interface [polypeptide binding]; other site
261594013530	active site
261594013531	substrate binding site [chemical binding]; other site
261594013532	CoA binding site [chemical binding]; other site
261594013533	pyrophosphatase PpaX; Provisional; Region: PRK13288
261594013534	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
261594013535	active site
261594013536	motif I; other site
261594013537	motif II; other site
261594013538	prolipoprotein diacylglyceryl transferase; Reviewed; Region: PRK12437
261594013539	HPr kinase/phosphorylase; Provisional; Region: PRK05428
261594013540	HPr Serine kinase N terminus; Region: Hpr_kinase_N; pfam02603
261594013541	HprK/P, the bifunctional histidine-containing protein kinase/phosphatase, controls the phosphorylation state of the phosphocarrier protein HPr and regulates the utilization of carbon sources by gram-positive bacteria. It catalyzes both the ATP-dependent...; Region: HprK_C; cd01918
261594013542	Hpr binding site; other site
261594013543	active site
261594013544	homohexamer subunit interaction site [polypeptide binding]; other site
261594013545	Predicted membrane protein [Function unknown]; Region: COG1950
261594013546	Domain of unknown function (DUF4275); Region: DUF4275; pfam14101
261594013547	excinuclease ABC subunit A; Reviewed; Region: uvrA; PRK00349
261594013548	ATP-binding cassette domain I of the excision repair protein UvrA; Region: ABC_UvrA_I; cd03270
261594013549	ATP-binding cassette domain I of the excision repair protein UvrA; Region: ABC_UvrA_I; cd03270
261594013550	ATP-binding cassette domain II of the excision repair protein UvrA; Region: ABC_UvrA_II; cd03271
261594013551	excinuclease ABC subunit B; Provisional; Region: PRK05298
261594013552	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
261594013553	ATP binding site [chemical binding]; other site
261594013554	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
261594013555	nucleotide binding region [chemical binding]; other site
261594013556	ATP-binding site [chemical binding]; other site
261594013557	Ultra-violet resistance protein B; Region: UvrB; pfam12344
261594013558	Transposase and inactivated derivatives [DNA replication, recombination, and repair]; Region: COG0675
261594013559	Helix-turn-helix domain; Region: HTH_OrfB_IS605; pfam12323
261594013560	Probable transposase; Region: OrfB_IS605; pfam01385
261594013561	transposase, IS605 OrfB family, central region; Region: tspaseT_teng_C; TIGR01766
261594013562	Domain of unknown function (DUF4362); Region: DUF4362; pfam14275
261594013563	Helix-Turn-Helix DNA binding domain of the transcription regulators TipAL, Mta, and SkgA; Region: HTH_TipAL-Mta; cd01106
261594013564	MerR HTH family regulatory protein; Region: MerR_1; pfam13411
261594013565	DNA binding residues [nucleotide binding]
261594013566	dimer interface [polypeptide binding]; other site
261594013567	TipAS antibiotic-recognition domain; Region: TipAS; pfam07739
261594013568	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
261594013569	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
261594013570	non-specific DNA binding site [nucleotide binding]; other site
261594013571	salt bridge; other site
261594013572	sequence-specific DNA binding site [nucleotide binding]; other site
261594013573	Predicted membrane protein [Function unknown]; Region: COG2855
261594013574	Transcriptional regulator [Transcription]; Region: LysR; COG0583
261594013575	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
261594013576	C-terminal substrate binding domain of LysR-type transcriptional regulator CysL, which activates the transcription of the cysJI operon encoding sulfite reductase, contains the type 2 periplasmic binding fold; Region: PBP2_CysL_like; cd08420
261594013577	putative dimerization interface [polypeptide binding]; other site
261594013578	Helix-Turn-Helix DNA binding domain of putative transcription regulators from the MerR superfamily; Region: HTH_MerR-like_sg3; cd01282
261594013579	MerR HTH family regulatory protein; Region: MerR_1; pfam13411
261594013580	DNA binding residues [nucleotide binding]
261594013581	putative dimer interface [polypeptide binding]; other site
261594013582	Multimeric flavodoxin WrbA [General function prediction only]; Region: WrbA; COG0655
261594013583	NADPH-dependent FMN reductase; Region: FMN_red; pfam03358
261594013584	gallidermin-class lantibiotic protection ABC transporter, ATP-binding subunit; Region: galliderm_ABC; TIGR03740
261594013585	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
261594013586	ABC transporter; Region: ABC_tran_2; pfam12848
261594013587	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
261594013588	ABC-type cobalt transport system, ATPase component [Inorganic ion transport and metabolism]; Region: CbiO; COG1122
261594013589	ABC-type multidrug transport system, ATPase and permease components [Defense mechanisms]; Region: MdlB; COG1132
261594013590	ABC transporter transmembrane region; Region: ABC_membrane; pfam00664
261594013591	ATP-binding cassette domain of the bacterial lipid flippase and related proteins, subfamily C; Region: ABCC_MsbA; cd03251
261594013592	Walker A/P-loop; other site
261594013593	ATP binding site [chemical binding]; other site
261594013594	Q-loop/lid; other site
261594013595	ABC transporter signature motif; other site
261594013596	Walker B; other site
261594013597	D-loop; other site
261594013598	H-loop/switch region; other site
261594013599	PDZ domain of tryspin-like serine proteases, such as DegP/HtrA, which are oligomeric proteins involved in heat-shock response, chaperone function, and apoptosis. May be responsible for substrate recognition and/or binding, as most PDZ domains bind...; Region: PDZ_serine_protease; cd00987
261594013600	protein binding site [polypeptide binding]; other site
261594013601	C-terminal processing peptidase family S41; Region: Peptidase_S41; cl02526
261594013602	C-terminal peptidase (prc); Region: prc; TIGR00225
261594013603	PDZ domain of C-terminal processing-, tail-specific-, and tricorn proteases, which function in posttranslational protein processing, maturation, and disassembly or degradation, in Bacteria, Archaea, and plant chloroplasts. May be responsible for...; Region: PDZ_CTP_protease; cd00988
261594013604	protein binding site [polypeptide binding]; other site
261594013605	C-terminal processing peptidase; serine protease family S41; Region: Peptidase_S41_CPP; cd07560
261594013606	Catalytic dyad [active]
261594013607	Putative peptidoglycan binding domain; Region: PG_binding_1; pfam01471
261594013608	Cell division protein [Cell division and chromosome partitioning]; Region: FtsX; COG2177
261594013609	cell division ABC transporter subunit FtsX; Provisional; Region: ftsX; PRK11026
261594013610	ATP-binding cassette transporter nucleotide-binding domain; Region: ABC_ATPase; cl17201
261594013611	Predicted ATPase involved in cell division [Cell division and chromosome partitioning]; Region: FtsE; COG2884
261594013612	Walker A/P-loop; other site
261594013613	ATP binding site [chemical binding]; other site
261594013614	Q-loop/lid; other site
261594013615	ABC transporter signature motif; other site
261594013616	Walker B; other site
261594013617	D-loop; other site
261594013618	H-loop/switch region; other site
261594013619	Cytochrome c, mono- and diheme variants [Energy production and conversion]; Region: CccA; COG2010
261594013620	Cytochrome C oxidase, cbb3-type, subunit III; Region: Cytochrome_CBB3; pfam13442
261594013621	preprotein translocase subunit SecA; Reviewed; Region: PRK12904
261594013622	SecA preprotein cross-linking domain; Region: SecA_PP_bind; smart00958
261594013623	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cl17351
261594013624	nucleotide binding region [chemical binding]; other site
261594013625	ATP-binding site [chemical binding]; other site
261594013626	SEC-C motif; Region: SEC-C; pfam02810
261594013627	RaiA ("ribosome-associated inhibitor A", also known as Protein Y (PY), YfiA, and SpotY,  is a stress-response protein that binds the ribosomal subunit interface and arrests translation by interfering with aminoacyl-tRNA binding to the ribosomal...; Region: RaiA; cd00552
261594013628	30S subunit binding site; other site
261594013629	Cold-Shock Protein (CSP) contains an S1-like cold-shock domain (CSD) that is found in eukaryotes, prokaryotes, and archaea.  CSP's include the major cold-shock proteins CspA and CspB in bacteria and the eukaryotic gene regulatory factor Y-box...; Region: CSP_CDS; cd04458
261594013630	DNA-binding site [nucleotide binding]; DNA binding site
261594013631	RNA-binding motif; other site
261594013632	comF family protein; Region: comF; TIGR00201
261594013633	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
261594013634	active site
261594013635	Superfamily II DNA/RNA helicase required for DNA uptake (late competence protein) [DNA replication, recombination, and repair]; Region: comFA; COG4098
261594013636	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
261594013637	ATP binding site [chemical binding]; other site
261594013638	putative Mg++ binding site [ion binding]; other site
261594013639	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
261594013640	nucleotide binding region [chemical binding]; other site
261594013641	ATP-binding site [chemical binding]; other site
261594013642	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3883
261594013643	Cell wall-associated hydrolases (invasion-associated proteins) [Cell envelope biogenesis, outer membrane]; Region: Spr; COG0791
261594013644	NlpC/P60 family; Region: NLPC_P60; pfam00877
261594013645	Predicted transcriptional regulators [Transcription]; Region: COG1733
261594013646	Arsenical Resistance Operon Repressor and similar prokaryotic, metal regulated homodimeric repressors. ARSR subfamily of helix-turn-helix bacterial transcription regulatory proteins (winged helix topology). Includes several proteins that appear to...; Region: HTH_ARSR; cd00090
261594013647	dimerization interface [polypeptide binding]; other site
261594013648	putative DNA binding site [nucleotide binding]; other site
261594013649	putative Zn2+ binding site [ion binding]; other site
261594013650	EDD domain protein, DegV family; Region: DegV; TIGR00762
261594013651	Uncharacterized protein, DegV family COG1307; Region: DegV; pfam02645
261594013652	uncharacterized protein, YigZ family; Region: IMPACT_YIGZ; TIGR00257
261594013653	Uncharacterized protein family UPF0029; Region: UPF0029; pfam01205
261594013654	Domain of unknown function (DUF1949); Region: DUF1949; pfam09186
261594013655	Transcriptional regulator [Transcription]; Region: LytR; COG1316
261594013656	UDP-N-acetylglucosamine 2-epimerase [Cell envelope biogenesis, outer membrane]; Region: WecB; COG0381
261594013657	Bacterial members of the UDP-N-Acetylglucosamine (GlcNAc) 2-Epimerase  family are known to catalyze the reversible interconversion of UDP-GlcNAc and UDP-N-acetylmannosamine (UDP-ManNAc). The enzyme serves to produce an activated form of ManNAc residues; Region: GT1_UDP-GlcNAc_2-Epimerase; cd03786
261594013658	active site
261594013659	homodimer interface [polypeptide binding]; other site
261594013660	Predicted UDP-glucose 6-dehydrogenase [Cell envelope biogenesis, outer membrane]; Region: Ugd; COG1004
261594013661	NAD-dependent glycerol-3-phosphate dehydrogenase N-terminus; Region: NAD_Gly3P_dh_N; pfam01210
261594013662	UDP-glucose/GDP-mannose dehydrogenase family, central domain; Region: UDPG_MGDP_dh; pfam00984
261594013663	UDP-glucose/GDP-mannose dehydrogenase family, UDP binding domain; Region: UDPG_MGDP_dh_C; pfam03720
261594013664	UDP-N-acetylmuramyl pentapeptide phosphotransferase/UDP-N- acetylglucosamine-1-phosphate transferase [Cell envelope biogenesis, outer membrane]; Region: Rfe; COG0472
261594013665	This subfamily contains Escherichia coli WecA, Bacillus subtilis TagO and related proteins. WecA is an UDP-N-acetylglucosamine (GlcNAc):undecaprenyl-phosphate (Und-P) GlcNAc-1-phosphate transferase that catalyzes the formation of a phosphodiester bond...; Region: GT_WecA_like; cd06853
261594013666	Mg++ binding site [ion binding]; other site
261594013667	putative catalytic motif [active]
261594013668	substrate binding site [chemical binding]; other site
261594013669	Predicted xylanase/chitin deacetylase [Carbohydrate transport and metabolism]; Region: CDA1; COG0726
261594013670	Catalytic NodB homology domain of Streptococcus mutans polysaccharide deacetylase PgdA, Bacillus subtilis YheN, and similar proteins; Region: CE4_SmPgdA_like; cd10944
261594013671	NodB motif; other site
261594013672	active site
261594013673	catalytic site [active]
261594013674	Zn binding site [ion binding]; other site
261594013675	The AAA+ (ATPases Associated with a wide variety of cellular Activities) superfamily represents an ancient group of ATPases belonging to the ASCE (for additional strand, catalytic E) division of the P-loop NTPase fold. The ASCE division also includes ABC; Region: AAA; cd00009
261594013676	ATPases associated with a variety of cellular activities; Region: AAA; smart00382
261594013677	Walker A motif; other site
261594013678	ATP binding site [chemical binding]; other site
261594013679	Walker B motif; other site
261594013680	arginine finger; other site
261594013681	Transcriptional antiterminator [Transcription]; Region: COG3933
261594013682	PRD domain; Region: PRD; pfam00874
261594013683	PTS_IIA, PTS system, mannose/sorbose specific IIA subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This family...; Region: PTS_IIA_man; cd00006
261594013684	active pocket/dimerization site; other site
261594013685	active site
261594013686	phosphorylation site [posttranslational modification]
261594013687	PRD domain; Region: PRD; pfam00874
261594013688	A domain in the BMP inhibitor chordin and in microbial proteins; Region: CHRD; smart00754
261594013689	Chromate transport protein ChrA [Inorganic ion transport and metabolism]; Region: ChrA; COG2059
261594013690	chromate transporter, chromate ion transporter (CHR) family; Region: 2A51; TIGR00937
261594013691	Chromate transporter; Region: Chromate_transp; pfam02417
261594013692	Enterococcus faecalis EF3048 and similar proteins; Region: YdjC_EF3048_like; cd10803
261594013693	putative active site [active]
261594013694	YdjC motif; other site
261594013695	Mg binding site [ion binding]; other site
261594013696	putative homodimer interface [polypeptide binding]; other site
261594013697	Alpha-galactosidases/6-phospho-beta-glucosidases, family 4 of glycosyl hydrolases [Carbohydrate transport and metabolism]; Region: CelF; COG1486
261594013698	Glycoside Hydrolases Family 4; Phospho-beta-glucosidase; Region: GH4_P_beta_glucosidase; cd05296
261594013699	NAD binding site [chemical binding]; other site
261594013700	sugar binding site [chemical binding]; other site
261594013701	divalent metal binding site [ion binding]; other site
261594013702	tetramer (dimer of dimers) interface [polypeptide binding]; other site
261594013703	dimer interface [polypeptide binding]; other site
261594013704	PTS_IIA, PTS system, lactose/cellobiose specific IIA subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This...; Region: PTS_IIA_lac; cd00215
261594013705	active site
261594013706	methionine cluster; other site
261594013707	phosphorylation site [posttranslational modification]
261594013708	metal binding site [ion binding]; metal-binding site
261594013709	cellobiose phosphotransferase system IIC component; Reviewed; Region: celD; PRK09592
261594013710	Phosphotransferase system cellobiose-specific component IIC [Carbohydrate transport and metabolism]; Region: CelB; COG1455
261594013711	PTS_IIB_chitobiose_lichenan: subunit IIB of enzyme II (EII) of the N,N-diacetylchitobiose-specific and lichenan-specific phosphoenolpyruvate:carbohydrate phosphotransferase system (PTS). In these systems, EII is either a lichenan- or an N; Region: PTS_IIB_chitobiose_lichenan; cd05564
261594013712	active site
261594013713	P-loop; other site
261594013714	phosphorylation site [posttranslational modification]
261594013715	spermidine synthase; Provisional; Region: PRK03612
261594013716	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594013717	S-adenosylmethionine binding site [chemical binding]; other site
261594013718	S-adenosylmethionine decarboxylase proenzyme; Validated; Region: PRK01706
261594013719	PTS_IIA, PTS system, lactose/cellobiose specific IIA subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This...; Region: PTS_IIA_lac; cd00215
261594013720	methionine cluster; other site
261594013721	active site
261594013722	phosphorylation site [posttranslational modification]
261594013723	metal binding site [ion binding]; metal-binding site
261594013724	cellobiose phosphotransferase system IIC component; Reviewed; Region: celD; PRK09592
261594013725	Phosphotransferase system cellobiose-specific component IIC [Carbohydrate transport and metabolism]; Region: CelB; cl17295
261594013726	PTS_IIB_chitobiose_lichenan: subunit IIB of enzyme II (EII) of the N,N-diacetylchitobiose-specific and lichenan-specific phosphoenolpyruvate:carbohydrate phosphotransferase system (PTS). In these systems, EII is either a lichenan- or an N; Region: PTS_IIB_chitobiose_lichenan; cd05564
261594013727	active site
261594013728	P-loop; other site
261594013729	phosphorylation site [posttranslational modification]
261594013730	Sodium:dicarboxylate symporter family; Region: SDF; pfam00375
261594013731	Na+/H+-dicarboxylate symporters [Energy production and conversion]; Region: GltP; COG1301
261594013732	Acyltransferase family; Region: Acyl_transf_3; pfam01757
261594013733	Predicted O-acyltransferase [General function prediction only]; Region: COG3274
261594013734	Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily; Region: Glyoxalase; pfam00903
261594013735	This conserved domain belongs to a superfamily including the bleomycin resistance protein, glyoxalase I, and type I ring-cleaving dioxygenases; Region: Glo_EDI_BRP_like_16; cd07263
261594013736	Predicted membrane protein [Function unknown]; Region: COG1511
261594013737	YhgE/Pip N-terminal domain; Region: pip_yhgE_Nterm; TIGR03061
261594013738	ABC-2 family transporter protein; Region: ABC2_membrane_3; pfam12698
261594013739	YhgE/Pip C-terminal domain; Region: pip_yhgE_Cterm; TIGR03062
261594013740	Transcriptional regulator [Transcription]; Region: LysR; COG0583
261594013741	Bacterial regulatory helix-turn-helix protein, lysR family; Region: HTH_1; pfam00126
261594013742	The substrate binding domain of LysR-type transcriptional regulator GltC, which activates gltA expression of glutamate synthase operon, contains type 2 periplasmic binding fold; Region: PBP2_GltC_like; cd08434
261594013743	putative dimerization interface [polypeptide binding]; other site
261594013744	transposase, putative, N-terminal domain; Region: tspaseT_teng_N; TIGR01765
261594013745	Bacterial Cytochrome Ubiquinol Oxidase; Region: Bac_Ubq_Cox; pfam01654
261594013746	Cytochrome bd-type quinol oxidase, subunit 2 [Energy production and conversion]; Region: AppB; COG1294
261594013747	Anion permease ArsB.  These permeases have been shown to export arsenate and antimonite in eubacteria and archaea.  A typical ArsB permease contains 8-13 transmembrane helices and can function either independently as a chemiosmotic transporter or as a...; Region: ArsB_permease; cd01118
261594013748	Na+/H+ antiporter NhaD and related arsenite permeases [Inorganic ion transport and metabolism]; Region: ArsB; COG1055
261594013749	transmembrane helices; other site
261594013750	thiamine biosynthesis protein ThiC; Provisional; Region: PRK09284
261594013751	ThiC-associated domain; Region: ThiC-associated; pfam13667
261594013752	Thiamine biosynthesis protein ThiC [Coenzyme metabolism]; Region: ThiC; COG0422
261594013753	L-lactate permease; Region: Lactate_perm; cl00701
261594013754	glycolate transporter; Provisional; Region: PRK09695
261594013755	Tic20-like protein; Region: Tic20; pfam09685
261594013756	Uncharacterized metal-binding protein (DUF2227); Region: DUF2227; pfam09988
261594013757	Uncharacterized conserved protein [Function unknown]; Region: COG3339
261594013758	Phosphoglycerol transferase and related proteins, alkaline phosphatase superfamily [Cell envelope biogenesis, outer membrane]; Region: MdoB; COG1368
261594013759	Sulfatase; Region: Sulfatase; pfam00884
261594013760	Branched-chain amino acid aminotransferase/4-amino-4-deoxychorismate lyase [Amino acid transport and metabolism / Coenzyme metabolism]; Region: IlvE; COG0115
261594013761	D-Alanine aminotransferase (D-AAT_like): D-amino acid aminotransferase catalyzes transamination between D-amino acids and their respective alpha-keto acids. It plays a major role in the synthesis of bacterial cell wall components like D-alanine and...; Region: D-AAT_like; cd01558
261594013762	homodimer interface [polypeptide binding]; other site
261594013763	substrate-cofactor binding pocket; other site
261594013764	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594013765	catalytic residue [active]
261594013766	Nucleoside permease [Nucleotide transport and metabolism]; Region: NupC; COG1972
261594013767	Na+ dependent nucleoside transporter N-terminus; Region: Nucleos_tra2_N; pfam01773
261594013768	Nucleoside recognition; Region: Gate; pfam07670
261594013769	Na+ dependent nucleoside transporter C-terminus; Region: Nucleos_tra2_C; pfam07662
261594013770	BCCT family transporter; Region: BCCT; pfam02028
261594013771	Bacterial SH3 domain; Region: SH3_3; pfam08239
261594013772	Bacterial SH3 domain; Region: SH3_3; pfam08239
261594013773	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG3584
261594013774	Protein of unknown function (DUF3910); Region: DUF3910; pfam13049
261594013775	Predicted membrane protein [Function unknown]; Region: COG4640
261594013776	zinc-ribbon domain; Region: zinc_ribbon_2; pfam13240
261594013777	Double zinc ribbon; Region: DZR; pfam12773
261594013778	Double zinc ribbon; Region: DZR; pfam12773
261594013779	zinc-ribbon domain; Region: zf-ribbon_3; cl11198
261594013780	SNF2 Helicase protein; Region: DUF3670; pfam12419
261594013781	SNF2 family N-terminal domain; Region: SNF2_N; pfam00176
261594013782	DEAD-like helicases superfamily. A diverse family of proteins involved in ATP-dependent RNA or DNA unwinding. This domain contains the ATP-binding region; Region: DEXDc; cd00046
261594013783	ATP binding site [chemical binding]; other site
261594013784	putative Mg++ binding site [ion binding]; other site
261594013785	Superfamily II DNA and RNA helicases [DNA replication, recombination, and repair / Transcription / Translation, ribosomal structure and biogenesis]; Region: SrmB; COG0513
261594013786	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
261594013787	nucleotide binding region [chemical binding]; other site
261594013788	ATP-binding site [chemical binding]; other site
261594013789	Predicted integral membrane protein [Function unknown]; Region: COG5652
261594013790	Protein of unknown function (DUF1659); Region: DUF1659; pfam07872
261594013791	Protein of unknown function (DUF2922); Region: DUF2922; pfam11148
261594013792	Domain of unknown function (DUF4359); Region: DUF4359; pfam14271
261594013793	ComK protein; Region: ComK; pfam06338
261594013794	RNA polymerase factor sigma-70; Validated; Region: PRK06759
261594013795	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
261594013796	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
261594013797	DNA binding residues [nucleotide binding]
261594013798	Protein of unknown function (DUF1282); Region: DUF1282; pfam06930
261594013799	MacB-like periplasmic core domain; Region: MacB_PCD; pfam12704
261594013800	ABC-type antimicrobial peptide transport system, permease component [Defense mechanisms]; Region: SalY; COG0577
261594013801	FtsX-like permease family; Region: FtsX; pfam02687
261594013802	ABC-type antimicrobial peptide transport system, ATPase component [Defense mechanisms]; Region: SalX; COG1136
261594013803	ATP-binding cassette domain of the transporters involved in export of lipoprotein and macrolide, and cell division protein; Region: ABC_MJ0796_LolCDE_FtsE; cd03255
261594013804	Walker A/P-loop; other site
261594013805	ATP binding site [chemical binding]; other site
261594013806	Q-loop/lid; other site
261594013807	ABC transporter signature motif; other site
261594013808	Walker B; other site
261594013809	D-loop; other site
261594013810	H-loop/switch region; other site
261594013811	RND family efflux transporter, MFP subunit; Region: RND_mfp; TIGR01730
261594013812	Biotin-lipoyl like; Region: Biotin_lipoyl_2; pfam13533
261594013813	Predicted transcriptional regulators [Transcription]; Region: HipB; COG1396
261594013814	Helix-turn-helix XRE-family like proteins. Prokaryotic DNA binding proteins belonging to the xenobiotic response element family of transcriptional regulators; Region: HTH_XRE; cd00093
261594013815	non-specific DNA binding site [nucleotide binding]; other site
261594013816	salt bridge; other site
261594013817	sequence-specific DNA binding site [nucleotide binding]; other site
261594013818	Sugar phosphate permease [Carbohydrate transport and metabolism]; Region: UhpC; COG2271
261594013819	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594013820	putative substrate translocation pore; other site
261594013821	Bacterial extracellular solute-binding protein; Region: SBP_bac_11; pfam13531
261594013822	Bacterial extracellular solute-binding protein; Region: SBP_bac_6; pfam13343
261594013823	Protein of unknown function (DUF3919); Region: DUF3919; pfam13057
261594013824	heavy metal sensor kinase; Region: cztS_silS_copS; TIGR01386
261594013825	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: BaeS; COG0642
261594013826	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
261594013827	dimerization interface [polypeptide binding]; other site
261594013828	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
261594013829	dimer interface [polypeptide binding]; other site
261594013830	phosphorylation site [posttranslational modification]
261594013831	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594013832	ATP binding site [chemical binding]; other site
261594013833	Mg2+ binding site [ion binding]; other site
261594013834	G-X-G motif; other site
261594013835	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
261594013836	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594013837	active site
261594013838	phosphorylation site [posttranslational modification]
261594013839	intermolecular recognition site; other site
261594013840	dimerization interface [polypeptide binding]; other site
261594013841	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
261594013842	DNA binding site [nucleotide binding]
261594013843	UDP-glucose 4-epimerase [Cell envelope biogenesis, outer membrane]; Region: GalE; COG1087
261594013844	UDP-glucose 4 epimerase, subgroup 1, extended (e) SDRs; Region: UDP_G4E_1_SDR_e; cd05247
261594013845	NAD binding site [chemical binding]; other site
261594013846	homodimer interface [polypeptide binding]; other site
261594013847	active site
261594013848	substrate binding site [chemical binding]; other site
261594013849	membrane-bound transcriptional regulator LytR; Provisional; Region: PRK09379
261594013850	FabZ is a 17kD beta-hydroxyacyl-acyl carrier protein (ACP) dehydratase that primarily catalyzes the dehydration of beta-hydroxyacyl-ACP to trans-2-acyl-ACP, the third step in the elongation phase of the bacterial/ plastid, type II, fatty-acid...; Region: FabZ; cd01288
261594013851	UDP-N-acetylglucosamine 2-epimerase [Cell envelope biogenesis, outer membrane]; Region: WecB; COG0381
261594013852	Bacterial members of the UDP-N-Acetylglucosamine (GlcNAc) 2-Epimerase  family are known to catalyze the reversible interconversion of UDP-GlcNAc and UDP-N-acetylmannosamine (UDP-ManNAc). The enzyme serves to produce an activated form of ManNAc residues; Region: GT1_UDP-GlcNAc_2-Epimerase; cd03786
261594013853	active site
261594013854	homodimer interface [polypeptide binding]; other site
261594013855	teichoic acids export protein ATP-binding subunit; Provisional; Region: tagH; PRK13545
261594013856	ATP-binding cassette component of polysaccharide transport system; Region: ABC_KpsT_Wzt; cd03220
261594013857	Walker A/P-loop; other site
261594013858	ATP binding site [chemical binding]; other site
261594013859	Q-loop/lid; other site
261594013860	ABC transporter signature motif; other site
261594013861	Walker B; other site
261594013862	D-loop; other site
261594013863	H-loop/switch region; other site
261594013864	Bacterial SH3 domain homologues; Region: SH3b; smart00287
261594013865	ABC-type polysaccharide/polyol phosphate export systems, permease component [Carbohydrate transport and metabolism / Cell envelope biogenesis, outer membrane]; Region: TagG; COG1682
261594013866	ABC-2 type transporter; Region: ABC2_membrane; pfam01061
261594013867	UDP-N-acetyl-D-mannosaminuronate dehydrogenase [Cell envelope biogenesis, outer membrane]; Region: WecC; COG0677
261594013868	UDP-glucose/GDP-mannose dehydrogenase family, central domain; Region: UDPG_MGDP_dh; pfam00984
261594013869	UDP-glucose/GDP-mannose dehydrogenase family, UDP binding domain; Region: UDPG_MGDP_dh_C; pfam03720
261594013870	Heparinase II/III-like protein; Region: Hepar_II_III; pfam07940
261594013871	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4641
261594013872	Glycosyl transferases group 1; Region: Glyco_trans_1_2; pfam13524
261594013873	Glycosyltransferases catalyze the transfer of sugar moieties from activated donor molecules to specific acceptor molecules, forming glycosidic bonds. The acceptor molecule can be a lipid, a protein, a heterocyclic compound, or another carbohydrate...; Region: Glycosyltransferase_GTB_type; cl10013
261594013874	Glycosyltransferase [Cell envelope biogenesis, outer membrane]; Region: RfaG; COG0438
261594013875	This family is most closely related to the GT1 family of glycosyltransferases. wbuB in E. coli is involved in the biosynthesis of the O26 O-antigen.  It has been proposed to function as an N-acetyl-L-fucosamine (L-FucNAc) transferase; Region: GT1_wbuB_like; cd03794
261594013876	putative glycosyl transferase; Provisional; Region: PRK10307
261594013877	rod shape-determining protein Mbl; Provisional; Region: PRK13928
261594013878	MreB and similar proteins; Region: MreB_like; cd10225
261594013879	nucleotide binding site [chemical binding]; other site
261594013880	Mg binding site [ion binding]; other site
261594013881	putative protofilament interaction site [polypeptide binding]; other site
261594013882	RodZ interaction site [polypeptide binding]; other site
261594013883	Stage III sporulation protein D; Region: SpoIIID; pfam12116
261594013884	Y_Y_Y domain; Region: Y_Y_Y; pfam07495
261594013885	Membrane proteins related to metalloendopeptidases [Cell envelope biogenesis, outer membrane]; Region: NlpD; COG0739
261594013886	Peptidase family M23; Region: Peptidase_M23; pfam01551
261594013887	ABC-2 family transporter protein; Region: ABC2_membrane_2; cl17866
261594013888	ABC-2 family transporter protein; Region: ABC2_membrane_3; pfam12698
261594013889	ABC-type multidrug transport system, ATPase component [Defense mechanisms]; Region: CcmA; COG1131
261594013890	ATP-binding cassette domain of the drug resistance transporter and related proteins, subfamily A; Region: ABC_DR_subfamily_A; cd03230
261594013891	Walker A/P-loop; other site
261594013892	ATP binding site [chemical binding]; other site
261594013893	Q-loop/lid; other site
261594013894	ABC transporter signature motif; other site
261594013895	Walker B; other site
261594013896	D-loop; other site
261594013897	H-loop/switch region; other site
261594013898	Stage II sporulation protein; Region: SpoIID; pfam08486
261594013899	SpoIID/LytB domain; Region: SpoIID_LytB; TIGR02669
261594013900	UDP-N-acetylglucosamine 1-carboxyvinyltransferase; Region: murA; TIGR01072
261594013901	UDP-N-acetylglucosamine enolpyruvyl transferase catalyzes enolpyruvyl transfer as part of the first step in the biosynthesis of peptidoglycan, a component of the bacterial cell wall. The reaction is phosphoenolpyruvate + UDP-N-acetyl-D-glucosamine =...; Region: UdpNAET; cd01555
261594013902	hinge; other site
261594013903	active site
261594013904	Protein of unknown function (DUF1779); Region: DUF1779; pfam08680
261594013905	Protein of unknown function (DUF1146); Region: DUF1146; cl11486
261594013906	NADH:ubiquinone oxidoreductase subunit N; Provisional; Region: PRK05777
261594013907	NADH-Ubiquinone/plastoquinone (complex I), various chains; Region: Oxidored_q1; pfam00361
261594013908	NADH:ubiquinone oxidoreductase subunit M; Reviewed; Region: PRK05846
261594013909	NADH-Ubiquinone/plastoquinone (complex I), various chains; Region: Oxidored_q1; pfam00361
261594013910	NADH:ubiquinone oxidoreductase subunit L; Reviewed; Region: PRK06590
261594013911	NADH-Ubiquinone oxidoreductase (complex I), chain 5 N-terminus; Region: Oxidored_q1_N; pfam00662
261594013912	NADH-Ubiquinone/plastoquinone (complex I), various chains; Region: Oxidored_q1; pfam00361
261594013913	NADH:ubiquinone oxidoreductase subunit K; Validated; Region: PRK05715
261594013914	NADH:ubiquinone oxidoreductase subunit J; Provisional; Region: PRK06638
261594013915	NADH dehydrogenase subunit J; Provisional; Region: PRK06433
261594013916	NADH-quinone oxidoreductase, chain I; Region: NuoI; TIGR01971
261594013917	4Fe-4S binding domain; Region: Fer4; cl02805
261594013918	4Fe-4S binding domain; Region: Fer4; pfam00037
261594013919	NADH:ubiquinone oxidoreductase subunit H; Provisional; Region: PRK06076
261594013920	Formate hydrogenlyase subunit 4 [Energy production and conversion]; Region: HyfC; COG0650
261594013921	NADH dehydrogenase subunit D; Provisional; Region: PRK12322
261594013922	NADH:ubiquinone oxidoreductase 49 kD subunit 7 [Energy production and conversion]; Region: NuoD; COG0649
261594013923	NADH dehydrogenase subunit C; Validated; Region: PRK07735
261594013924	Respiratory-chain NADH dehydrogenase, 30 Kd subunit; Region: Complex1_30kDa; cl16917
261594013925	NADH dehydrogenase subunit B; Validated; Region: PRK06411
261594013926	NADH dehydrogenase subunit A; Validated; Region: PRK07756
261594013927	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
261594013928	PAS domain; Region: PAS_9; pfam13426
261594013929	putative active site [active]
261594013930	heme pocket [chemical binding]; other site
261594013931	c-di-GMP synthetase (diguanylate cyclase, GGDEF domain) [Signal    transduction mechanisms]; Region: COG2199
261594013932	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
261594013933	metal binding site [ion binding]; metal-binding site
261594013934	active site
261594013935	I-site; other site
261594013936	EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2).  The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cd01948
261594013937	Protein of unknown function (DUF975); Region: DUF975; cl10504
261594013938	Protein of unknown function (DUF975); Region: DUF975; cl10504
261594013939	F0F1 ATP synthase subunit epsilon; Validated; Region: atpC; PRK00571
261594013940	mitochondrial ATP synthase delta subunit; Region: F1-ATPase_delta; cd12152
261594013941	gamma subunit interface [polypeptide binding]; other site
261594013942	epsilon subunit interface [polypeptide binding]; other site
261594013943	LBP interface [polypeptide binding]; other site
261594013944	F0F1 ATP synthase subunit beta; Validated; Region: PRK09280
261594013945	ATP synthase alpha/beta family, beta-barrel domain; Region: ATP-synt_ab_N; pfam02874
261594013946	F1 ATP synthase beta subunit, nucleotide-binding domain. The F-ATPase is found in bacterial plasma membranes, mitochondrial inner membranes and in chloroplast thylakoid membranes. It has also been found in the archaea Methanosarcina barkeri. It uses a...; Region: F1-ATPase_beta; cd01133
261594013947	alpha subunit interaction interface [polypeptide binding]; other site
261594013948	Walker A motif; other site
261594013949	ATP binding site [chemical binding]; other site
261594013950	Walker B motif; other site
261594013951	inhibitor binding site; inhibition site
261594013952	ATP synthase alpha/beta chain, C terminal domain; Region: ATP-synt_ab_C; pfam00306
261594013953	mitochondrial ATP synthase gamma subunit; Region: F1-ATPase_gamma; cd12151
261594013954	core domain interface [polypeptide binding]; other site
261594013955	delta subunit interface [polypeptide binding]; other site
261594013956	epsilon subunit interface [polypeptide binding]; other site
261594013957	F0F1 ATP synthase subunit alpha; Validated; Region: PRK09281
261594013958	ATP synthase alpha/beta family, beta-barrel domain; Region: ATP-synt_ab_N; pfam02874
261594013959	F1 ATP synthase alpha, central domain. The F-ATPase is found in bacterial plasma membranes, mitochondrial inner membranes and in chloroplast thylakoid membranes. It has also been found in the archaea Methanosarcina barkeri. It uses a proton gradient to...; Region: F1_ATPase_alpha; cd01132
261594013960	beta subunit interaction interface [polypeptide binding]; other site
261594013961	Walker A motif; other site
261594013962	ATP binding site [chemical binding]; other site
261594013963	Walker B motif; other site
261594013964	ATP synthase alpha/beta chain, C terminal domain; Region: ATP-synt_ab_C; pfam00306
261594013965	F0F1 ATP synthase subunit delta; Validated; Region: PRK05758
261594013966	ATP synthase delta (OSCP) subunit; Region: OSCP; pfam00213
261594013967	F0F1-type ATP synthase, subunit b [Energy production and conversion]; Region: AtpF; COG0711
261594013968	F0F1 ATP synthase subunit B; Validated; Region: PRK05759
261594013969	F0F1 ATP synthase subunit C; Validated; Region: PRK06876
261594013970	F0F1 ATP synthase subunit A; Validated; Region: PRK05815
261594013971	F0F1-type ATP synthase, subunit a [Energy production and conversion]; Region: AtpB; COG0356
261594013972	ATP synthase I chain; Region: ATP_synt_I; pfam03899
261594013973	Putative F0F1-ATPase subunit (ATPase_gene1); Region: ATPase_gene1; cl09754
261594013974	Protein of unknown function (DUF4024); Region: DUF4024; pfam13216
261594013975	Phosphoribosyl transferase (PRT)-type I domain; Region: PRTases_typeI; cd06223
261594013976	active site
261594013977	serine hydroxymethyltransferase; Reviewed; Region: glyA; PRK00011
261594013978	Serine-glycine hydroxymethyltransferase (SHMT). This family belongs to pyridoxal phosphate (PLP)-dependent aspartate aminotransferase superfamily (fold I). SHMT carries out interconversion of serine and glycine; it catalyzes the transfer of hydroxymethyl...; Region: SHMT; cd00378
261594013979	dimer interface [polypeptide binding]; other site
261594013980	active site
261594013981	glycine-pyridoxal phosphate binding site [chemical binding]; other site
261594013982	folate binding site [chemical binding]; other site
261594013983	hypothetical protein; Provisional; Region: PRK13690
261594013984	ribose-5-phosphate isomerase B; Provisional; Region: PRK05571
261594013985	Protein-tyrosine-phosphatase [Signal transduction mechanisms]; Region: Wzb; COG0394
261594013986	Low molecular weight phosphatase family; Region: LMWPc; cd00115
261594013987	active site
261594013988	PTS_IIA, PTS system, glucose/sucrose specific IIA subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes. This family...; Region: PTS_IIA_glc; cd00210
261594013989	HPr interaction site; other site
261594013990	glycerol kinase (GK) interaction site [polypeptide binding]; other site
261594013991	active site
261594013992	phosphorylation site [posttranslational modification]
261594013993	Predicted membrane protein [Function unknown]; Region: COG2259
261594013994	Conserved protein/domain typically associated with flavoprotein oxygenases, DIM6/NTAB family [General function prediction only]; Region: COG1853
261594013995	Protein of unknown function (DUF3935); Region: DUF3935; pfam13071
261594013996	Predicted membrane protein [Function unknown]; Region: COG1971
261594013997	Domain of unknown function DUF; Region: DUF204; pfam02659
261594013998	Domain of unknown function DUF; Region: DUF204; pfam02659
261594013999	Putative translation factor (SUA5) [Translation, ribosomal structure and biogenesis]; Region: SUA5; COG0009
261594014000	Putative GTP-binding controlling metal-binding; Region: SUA5; pfam03481
261594014001	N-Acyltransferase superfamily: Various enzymes that characteristically catalyze the transfer of an acyl group to a substrate; Region: NAT_SF; cl17182
261594014002	Stage II sporulation protein R (spore_II_R); Region: Spore_II_R; pfam09551
261594014003	N5-glutamine S-adenosyl-L-methionine-dependent methyltransferase; Provisional; Region: PRK09328
261594014004	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594014005	S-adenosylmethionine binding site [chemical binding]; other site
261594014006	peptide chain release factor 1; Validated; Region: prfA; PRK00591
261594014007	This domain is found in peptide chain release factors; Region: PCRF; smart00937
261594014008	RF-1 domain; Region: RF-1; pfam00472
261594014009	thymidine kinase; Provisional; Region: PRK04296
261594014010	50S ribosomal protein L31 type B; Reviewed; Region: rpmE2; PRK01678
261594014011	transcription termination factor Rho; Provisional; Region: rho; PRK09376
261594014012	Rho termination factor, N-terminal domain; Region: Rho_N; smart00959
261594014013	Rho_CSD: Rho protein cold-shock domain (CSD). Rho protein is a transcription termination factor in most bacteria. In bacteria, there are two distinct mechanisms for mRNA transcription termination. In intrinsic termination, RNA polymerase and nascent mRNA...; Region: Rho_CSD; cd04459
261594014014	RNA binding site [nucleotide binding]; other site
261594014015	Transcription termination factor rho is a bacterial ATP-dependent RNA/DNA helicase. It is a homohexamer. Each monomer consists of an N-terminal domain of the OB fold, which is responsible for binding to cysteine rich nucleotides. This alignment is of the...; Region: rho_factor; cd01128
261594014016	multimer interface [polypeptide binding]; other site
261594014017	Walker A motif; other site
261594014018	ATP binding site [chemical binding]; other site
261594014019	Walker B motif; other site
261594014020	Bacterial fructose-1,6-bisphosphatase, glpX-encoded. A dimeric enzyme dependent on Mg(2+). glpX-encoded FPBase (FBPase class II) differs from other members of the inositol-phosphatase superfamily by permutation of secondary structure elements. The core...; Region: FBPase_glpX; cd01516
261594014021	Bacterial fructose-1,6-bisphosphatase, glpX-encoded; Region: FBPase_glpX; pfam03320
261594014022	putative active site [active]
261594014023	UDP-N-acetylglucosamine 1-carboxyvinyltransferase; Region: murA; TIGR01072
261594014024	UDP-N-acetylglucosamine enolpyruvyl transferase catalyzes enolpyruvyl transfer as part of the first step in the biosynthesis of peptidoglycan, a component of the bacterial cell wall. The reaction is phosphoenolpyruvate + UDP-N-acetyl-D-glucosamine =...; Region: UdpNAET; cd01555
261594014025	hinge; other site
261594014026	active site
261594014027	fructose-bisphosphate aldolase; Provisional; Region: PRK09197
261594014028	Tagatose-1,6-bisphosphate (TBP) aldolase and related Type B Class II aldolases. TBP aldolase is a tetrameric class II aldolase that catalyzes the reversible condensation of dihydroxyacetone phosphate with glyceraldehyde 3-phsophate to produce tagatose 1; Region: TBP_aldolase_IIB; cd00947
261594014029	intersubunit interface [polypeptide binding]; other site
261594014030	active site
261594014031	zinc binding site [ion binding]; other site
261594014032	Na+ binding site [ion binding]; other site
261594014033	Response regulator receiver domain; Region: Response_reg; pfam00072
261594014034	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594014035	active site
261594014036	phosphorylation site [posttranslational modification]
261594014037	intermolecular recognition site; other site
261594014038	dimerization interface [polypeptide binding]; other site
261594014039	Protein of unknown function (DUF2529); Region: DUF2529; pfam10740
261594014040	CTP synthetase; Validated; Region: pyrG; PRK05380
261594014041	CTP synthetase (CTPs) is a two-domain protein, which consists of an N-terminal synthetase domain and C-terminal glutaminase domain. The enzymes hydrolyze the amide bond of glutamine to ammonia and glutamate at the glutaminase domains and transfer nascent...; Region: CTGs; cd03113
261594014042	Catalytic site [active]
261594014043	active site
261594014044	UTP binding site [chemical binding]; other site
261594014045	Type 1 glutamine amidotransferase (GATase1) domain found in Cytidine Triphosphate Synthetase; Region: GATase1_CTP_Synthase; cd01746
261594014046	active site
261594014047	putative oxyanion hole; other site
261594014048	catalytic triad [active]
261594014049	DNA-directed RNA polymerase delta subunit; Region: RNA_pol_delta; pfam05066
261594014050	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
261594014051	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
261594014052	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
261594014053	Short chain acyl-CoA dehydrogenases and eukaryotic short/branched chain acyl-CoA dehydrogenases; Region: SCAD_SBCAD; cd01158
261594014054	FAD binding site [chemical binding]; other site
261594014055	homotetramer interface [polypeptide binding]; other site
261594014056	substrate binding pocket [chemical binding]; other site
261594014057	catalytic base [active]
261594014058	Acyl-CoA dehydrogenases [Lipid metabolism]; Region: CaiA; COG1960
261594014059	Short chain acyl-CoA dehydrogenases and eukaryotic short/branched chain acyl-CoA dehydrogenases; Region: SCAD_SBCAD; cd01158
261594014060	FAD binding site [chemical binding]; other site
261594014061	homotetramer interface [polypeptide binding]; other site
261594014062	substrate binding pocket [chemical binding]; other site
261594014063	catalytic base [active]
261594014064	3-hydroxybutyryl-CoA dehydrogenase; Validated; Region: PRK05808
261594014065	3-hydroxyacyl-CoA dehydrogenase, NAD binding domain; Region: 3HCDH_N; pfam02737
261594014066	3-hydroxyacyl-CoA dehydrogenase, C-terminal domain; Region: 3HCDH; pfam00725
261594014067	acetyl-CoA acetyltransferase; Provisional; Region: PRK08235
261594014068	Thiolase are ubiquitous enzymes that catalyze the reversible thiolytic cleavage of 3-ketoacyl-CoA into acyl-CoA and acetyl-CoA, a 2-step reaction involving a covalent intermediate formed with a catalytic cysteine. They are found in prokaryotes and...; Region: thiolase; cd00751
261594014069	dimer interface [polypeptide binding]; other site
261594014070	active site
261594014071	Fe-S oxidoreductase [Energy production and conversion]; Region: GlpC; COG0247
261594014072	4Fe-4S binding domain; Region: Fer4; cl02805
261594014073	Cysteine-rich domain; Region: CCG; pfam02754
261594014074	Cysteine-rich domain; Region: CCG; pfam02754
261594014075	Catalytic domain, repeat 1, of bacterial cardiolipin synthase and similar proteins; Region: PLDc_CLS_1; cd09110
261594014076	PLD-like domain; Region: PLDc_2; pfam13091
261594014077	putative active site [active]
261594014078	catalytic site [active]
261594014079	catalytic domain repeat 2 of bacterial cardiolipin synthase and similar proteins; Region: PLDc_CLS_2; cd09112
261594014080	PLD-like domain; Region: PLDc_2; pfam13091
261594014081	putative active site [active]
261594014082	catalytic site [active]
261594014083	putative UV damage endonuclease; Provisional; Region: uvsE; PRK02308
261594014084	Domain of unknown function (DUF4084); Region: DUF4084; pfam13321
261594014085	PAS domain S-box; Region: sensory_box; TIGR00229
261594014086	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
261594014087	putative active site [active]
261594014088	heme pocket [chemical binding]; other site
261594014089	c-di-GMP synthetase (diguanylate cyclase, GGDEF domain) [Signal    transduction mechanisms]; Region: COG2199
261594014090	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
261594014091	metal binding site [ion binding]; metal-binding site
261594014092	active site
261594014093	I-site; other site
261594014094	EAL domain. This domain is found in diverse bacterial signaling proteins. It is called EAL after its conserved residues and is also known as domain of unknown function 2 (DUF2).  The EAL domain has been shown to stimulate degradation of a second...; Region: EAL; cd01948
261594014095	Bacillus PapR protein; Region: Bacillus_PapR; pfam05968
261594014096	Response regulator containing a CheY-like receiver domain and an HTH DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: CitB; COG2197
261594014097	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594014098	active site
261594014099	phosphorylation site [posttranslational modification]
261594014100	intermolecular recognition site; other site
261594014101	dimerization interface [polypeptide binding]; other site
261594014102	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
261594014103	DNA binding residues [nucleotide binding]
261594014104	dimerization interface [polypeptide binding]; other site
261594014105	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: COG4585
261594014106	Histidine kinase; Region: HisKA_3; pfam07730
261594014107	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594014108	ATP binding site [chemical binding]; other site
261594014109	Mg2+ binding site [ion binding]; other site
261594014110	G-X-G motif; other site
261594014111	ABC-2 family transporter protein; Region: ABC2_membrane_2; cl17866
261594014112	ABC-type multidrug transport system, permease component [Defense mechanisms]; Region: COG0842
261594014113	ABC-type multidrug transport system, ATPase component [Defense mechanisms]; Region: CcmA; COG1131
261594014114	ATP-binding cassette domain of the drug resistance transporter and related proteins, subfamily A; Region: ABC_DR_subfamily_A; cd03230
261594014115	Walker A/P-loop; other site
261594014116	ATP binding site [chemical binding]; other site
261594014117	Q-loop/lid; other site
261594014118	ABC transporter signature motif; other site
261594014119	Walker B; other site
261594014120	D-loop; other site
261594014121	H-loop/switch region; other site
261594014122	Methionine Aminopeptidase 1. E.C. 3.4.11.18. Also known as methionyl aminopeptidase and Peptidase M. Catalyzes release of N-terminal amino acids, preferentially methionine, from peptides and arylamides; Region: MetAP1; cd01086
261594014123	active site
261594014124	Zinc peptidases M18, M20, M28, and M42; Region: Zinc_peptidase_like; cl14876
261594014125	PA: Protease-associated (PA) domain. The PA domain is an insert domain in a diverse fraction of proteases. The significance of the PA domain to many of the proteins in which it is inserted is undetermined. It may be a protein-protein interaction domain; Region: PA; cd00538
261594014126	PA/protease or protease-like domain interface [polypeptide binding]; other site
261594014127	M28 Zn-peptidases include aminopeptidases and carboxypeptidases; Region: M28; cd02690
261594014128	Peptidase family M28; Region: Peptidase_M28; pfam04389
261594014129	metal binding site [ion binding]; metal-binding site
261594014130	RNA polymerase sigma factor; Provisional; Region: PRK12522
261594014131	Sigma-70 region 2; Region: Sigma70_r2; pfam04542
261594014132	Sigma70, region (SR) 4 refers to the most C-terminal of four conserved domains found in Escherichia coli (Ec) sigma70, the main housekeeping sigma, and related sigma-factors (SFs). A SF is a dissociable subunit of RNA polymerase, it directs bacterial or...; Region: Sigma70_r4; cd06171
261594014133	DNA binding residues [nucleotide binding]
261594014134	arginyl-tRNA synthetase; Reviewed; Region: argS; PRK01611
261594014135	Arginyl tRNA synthetase N terminal dom; Region: Arg_tRNA_synt_N; smart01016
261594014136	catalytic core domain of arginyl-tRNA synthetases; Region: ArgRS_core; cd00671
261594014137	active site
261594014138	HIGH motif; other site
261594014139	KMSK motif region; other site
261594014140	Anticodon-binding domain of class Ia aminoacyl tRNA synthetases and similar domains; Region: Anticodon_Ia_like; cl12020
261594014141	tRNA binding surface [nucleotide binding]; other site
261594014142	anticodon binding site; other site
261594014143	Domain of unknown function (DUF1934); Region: DUF1934; pfam09148
261594014144	Microcin C7 self-immunity protein determines resistance to exogenous microcin C7; Region: Peptidase_S66_mccF_like; cd07062
261594014145	putative dimer interface [polypeptide binding]; other site
261594014146	catalytic triad [active]
261594014147	Protein of unknown function (DUF1093); Region: DUF1093; pfam06486
261594014148	Phosphotransferase system, EIIC; Region: PTS_EIIC_2; pfam13303
261594014149	Phosphotransferase system, fructose-specific IIC component [Carbohydrate transport and metabolism]; Region: FruA; cl17425
261594014150	agmatinase; Region: agmatinase; TIGR01230
261594014151	Agmatinase and related proteins; Region: Agmatinase-like_2; cd11593
261594014152	putative active site [active]
261594014153	Mn binding site [ion binding]; other site
261594014154	spermidine synthase; Provisional; Region: PRK00811
261594014155	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594014156	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594014157	Major Facilitator Superfamily; Region: MFS_1; pfam07690
261594014158	putative substrate translocation pore; other site
261594014159	Predicted transcriptional regulators [Transcription]; Region: SoxR; COG0789
261594014160	Helix-Turn-Helix DNA binding domain of the YfmP transcription regulator; Region: HTH_YfmP; cd04774
261594014161	DNA binding residues [nucleotide binding]
261594014162	putative dimer interface [polypeptide binding]; other site
261594014163	Glycerophosphoryl diester phosphodiesterase [Energy production and conversion]; Region: UgpQ; COG0584
261594014164	Glycerophosphodiester phosphodiesterase domain of Thermoanaerobacter tengcongensis and similar proteins; Region: GDPD_TtGDE_like; cd08563
261594014165	active site
261594014166	catalytic site [active]
261594014167	metal binding site [ion binding]; metal-binding site
261594014168	dimer interface [polypeptide binding]; other site
261594014169	Transglycosylase; Region: Transgly; pfam00912
261594014170	penicillin-binding protein, 1A family; Region: PBP_1a_fam; TIGR02074
261594014171	Penicillin binding protein transpeptidase domain; Region: Transpeptidase; pfam00905
261594014172	YwhD family; Region: YwhD; pfam08741
261594014173	Uncharacterized homologs of Site-2 protease (S2P), zinc metalloproteases (MEROPS family M50) which cleave transmembrane domains of substrate proteins, regulating intramembrane proteolysis (RIP) of diverse signal transduction mechanisms. Members of the...; Region: S2P-M50_like_1; cd06158
261594014174	Peptidase family M50; Region: Peptidase_M50; pfam02163
261594014175	active site
261594014176	putative substrate binding region [chemical binding]; other site
261594014177	4-Oxalocrotonate Tautomerase:  Catalyzes the isomerization of unsaturated ketones. The structure is a homohexamer that is arranged as a trimer of dimers. The hexamer contains six active sites, each formed by residues from three monomers, two from one...; Region: 4Oxalocrotonate_Tautomerase; cd00491
261594014178	active site 1 [active]
261594014179	dimer interface [polypeptide binding]; other site
261594014180	hexamer interface [polypeptide binding]; other site
261594014181	active site 2 [active]
261594014182	HD superfamily phosphohydrolases [General function prediction only]; Region: COG1078
261594014183	Metal dependent phosphohydrolases with conserved 'HD' motif; Region: HDc; cd00077
261594014184	Zn2+ binding site [ion binding]; other site
261594014185	Mg2+ binding site [ion binding]; other site
261594014186	ABC-type Fe3+-hydroxamate transport system, periplasmic component [Inorganic ion transport and metabolism]; Region: FepB; COG0614
261594014187	Helical backbone metal receptor (TroA-like domain). These proteins have been shown to function in the ABC transport of ferric siderophores and metal ions such as Mn2+, Fe3+, Cu2+ and/or Zn2+.  Their ligand binding site is formed in the interface between...; Region: TroA-like; cl00262
261594014188	intersubunit interface [polypeptide binding]; other site
261594014189	ABC-type cobalamin/Fe3+-siderophores transport systems, ATPase components [Inorganic ion transport and metabolism / Coenzyme metabolism]; Region: FepC; COG1120
261594014190	ATP-binding component of iron-siderophores, vitamin B12 and hemin transporters and related proteins; Region: ABC_Iron-Siderophores_B12_Hemin; cd03214
261594014191	Walker A/P-loop; other site
261594014192	ATP binding site [chemical binding]; other site
261594014193	Q-loop/lid; other site
261594014194	ABC transporter signature motif; other site
261594014195	Walker B; other site
261594014196	D-loop; other site
261594014197	H-loop/switch region; other site
261594014198	iron-hydroxamate transporter permease subunit; Provisional; Region: PRK10577
261594014199	Transmembrane subunit (TM), of Periplasmic Binding Protein (PBP)-dependent ATP-Binding Cassette (ABC) transporters involved in the uptake of siderophores, heme, vitamin B12, or the divalent cations Mg2+ and Zn2+. PBP-dependent ABC transporters consist of...; Region: TM_ABC_iron-siderophores_like; cd06550
261594014200	ABC-ATPase subunit  interface; other site
261594014201	dimer interface [polypeptide binding]; other site
261594014202	putative PBP binding regions; other site
261594014203	Protein of unknown function (DUF1450); Region: DUF1450; cl11488
261594014204	putative spore coat protein regulator protein YlbO; Provisional; Region: PRK13923
261594014205	transcription factor, RsfA family; Region: DNA_bind_RsfA; TIGR02894
261594014206	hypothetical protein; Provisional; Region: PRK12473
261594014207	Lipoate-protein ligase A [Coenzyme metabolism]; Region: LplA; COG0095
261594014208	phosphotransacetylase; Reviewed; Region: eutD; PRK09653
261594014209	putative heme peroxidase; Provisional; Region: PRK12276
261594014210	D-alanyl-D-alanine carboxypeptidase; Region: Peptidase_S11; pfam00768
261594014211	Beta-lactamase enzyme family; Region: Beta-lactamase2; cl17872
261594014212	Penicillin-binding protein 5, C-terminal domain; Region: PBP5_C; pfam07943
261594014213	Cell wall hydrolyses involved in spore germination [Cell envelope biogenesis, outer membrane]; Region: SleB; COG3773
261594014214	Cell Wall Hydrolase; Region: Hydrolase_2; pfam07486
261594014215	Spore coat protein (Spore_GerQ); Region: Spore_GerQ; pfam09671
261594014216	Uncharacterized small membrane protein [Function unknown]; Region: COG2363
261594014217	putative uracil/xanthine transporter; Provisional; Region: PRK11412
261594014218	haloacid dehalogenase-like hydrolase; Region: Hydrolase_3; pfam08282
261594014219	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
261594014220	motif II; other site
261594014221	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
261594014222	Domain of unknown function (DUF3817); Region: DUF3817; pfam12823
261594014223	Family 1 of Uracil-DNA glycosylase (UDG) enzymes; Region: UDG_F1; cd10027
261594014224	ligand binding site [chemical binding]; other site
261594014225	active site
261594014226	UGI interface [polypeptide binding]; other site
261594014227	catalytic site [active]
261594014228	ABC-2 family transporter protein; Region: ABC2_membrane_3; pfam12698
261594014229	60Kd inner membrane protein; Region: 60KD_IMP; cl00489
261594014230	ABC-type transport system involved in multi-copper enzyme maturation, permease component [General function prediction only]; Region: NosY; COG1277
261594014231	ABC-2 family transporter protein; Region: ABC2_membrane_4; pfam12730
261594014232	ABC-type multidrug transport system, ATPase component [Defense mechanisms]; Region: CcmA; COG1131
261594014233	ATP-binding cassette domain of the bacitracin-resistance transporter; Region: ABC_BcrA_bacitracin_resist; cd03268
261594014234	Walker A/P-loop; other site
261594014235	ATP binding site [chemical binding]; other site
261594014236	Q-loop/lid; other site
261594014237	ABC transporter signature motif; other site
261594014238	Walker B; other site
261594014239	D-loop; other site
261594014240	H-loop/switch region; other site
261594014241	Members of the SGNH-hydrolase superfamily, a diverse family of lipases and esterases. The tertiary fold of the enzyme is substantially different from that of the alpha/beta hydrolase family and unique among all known hydrolases; its active site closely...; Region: SGNH_hydrolase_YpmR_like; cd04506
261594014242	active site
261594014243	catalytic triad [active]
261594014244	oxyanion hole [active]
261594014245	Transcriptional regulators [Transcription]; Region: PurR; COG1609
261594014246	Helix-turn-helix (HTH) DNA binding domain of the LacI family of transcriptional regulators; Region: HTH_LacI; cd01392
261594014247	DNA binding site [nucleotide binding]
261594014248	domain linker motif; other site
261594014249	Ligand-binding domain of a novel transcription factor implicated in catabolite repression in Bacillus and Clostridium species; Region: PBP1_CcpB_like; cd06286
261594014250	putative dimerization interface [polypeptide binding]; other site
261594014251	putative ligand binding site [chemical binding]; other site
261594014252	Predicted membrane protein [Function unknown]; Region: COG2364
261594014253	homoserine dehydrogenase; Provisional; Region: PRK06349
261594014254	Homoserine dehydrogenase, NAD binding domain; Region: NAD_binding_3; pfam03447
261594014255	Homoserine dehydrogenase; Region: Homoserine_dh; pfam00742
261594014256	ACT_HSDH_Hom CD includes the C-terminal ACT domain of the NAD(P)H-dependent, homoserine dehydrogenase (HSDH) and related domains; Region: ACT_HSDH-Hom; cd04881
261594014257	homoserine O-succinyltransferase; Provisional; Region: PRK05368
261594014258	Type 1 glutamine amidotransferase (GATase1)-like domain found in homoserine trans-succinylase (HTS); Region: GATase1_HTS; cd03131
261594014259	proposed active site lysine [active]
261594014260	conserved cys residue [active]
261594014261	O-acetylhomoserine aminocarboxypropyltransferase; Validated; Region: PRK06702
261594014262	CGS_like: Cystathionine gamma-synthase is a PLP dependent enzyme and catalyzes the committed step of methionine biosynthesis. This pathway is unique to microorganisms and plants, rendering the enzyme an attractive target for the development of...; Region: CGS_like; cd00614
261594014263	homodimer interface [polypeptide binding]; other site
261594014264	substrate-cofactor binding pocket; other site
261594014265	pyridoxal 5'-phosphate binding site [chemical binding]; other site
261594014266	catalytic residue [active]
261594014267	Chloride channel protein EriC [Inorganic ion transport and metabolism]; Region: EriC; COG0038
261594014268	CLC voltage-gated chloride channel. The ClC chloride channels catalyse the selective flow of Cl- ions across cell membranes, thereby regulating electrical excitation in skeletal muscle and the flow of salt and water across epithelial barriers. This...; Region: Voltage_gated_ClC; cd00400
261594014269	Cl- selectivity filter; other site
261594014270	Cl- binding residues [ion binding]; other site
261594014271	pore gating glutamate residue; other site
261594014272	HAD superfamily (subfamily IA) hydrolase, TIGR02254; Region: YjjG/YfnB
261594014273	Haloacid dehalogenase-like hydrolases. The haloacid dehalogenase-like (HAD) superfamily includes L-2-haloacid dehalogenase, epoxide hydrolase, phosphoserine phosphatase, phosphomannomutase, phosphoglycolate phosphatase, P-type ATPase, and many others; Region: HAD_like; cd01427
261594014274	active site
261594014275	motif I; other site
261594014276	motif II; other site
261594014277	DNA-binding transcriptional activator YeiL; Provisional; Region: PRK10402
261594014278	effector domain of the CAP family of transcription factors; members include CAP (or cAMP receptor protein (CRP)), which binds cAMP, FNR (fumarate and nitrate reduction), which uses an iron-sulfur cluster to sense oxygen) and CooA, a heme containing CO...; Region: CAP_ED; cd00038
261594014279	ligand binding site [chemical binding]; other site
261594014280	flexible hinge region; other site
261594014281	helix_turn_helix, cAMP Regulatory protein C-terminus; DNA binding domain of prokaryotic regulatory proteins belonging to the catabolite activator protein family; Region: HTH_CRP; cl17320
261594014282	azoreductase; Provisional; Region: PRK13556
261594014283	Response regulator containing a CheY-like receiver domain and an HTH DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: CitB; COG2197
261594014284	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594014285	active site
261594014286	phosphorylation site [posttranslational modification]
261594014287	intermolecular recognition site; other site
261594014288	dimerization interface [polypeptide binding]; other site
261594014289	C-terminal DNA-binding domain of LuxR-like proteins. This domain contains a helix-turn-helix motif and binds DNA. Proteins belonging to this group are response regulators; some act as transcriptional activators, others as transcriptional repressors. Many...; Region: LuxR_C_like; cd06170
261594014290	DNA binding residues [nucleotide binding]
261594014291	dimerization interface [polypeptide binding]; other site
261594014292	4-amino-5-hydroxymethyl-2-methyl-pyrimidine phosphate kinase (HMPP-kinase) catalyzes two consecutive phosphorylation steps in the thiamine phosphate biosynthesis pathway, leading to the synthesis of vitamin B1. The first step is the phosphorylation of...; Region: HMPP_kinase; cd01169
261594014293	dimer interface [polypeptide binding]; other site
261594014294	substrate binding site [chemical binding]; other site
261594014295	ATP binding site [chemical binding]; other site
261594014296	5TMR of 5TMR-LYT; Region: 5TM-5TMR_LYT; pfam07694
261594014297	c-di-GMP synthetase (diguanylate cyclase, GGDEF domain) [Signal    transduction mechanisms]; Region: COG2199
261594014298	Diguanylate-cyclase (DGC) or GGDEF domain; Region: GGDEF; cd01949
261594014299	metal binding site [ion binding]; metal-binding site
261594014300	active site
261594014301	I-site; other site
261594014302	Protein of unknown function (DUF466); Region: DUF466; pfam04328
261594014303	carbon starvation protein A; Provisional; Region: PRK15015
261594014304	Carbon starvation protein CstA; Region: CstA; pfam02554
261594014305	C-terminal domain on CstA (DUF4161); Region: DUF4161; pfam13722
261594014306	Response regulator of the LytR/AlgR family [Transcription / Signal transduction mechanisms]; Region: LytT; COG3279
261594014307	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594014308	active site
261594014309	phosphorylation site [posttranslational modification]
261594014310	intermolecular recognition site; other site
261594014311	dimerization interface [polypeptide binding]; other site
261594014312	LytTr DNA-binding domain; Region: LytTR; pfam04397
261594014313	benzoate transport; Region: 2A0115; TIGR00895
261594014314	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594014315	putative substrate translocation pore; other site
261594014316	Teichoic acid biosynthesis proteins [Cell envelope biogenesis, outer membrane]; Region: WecG; COG1922
261594014317	The glycosyltransferase WecG/TagA superfamily contains Escherichia coli WecG, Bacillus subtilis TagA and related proteins. E. coli WecG is believed to be a UDP-N-acetyl-D-mannosaminuronic acid transferase, and is involved in enterobacterial common...; Region: Glyco_transf_WecG_TagA; cd06533
261594014318	Glycosyltransferase [Cell envelope biogenesis, outer membrane]; Region: RfaG; COG0438
261594014319	This family is most closely related to the GT1 family of glycosyltransferases and named after YqgM in Bacillus licheniformis about which little is known. Glycosyltransferases catalyze the transfer of sugar moieties from activated donor molecules to...; Region: GT1_YqgM_like; cd03801
261594014320	Predicted membrane protein [Function unknown]; Region: COG2860
261594014321	UPF0126 domain; Region: UPF0126; pfam03458
261594014322	UPF0126 domain; Region: UPF0126; pfam03458
261594014323	Globin domain present in Globin-Coupled-Sensors (GCS). These domains detect changes in intracellular concentrations of oxygen, carbon monoxyde, or nitrous oxide,  which result in aerotaxis and/or gene regulation. One subgroup, the HemATs, are aerotactic...; Region: sensor_globin; cd01068
261594014324	heme-binding site [chemical binding]; other site
261594014325	Methyl-accepting chemotaxis-like domains (chemotaxis sensory transducer); Region: MA; smart00283
261594014326	Methyl-accepting chemotaxis protein (MCP), signaling domain; Region: MCP_signal; cd11386
261594014327	dimer interface [polypeptide binding]; other site
261594014328	putative CheW interface [polypeptide binding]; other site
261594014329	Dolichyl-phosphate-mannose-protein mannosyltransferase; Region: PMT_2; pfam13231
261594014330	Brown fat-inducible thioesterase (BFIT).  Brain acyl-CoA hydrolase (BACH).  These enzymes deacylate long-chain fatty acids by hydrolyzing acyl-CoA thioesters to free fatty acids and CoA-SH. Eukaryotic members of this family are expressed in brain, testis; Region: BFIT_BACH; cd03442
261594014331	Membrane protein involved in the export of O-antigen and teichoic acid [General function prediction only]; Region: RfbX; COG2244
261594014332	Wzx, a subfamily of the multidrug and toxic compound extrusion (MATE)-like proteins; Region: MATE_Wzx_like; cd13128
261594014333	Predicted glycosyltransferases [General function prediction only]; Region: COG1216
261594014334	Glycosyltransferase family A (GT-A) includes diverse families of glycosyl transferases with a common GT-A type structural fold; Region: Glyco_tranf_GTA_type; cd00761
261594014335	active site
261594014336	ATPase components of ABC transporters with duplicated ATPase domains [General function prediction only]; Region: Uup; COG0488
261594014337	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
261594014338	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
261594014339	ABC transporter; Region: ABC_tran_2; pfam12848
261594014340	ATP-binding cassette domain of elongation factor 3, subfamily F; Region: ABCF_EF-3; cd03221
261594014341	Dolichyl-phosphate-mannose-protein mannosyltransferase; Region: PMT_2; pfam13231
261594014342	Predicted membrane protein [Function unknown]; Region: COG2246
261594014343	GtrA-like protein; Region: GtrA; pfam04138
261594014344	undecaprenyl phosphate 4-deoxy-4-formamido-L-arabinose transferase; Provisional; Region: PRK10714
261594014345	Bacterial DPM1_like enzymes are related to eukaryotic DPM1; Region: DPM1_like_bac; cd04187
261594014346	Ligand binding site; other site
261594014347	Putative Catalytic site; other site
261594014348	DXD motif; other site
261594014349	Transcriptional regulator [Transcription]; Region: AcrR; COG1309
261594014350	Bacterial regulatory proteins, tetR family; Region: TetR_N; pfam00440
261594014351	Cation/multidrug efflux pump [Defense mechanisms]; Region: AcrB; COG0841
261594014352	Protein export membrane protein; Region: SecD_SecF; cl14618
261594014353	Peptide methionine sulfoxide reductase [Posttranslational modification, protein turnover, chaperones]; Region: MsrA; COG0225
261594014354	methionine sulfoxide reductase B; Provisional; Region: PRK00222
261594014355	SelR domain; Region: SelR; pfam01641
261594014356	Predicted permease, member of the PurR regulon [General function prediction only]; Region: yhhT; COG0628
261594014357	antiholin-like protein LrgB; Provisional; Region: PRK04288
261594014358	murein hydrolase regulator LrgA; Provisional; Region: PRK04125
261594014359	Response regulator of the LytR/AlgR family [Transcription / Signal transduction mechanisms]; Region: LytT; COG3279
261594014360	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594014361	active site
261594014362	phosphorylation site [posttranslational modification]
261594014363	intermolecular recognition site; other site
261594014364	dimerization interface [polypeptide binding]; other site
261594014365	LytTr DNA-binding domain; Region: LytTR; pfam04397
261594014366	Putative regulator of cell autolysis [Signal transduction mechanisms]; Region: LytS; COG3275
261594014367	5TMR of 5TMR-LYT; Region: 5TM-5TMR_LYT; pfam07694
261594014368	Domain present in phytochromes and cGMP-specific phosphodiesterases; Region: GAF; smart00065
261594014369	Histidine kinase; Region: His_kinase; pfam06580
261594014370	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594014371	ATP binding site [chemical binding]; other site
261594014372	Mg2+ binding site [ion binding]; other site
261594014373	G-X-G motif; other site
261594014374	benzoate transport; Region: 2A0115; TIGR00895
261594014375	The Major Facilitator Superfamily (MFS) is a large and diverse group of secondary transporters that includes uniporters, symporters, and antiporters. MFS proteins facilitate the transport across cytoplasmic or internal membranes of a variety of...; Region: MFS; cd06174
261594014376	putative substrate translocation pore; other site
261594014377	BCCT family transporter; Region: BCCT; pfam02028
261594014378	Nitric oxide synthase (NOS) produces nitric oxide (NO) by catalyzing a five-electron heme-based oxidation of a guanidine nitrogen of L-arginine to L-citrulline via two successive monooxygenation reactions producing N(omega)-hydroxy-L-arginine (NHA) as an...; Region: NOS_oxygenase; cd00575
261594014379	active site
261594014380	dimer interface [polypeptide binding]; other site
261594014381	Superoxide dismutase [Inorganic ion transport and metabolism]; Region: SodA; COG0605
261594014382	Iron/manganese superoxide dismutases, alpha-hairpin domain; Region: Sod_Fe_N; pfam00081
261594014383	Iron/manganese superoxide dismutases, C-terminal domain; Region: Sod_Fe_C; pfam02777
261594014384	Nucleoside-diphosphate-sugar epimerases [Cell envelope biogenesis, outer membrane / Carbohydrate transport and metabolism]; Region: WcaG; COG0451
261594014385	Rossmann-fold NAD(P)(+)-binding proteins; Region: NADB_Rossmann; cl09931
261594014386	NAD(P) binding site [chemical binding]; other site
261594014387	active site
261594014388	AmiS/UreI family transporter; Region: AmiS_UreI; pfam02293
261594014389	UDP-glucose 4 epimerase, subgroup 1, extended (e) SDRs; Region: UDP_G4E_1_SDR_e; cd05247
261594014390	UDP-glucose 4-epimerase; Region: PLN02240
261594014391	NAD binding site [chemical binding]; other site
261594014392	homodimer interface [polypeptide binding]; other site
261594014393	active site
261594014394	substrate binding site [chemical binding]; other site
261594014395	channel protein, hemolysin III family; Region: hlyIII; TIGR01065
261594014396	Predicted membrane protein, hemolysin III homolog [General function prediction only]; Region: COG1272
261594014397	Domain of unknown function (DUF1836); Region: DUF1836; pfam08876
261594014398	Superfamily II DNA and RNA helicases [DNA replication, recombination, and repair / Transcription / Translation, ribosomal structure and biogenesis]; Region: SrmB; COG0513
261594014399	DEAD-box helicases. A diverse family of proteins involved in ATP-dependent RNA unwinding, needed in a variety of cellular processes including splicing, ribosome biogenesis and RNA degradation. The name derives from the sequence of the Walker  B motif; Region: DEADc; cd00268
261594014400	ATP binding site [chemical binding]; other site
261594014401	Mg++ binding site [ion binding]; other site
261594014402	motif III; other site
261594014403	Helicase superfamily c-terminal domain; associated with DEXDc-, DEAD-, and DEAH-box proteins, yeast initiation factor 4A, Ski2p, and Hepatitis C virus NS3 helicases; this domain is found in a wide variety of helicases and helicase related proteins; may...; Region: HELICc; cd00079
261594014404	nucleotide binding region [chemical binding]; other site
261594014405	ATP-binding site [chemical binding]; other site
261594014406	RNA recognition motif in Bacillus subtilis ATP-dependent RNA helicase YxiN and similar proteins; Region: RRM_BsYxiN_like; cd12500
261594014407	RNA binding site [nucleotide binding]; other site
261594014408	Predicted O-acyltransferase [General function prediction only]; Region: COG3274
261594014409	Acyltransferase family; Region: Acyl_transf_3; pfam01757
261594014410	guanosine 5'-monophosphate oxidoreductase; Provisional; Region: PRK05458
261594014411	IMPDH: The catalytic domain of the inosine monophosphate dehydrogenase. IMPDH catalyzes the NAD-dependent oxidation of inosine 5'-monophosphate (IMP) to xanthosine 5' monophosphate (XMP). It is a rate-limiting step in the de novo synthesis of...; Region: IMPDH; cd00381
261594014412	active site
261594014413	oligoendopeptidase F; Region: pepF; TIGR00181
261594014414	Peptidase family M3B Oligopeptidase F (PepF); Region: M3B_PepF_4; cd09609
261594014415	active site
261594014416	Zn binding site [ion binding]; other site
261594014417	Radical SAM superfamily. Enzymes of this family generate radicals by combining a 4Fe-4S cluster and S-adenosylmethionine (SAM) in close proximity. They are characterized by a conserved CxxxCxxC motif, which coordinates the conserved iron-sulfur cluster; Region: Radical_SAM; cd01335
261594014418	FeS/SAM binding site; other site
261594014419	Domain of unknown function (DUF4008); Region: DUF4008; pfam13186
261594014420	rRNA large subunit methyltransferase; Provisional; Region: PRK00103
261594014421	CxxH/CxxC protein, BA_5709 family; Region: CxxH_BA5709; TIGR04129
261594014422	Trypsin-like serine proteases, typically periplasmic, contain C-terminal PDZ domain [Posttranslational modification, protein turnover, chaperones]; Region: DegQ; COG0265
261594014423	Trypsin-like peptidase domain; Region: Trypsin_2; pfam13365
261594014424	PDZ domain of tryspin-like serine proteases, such as DegP/HtrA, which are oligomeric proteins involved in heat-shock response, chaperone function, and apoptosis. May be responsible for substrate recognition and/or binding, as most PDZ domains bind...; Region: PDZ_serine_protease; cd00987
261594014425	protein binding site [polypeptide binding]; other site
261594014426	Metal-dependent hydrolases of the beta-lactamase superfamily I [General function prediction only]; Region: PhnP; COG1235
261594014427	YycH protein; Region: YycI; pfam09648
261594014428	Uncharacterized protein conserved in bacteria [Function unknown]; Region: COG4863
261594014429	YycH protein; Region: YycH; pfam07435
261594014430	heavy metal sensor kinase; Region: cztS_silS_copS; TIGR01386
261594014431	Signal transduction histidine kinase [Signal transduction mechanisms]; Region: VicK; COG5002
261594014432	Histidine kinase, Adenylyl cyclase, Methyl-accepting protein, and Phosphatase (HAMP) domain. HAMP is a signaling domain which occurs in a wide variety of signaling proteins, many of which are bacterial. The HAMP domain consists of two alpha helices...; Region: HAMP; cd06225
261594014433	dimerization interface [polypeptide binding]; other site
261594014434	PAS domain; PAS motifs appear in archaea, eubacteria and eukarya. Probably the most surprising identification of a PAS domain was that in EAG-like K+-channels. PAS domains have been found to bind ligands, and to act as sensors for light and oxygen in...; Region: PAS; cd00130
261594014435	putative active site [active]
261594014436	heme pocket [chemical binding]; other site
261594014437	Histidine Kinase A (dimerization/phosphoacceptor) domain; Histidine Kinase A dimers are formed through parallel association of 2 domains creating 4-helix bundles; usually these domains contain a conserved His residue and are activated via...; Region: HisKA; cd00082
261594014438	dimer interface [polypeptide binding]; other site
261594014439	phosphorylation site [posttranslational modification]
261594014440	Histidine kinase-like ATPases; This family includes several ATP-binding proteins for example: histidine kinase, DNA gyrase B, topoisomerases, heat shock protein HSP90, phytochrome-like ATPases and DNA mismatch repair proteins; Region: HATPase_c; cd00075
261594014441	ATP binding site [chemical binding]; other site
261594014442	Mg2+ binding site [ion binding]; other site
261594014443	G-X-G motif; other site
261594014444	Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain [Signal transduction mechanisms / Transcription]; Region: OmpR; COG0745
261594014445	Signal receiver domain; originally thought to be unique to bacteria (CheY, OmpR, NtrC, and PhoB), now recently identified in eukaroytes ETR1 Arabidopsis thaliana; this domain receives the signal from the sensor partner in a two-component systems; Region: REC; cd00156
261594014446	active site
261594014447	phosphorylation site [posttranslational modification]
261594014448	intermolecular recognition site; other site
261594014449	dimerization interface [polypeptide binding]; other site
261594014450	Effector domain of response regulator. Bacteria and certain eukaryotes like protozoa and higher plants use two-component signal transduction systems to detect and respond to changes in the environment. The system consists of a sensor histidine kinase and...; Region: trans_reg_C; cd00383
261594014451	DNA binding site [nucleotide binding]
261594014452	Adenylosuccinate synthetase; Region: Adenylsucc_synt; smart00788
261594014453	Adenylosuccinate synthetase (AdSS) catalyzes the first step in the de novo biosynthesis of AMP. IMP and L-aspartate are conjugated in a two-step reaction accompanied by the hydrolysis of GTP to GDP in the presence of Mg2+. In the first step, the...; Region: AdSS; cd03108
261594014454	GDP-binding site [chemical binding]; other site
261594014455	ACT binding site; other site
261594014456	IMP binding site; other site
261594014457	replicative DNA helicase; Provisional; Region: PRK05748
261594014458	DnaB-like helicase N terminal domain; Region: DnaB; pfam00772
261594014459	DnaB helicase C terminal domain. The hexameric helicase DnaB unwinds the DNA duplex at the  chromosome replication fork. Although the mechanism by which DnaB both couples ATP hydrolysis to translocation along DNA and denatures the duplex is unknown, a...; Region: DnaB_C; cd00984
261594014460	Walker A motif; other site
261594014461	ATP binding site [chemical binding]; other site
261594014462	Walker B motif; other site
261594014463	DNA binding loops [nucleotide binding]
261594014464	50S ribosomal protein L9; Reviewed; Region: rplI; PRK00137
261594014465	Ribosomal protein L9, N-terminal domain; Region: Ribosomal_L9_N; pfam01281
261594014466	Ribosomal protein L9, C-terminal domain; Region: Ribosomal_L9_C; pfam03948
261594014467	Predicted signaling protein consisting of a modified GGDEF domain and a DHH domain [Signal transduction mechanisms]; Region: COG3887
261594014468	Class III nucleotidyl cyclases; Region: Nucleotidyl_cyc_III; cl11967
261594014469	DHH family; Region: DHH; pfam01368
261594014470	DHHA1 domain; Region: DHHA1; pfam02272
261594014471	Predicted membrane protein (DUF2232); Region: DUF2232; pfam09991
261594014472	30S ribosomal protein S18; Reviewed; Region: rpsR; PRK00391
261594014473	Single-stranded DNA-binding protein [DNA replication, recombination, and repair]; Region: Ssb; COG0629
261594014474	SSB_OBF: A subfamily of OB folds similar to the OB fold of ssDNA-binding protein (SSB). SSBs bind with high affinity to ssDNA. They bind to and protect ssDNA intermediates during DNA metabolic pathways. All bacterial and eukaryotic SSBs studied to date...; Region: SSB_OBF; cd04496
261594014475	dimer interface [polypeptide binding]; other site
261594014476	ssDNA binding site [nucleotide binding]; other site
261594014477	tetramer (dimer of dimers) interface [polypeptide binding]; other site
261594014478	30S ribosomal protein S6; Reviewed; Region: rpsF; PRK00453
261594014479	GTP-binding protein YchF; Reviewed; Region: PRK09601
261594014480	YchF GTPase; Region: YchF; cd01900
261594014481	G1 box; other site
261594014482	GTP/Mg2+ binding site [chemical binding]; other site
261594014483	Switch I region; other site
261594014484	G2 box; other site
261594014485	Switch II region; other site
261594014486	G3 box; other site
261594014487	G4 box; other site
261594014488	G5 box; other site
261594014489	TGS_YchF_C: This subfamily represents TGS domain-containing YchF GTP-binding protein, a universally conserved GTPase whose function is unknown. The N-terminal domain of the YchF protein belongs to the Obg-like family of GTPases, and some members of the...; Region: TGS_YchF_C; cd04867
261594014490	Bacterial protein of unknown function (DUF951); Region: DUF951; pfam06107
261594014491	Small-conductance mechanosensitive channel [Cell envelope biogenesis, outer membrane]; Region: MscS; COG0668
261594014492	Mechanosensitive ion channel; Region: MS_channel; pfam00924
261594014493	putative sporulation protein YyaC; Region: spore_YyaC; TIGR02841
261594014494	ParB/RepB/Spo0J family partition protein; Region: parB_part; TIGR00180
261594014495	ParB-like nuclease domain; Region: ParB; smart00470
261594014496	KorB domain; Region: KorB; pfam08535
261594014497	ATPases involved in chromosome partitioning [Cell division and chromosome partitioning]; Region: Soj; COG1192
261594014498	ParA and ParB of Caulobacter crescentus belong to a conserved family of bacterial proteins implicated in chromosome segregation. ParB binds to DNA sequences adjacent to the origin of replication and localizes to opposite cell poles shortly following the...; Region: ParA; cd02042
261594014499	P-loop; other site
261594014500	Magnesium ion binding site [ion binding]; other site
261594014501	ParA and ParB of Caulobacter crescentus belong to a conserved family of bacterial proteins implicated in chromosome segregation. ParB binds to DNA sequences adjacent to the origin of replication and localizes to opposite cell poles shortly following the...; Region: ParA; cd02042
261594014502	Magnesium ion binding site [ion binding]; other site
261594014503	nucleoid occlusion protein; Region: nucleoid_noc; TIGR04285
261594014504	ParB-like nuclease domain; Region: ParBc; pfam02195
261594014505	Predicted S-adenosylmethionine-dependent methyltransferase involved in bacterial cell division [Cell envelope biogenesis, outer membrane]; Region: GidB; COG0357
261594014506	S-adenosylmethionine-dependent methyltransferases (SAM or AdoMet-MTase), class I;  AdoMet-MTases are enzymes that use S-adenosyl-L-methionine (SAM or AdoMet) as a substrate for methyltransfer, creating the product S-adenosyl-L-homocysteine (AdoHcy); Region: AdoMet_MTases; cd02440
261594014507	S-adenosylmethionine binding site [chemical binding]; other site
261594014508	tRNA uridine 5-carboxymethylaminomethyl modification enzyme GidA; Validated; Region: PRK05192
261594014509	tRNA:m(5)U-54 methyltransferase; Region: gid_trmFO; TIGR00137
261594014510	GidA associated domain 3; Region: GIDA_assoc_3; pfam13932
261594014511	tRNA modification GTPase TrmE; Reviewed; Region: trmE; PRK05291
261594014512	GTP-binding protein TrmE N-terminus; Region: TrmE_N; pfam10396
261594014513	trmE is a tRNA modification GTPase; Region: trmE; cd04164
261594014514	G1 box; other site
261594014515	GTP/Mg2+ binding site [chemical binding]; other site
261594014516	Switch I region; other site
261594014517	G2 box; other site
261594014518	Switch II region; other site
261594014519	G3 box; other site
261594014520	G4 box; other site
261594014521	G5 box; other site
261594014522	Catalytic cysteine-containing C-terminus of GTPase, MnmE; Region: GTPase_Cys_C; pfam12631
261594014523	Predicted RNA-binding protein [General function prediction only]; Region: Jag; COG1847
261594014524	jag_K homology RNA-binding domain. The KH domain is found in proteins homologous to the Bacillus subtilis protein Jag, which is associated with SpoIIIJ and is necessary for the third stage of sporulation.  The KH motif is a beta-alpha-alpha-beta-beta...; Region: jag_KH; cd02414
261594014525	G-X-X-G motif; other site
261594014526	R3H domain found in proteins homologous to Bacillus subtilus Jag, which is associated with SpoIIIJ. SpoIIIJ is necessary for the third stage of sporulation. The name of the R3H domain comes from the characteristic spacing of the most conserved arginine...; Region: R3H_jag; cd02644
261594014527	RxxxH motif; other site
261594014528	OxaA-like protein precursor; Validated; Region: PRK02944
261594014529	Preprotein translocase subunit YidC [Intracellular trafficking and secretion]; Region: YidC; COG0706
261594014530	ribonuclease P; Reviewed; Region: rnpA; PRK00499
261594014531	50S ribosomal protein L34; Reviewed; Region: rpmH; PRK00399